CN104946651B - One kind has the specific DNA fragmentation of Rice Ovary - Google Patents

Abstract

The present invention discloses a kind of DNA fragmentation, and the DNA fragmentation is included：1), SEQ ID NO in sequence table：DNA sequence dna shown in 1；Or 2) under strict conditions with 1), described in DNA sequence dna hybridization and with promoter function DNA molecular；1) or 2) or 3), with the DNA sequence dna that limits there is more than 90% homology, and the DNA fragmentation with promoter function.The DNA fragmentation may be used as ovary specific expression promoter.Present invention also offers the expression cassette containing the DNA fragmentation, plant expression vector and it is applied in plant genetic engineering.The DNA fragmentation has important theory and practical significance for the research of paddy rice reproductive development.The present invention is in agriculture field by with wide application and market prospects.

Description

One kind has the specific DNA fragmentation of Rice Ovary

Technical field

The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to can be in water The section of DNA fragment of the expression of specific driving target gene in rice transgenic regulation system.

Background technology

The mankind are by the selection and utilization to natural mutation gene and recombinant, and the kind to crop is improved near The history of thousand.In the last hundred years, the restructuring of excellent genes and the importing of foreign gene are generally realized using the method for artificial hybridization Cultivate New Crop Varieties.Crossbreeding technology can realize kind of an interior gene transfer, still, between the kind of affiliation farther out Then there is obstacle in gene transfer；On the other hand, crossbreeding technology accurately can not select and manipulate some gene.Therefore, increase The complexity of breeding result.

The seed selection of crop varieties is carried out by the means of transgenosis, it is advantageous that transgenosis is not closed by relationship between organism The limitation of system, for the technical standpoint of transgenosis, the gene source of candidate's conversion is almost unrestricted.In addition, transgenosis skill Operated and transfer the gene of art is definite functions, the gene of control targe character, and this causes the phenotype of transgenic progeny to have more Have predictable.Current transgenic technology has become the important means of improvement of crop cultivar, genetically engineered soybean, corn, cotton Cultivated area with rape is up to the 25% of 4 kinds of total cultivated areas in the crop whole world.

Two required elements, i.e. promoter and target gene are needed in the transgenosis of plant.Promoter is to be located at base Because of the cis-regulating element of transcription initiation site upstream, combined with trans-acting factor, pass through recognition factor and RNA polymerase Interaction, the transcription of promotor gene；Therefore, the space-time of the expression pattern of promoter regulation gene, i.e. destination gene expression is special The opposite sex and expression intensity, are one of key factors of transgenosis success or failure or effect height.

Purpose for transgenosis is different, the different expression pattern of the gene selects of conversion, mainly includes the high table of composing type Reach, tissue specific expression and inducible expression etc..The golden gemma bars of Su Yun are such as transferred in cotton, corn, paddy rice crops The insect resistance protein of bacterium uses the high expression way of composing type, and the advantage of high dose expression Bt insect resistance proteins is height in crop Dosage may insure the effect of desinsection, while being conducive to extending the term of validity of Bt insect resistance proteins.During the initiative of golden paddy, Its target is the route of synthesis by introducing vitamin A precursor in paddy endosperm, so that the enhanced vitamin A in rice, Solve the problem of vitamin A nutritional lacks；Therefore, the promoter used during transgenosis for the specifically expressing in paddy endosperm paddy Protein promoter.In the conversion of plant disease resistance genes, the promoter expressed frequently with pathogenic bacterium inducing.

Paddy rice is the representative plant of monocotyledon Cereal, different from dicotyledon, and with monocotyledonous Multinomial advantage, is the ideal material for studying flower development, but the research of paddy rice flower development mechanism lags far behind dicotyledon.

The content of the invention

Therefore, in view of the above-mentioned problems, the present invention is carefully studied for paddy rice flower development mechanism.And studying Journey, lays particular emphasis on the expression of related gene in Rice Ovary, obtains a DNA fragmentation, it has ovary expression specificity, Ke Yiyong In driving some functional genes specific expressed in ovary or structural gene, this quality-improving and paddy rice for Rice Panicle The raising of yield have great importance.

Have also obtained for the present invention obtains expression cassette and recombinant vector containing above-mentioned DNA fragmentation, and the present invention also profit Corresponding genetically modified plants are obtained with the DNA fragmentation.Wherein, involved " plant " herein refers to monocotyledon, example Such as paddy rice, wheat, corn, barley, jowar or oat, preferably paddy rice.

To achieve these goals, on the one hand, the present invention provides a kind of DNA fragmentation, the DNA fragmentation is included：

1) SEQ ID NO in sequence table：DNA sequence dna shown in 1；Or

2) under strict conditions with 1) described in DNA sequence dna hybridization and with promoter function DNA molecular；Or

1) or 2) 3) there is more than 90% homology, and the DNA with promoter function points with the DNA sequence dna that limits Son.

And 3) 2) sequence and SEQ ID No in:DNA sequence dna shown in 1 has identical function, that is, drives target gene Expressed in plant, wherein,

SEQ ID NO：Sequence is shown in 1:

It should be noted that：In the DNA sequence dna of above-mentioned promoter, the sequence " tccacaggat of sequence beginning Tcacaataac gt " amount to 22bp to obtain the retention sequence of the forward primer used during promoter；The sequence at sequence end " at tgcctctacc atactcggtg " amount to 22bp to obtain the retention sequence of the reverse primer used during promoter row Row (the retention sequence and the corresponding sequence of reverse primer are complementary)；Remaining part is then obtained from Nipponbare water in the DNA sequence dna DNA sequence dna in rice.It is emphasized that promoter mentioned herein can both refer to above-mentioned whole DNA sequence dna, can also Refer to and remove the DNA sequence dna after above-mentioned primer retention sequence.Even if it should be noted that base of the those skilled in the art in the present invention On plinth, similar sequence is obtained using other primers, it is also fallen within protection scope of the present invention.

Preferably, DNA sequence dna of the present invention is SEQ ID No:Sequence shown in 1.

Preferably, SEQ ID No in sequence table:DNA sequence dna shown in 1 is used as Rice Ovary specific expression promoter.

SEQ ID No in sequence table:DNA sequence dna shown in 1 can extract from paddy rice platymiscium, preferably Nipponbare paddy rice (Oryza sativa L cv.Nipponbare), referred to herein as OsOva1 or promoter OsOva1.Specifically, the application Inventor find Nipponbare paddy rice (Oryza sativa L cv.Nipponbare) upstream region of gene include transcription initiation site The DNA sequence dna of 1970bp inside, with driving target gene function specific expressed in Rice Ovary, and is separated gram Function that is grand and identifying the DNA sequence dna.However, it is desirable to explanation, follow-up people manually close according to the disclosure of invention Into identical sequence be also contained in the scope of the present invention.

On the other hand, the present invention also provides a kind of expression cassette that promoter is expressed comprising above-mentioned Rice Ovary high specificity.

On the other hand, the present invention also provides one group of total length for being used to expand the DNA fragmentation described in claim 1 or its is any The primer pair of fragment, it is characterised in that the primer pair includes the first primer and the second primer, the DNA sequences of first primer Row include fragment：TCCACAGGATTCACAATAACGT；The DNA sequence dna of second primer includes fragment： ATTGCCTCTACCATACTCGGTG。

Another aspect, the present invention also provides a kind of recombinant expression carrier, and the recombinant expression carrier is to express to carry in plant Body pCAMBIA1391 multiple cloning sites insert the recombinant plasmid that the DNA fragmentation is obtained, in the recombinant expression carrier, The Rice Ovary specific expression promoter OsOva1 is connected to the upstream of gene order to be expressed in carrier；It is preferred that, institute It is to have the gene for improving function to Rice Ovary to state gene to be expressed.Gene is driven in ovary by the promoter of the present invention It is specific expressed, so as to reach the effect of Crop Improvement character.

Another further aspect, the present invention provides above-mentioned Rice Ovary high specificity expression promoter in genetically modified plants are cultivated Using.The application include providing the present invention above-mentioned Rice Ovary high specificity expression promoter is connected to carrier treats table The gene order upstream (for example, the promoter sequence is placed in before target gene) reached, so that recombinant expression carrier is built, The recombinant expression carrier is transformed into plant cell, tissue or organ and cultivated.

In summary, the inventors found that, extract and identify Nipponbare paddy rice (Oryza sativa L Cv.Nipponbare) 1970bp of the OsOva1 upstream region of gene including transcription initiation site DNA sequence dna, and being named For promoter OsOva1.The sequence is connected to after digestion on plant binary expression vector pCAMBIA1391, obtains corresponding Recombinant plasmid (i.e. recombinant expression carrier), using recombinant plasmid transformed Agrobacterium tumefaciens strain EHA105, then uses Agrobacterium The method of mediation carries out the conversion of paddy rice, obtains transgenic rice plant.Gus histochemistries are carried out to the transgenic paddy rice of acquisition Dyeing detection finds that transfer-gen plant only has Gus expression at ovary position, so that proving the sequence of the 1970bp has driving base Because of the activity expressed in ovary site specific.

Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter. Also, the promoter sequence can be connected with required target gene, build recombinant plant expression vector, it is inverted after, in water The expression of the driving target gene of the ovary site specific of rice, increases the effect of transgenosis, improves the characteristic of paddy rice.

Technique effect

The rice starter OsOva1 that is cloned of the present invention can controlling gene specificity in Rice Ovary concentrate expression, There is significantly value in actual applications.Genetic modification is carried out to variety of crops by the promoter, such as passes through the promoter Driving target gene is expressed in plant, can be improved and be improved the reproductive characteristic of paddy rice, so as to cultivate preferable transgenosis Plant variety.

Brief description of the drawings

Hereinafter, embodiment of the present invention is described in detail with reference to accompanying drawing, wherein：

Fig. 1 is that OsOva1 promoters are implemented in A in schematic diagram in pCAMBIA1391 vector plasmids, wherein Fig. 1 to be B is pCAMBIA1391-OsOva1 schematic diagrames in pCAMBIA1391 schematic diagrames, Fig. 1, illustrated therein is and utilizes OsOva1 promoters The Gus gene expressions of driving downstream；

Fig. 2 is the result schematic diagram that digestion verification is carried out to promoter of the present invention；

Fig. 3 is the OsOva1 of 12 weeks seedling ages::GUS transfer-gen plant tissue staining figures.(scale=5mm).Root, stem, The blueness for representing GUS activity is not observed in leaf, sheath tissue, and in spending, only has in the ovary of gynoecium base portion Blueness occurs, and GUS activity is not all shown in glume, stamen yet.

Embodiment

Illustrate the present invention referring to specific embodiment.It will be appreciated by those skilled in the art that these embodiments are only For illustrating the present invention, it does not limit the scope of the present invention in any way.

Experimental method in following embodiments, is conventional method unless otherwise specified.Medicine used in following embodiments Material raw material, reagent material etc., unless otherwise specified, are commercially available products.

The acquisition of OsOva1 promoters containing restriction enzyme site

Step 1, the design of primer

According to rice varieties Nipponbare (the Oryza sativa L cv.Nipponbare) full-length genome provided in NCBI Sequence, according to the sequences Design amplimer of rice Os Ova1 genes, and according to the characteristics of the carrier and target gene of selection, if Count the restriction enzyme site of primer.

CAMBIA (is come from, open to use carrier, peace with paddy rice binary expression vector pCAMBIA1391 in this experimental example Genetically modified organism product composition supervision and inspection center of the emblem Ministry of Agriculture of Shanxi Academy of Agricultural Sciences paddy rice group is preserved) exemplified by, target base Because Gus genes, the primer of specific design is：Forward primer (SEQ ID No:2) 5 ' end band HindIII, restriction enzyme site (AAGCTT), reverse primer (SEQ ID No:3) 5 ' end band EcoRI, restriction enzyme site (GAATTC), primer sequence is as follows：

Forward primer：AAGCTTTCCACAGGATTCACAATAACGT HindIII

Reverse primer：GAATTCCACCGAGTATGGTAGAGGCAAT EcoRI

By Shenzhen, Huada gene company is synthesized.

The acquisition of step 2, promoter OsOva1

Using rice varieties Nipponbare DNA as template, promoter OsOva1 is expanded using forward primer, reverse primer, by normal PCR system is advised, using following amplification program：

95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min30s, are circulated 35 times；Finally 72 DEG C of extension 10min.

The purpose fragment of PCR amplifications is reclaimed, purpose fragment length 1970bp is connected to the (purchase of PGEM-T-Easy carriers From Promega companies, mixed in the ratio in carrier specification) on, convert Escherichia coli XL-Blue competence according to cold shock method After cell, competent cell is activated, and then purpose fragment is transferred to the competent cell of activation, then, sieved through bacterium colony PCR Choosing obtains positive colony, and picking monoclonal bacterium solution upgrading grain carries out double digestion checking, as shown in Figure 2 with HindIII and EcoRI. Positive colony by identification is sent and the sequencing of Invitrogen companies.The correct clone of checking is the promoter to be obtained OsOva1, its nucleotide sequence such as SEQ ID No:Shown in 1.

The structure of plant expression vector and the conversion of Agrobacterium

Extract plasmid in the positive colony obtained from above during " promoter OsOva1 acquisition ", with HindIII and EcoRI digestions, reclaim promoter OsOva1 fragments.PCAMBIA1391 is linearized using HindIII and EcoRI simultaneously Processing, recovery pCAMBIA1391, (contain Gus by above-mentioned OsOva1 fragments and pCAMBIA1391 fragments in pCAMBIA1391 Gene) it is attached with T4 ligases (being purchased from TaKaRa companies), obtain promoter OsOva1 and Gus Gene Fusions plant table Up to carrier pCAMBIA1391-OsOva1, plant expression vector is transferred to Agrobacterium tumefaciems (Agrobacterium using freeze-thaw method Tumefaciens) EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture water Rice group is preserved).

Expressed using promoter OsOva1 driving Gus reporter genes in paddy rice

Step 1：Agriculture bacillus mediated rice transformation

Ripe rice paddy seed is removed after glume, with 70% alcohol-pickled seed 1min, alcohol is outwelled.Dripped with containing 1 Tween20 50% sodium hypochlorite (stoste effective chlorine density is more than 4%) solution immersion seed 40min (150r/min).Outwell Sodium hypochlorite, sterile washing 5 times to solution clarification, no sodium hypochlorite taste.Sterilized water immersion seed is stayed overnight.Planted with scalpel edge The aleurone of son peels embryo, and embryo is inoculated on calli induction media.At 30 DEG C light culture after 11 days by callus and endosperm And germ separation, it is used for agriculture bar after the primary callus in good condition, that division is vigorous for removing bud is carried out into preculture 3~5 days The conversion of bacterium.

Using it is above-mentioned " plant expression vector structure and Agrobacterium conversion " during be transferred to recombinant expression carrier Agrobacterium tumefaciems carries out Agrobacterium-mediated genetic transformation, obtains OsOva1::GUS transgenic rice plants, the genetic transformation, Transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phOsphomannOse isomerase pOsitive selection in Japonica rice(Oryza sativa L.)[J].Plant Cell Report,2012.DOI10.1007/s00299- The method of proposition such as 01201275-3.).

The histoorgan dyeing of step 2, transgenic paddy rice seedling

The histoorgan of the transgenic paddy rice of OsOva1 promoters will be converted, i.e. root, stem, leaf, floral organ carries out GUS respectively Dyeing：Each tissue is dipped in GUS dyeing liquors respectively, 37 DEG C, 24 hours overnight, 75% ethanol decolorization was green by the leaf in tissue Element is taken off.Then the result of GUS dyeing is observed and recorded under disecting microscope.As a result as shown in figure 3, gus gene is only turning The ovary of trans-genetic hybrid rice children's fringe is coloured to the very strong blueness that naked eyes can be observed substantially；And other each organs for example root, stem, In the style and column cap of blade, leaf sheath and gynoecium, the expression of gus gene is not detected substantially.This shows that of the invention opens Mover can specifically instruct gus protein downstream to express in the ovary of transfer-gen plant, and this expression has ovary Tissue expression specificity.

Specific description of embodiments of the present invention above is not intended to limit the present invention, and those skilled in the art can be according to this Invention is variously modified or deformed, and without departing from the spirit of the present invention, all should belong to the model of appended claims of the present invention Enclose.

Claims (9)

1. a kind of DNA fragmentation, it is characterised in that DNA fragmentation SEQ ID NO in sequence table：DNA sequence dna structure shown in 1 Into, the DNA fragmentation is used as ovary specific promoter,

SEQ ID NO：Sequence is shown in 1:

2. DNA fragmentation according to claim 1, it is characterised in that the DNA fragmentation extracts from Nipponbare paddy rice.

3. one group of total length or the primer pair of its any fragment for being used to expand the DNA fragmentation described in claim 1, its feature exists In the primer pair includes the first primer and the second primer, and the DNA sequence dna of first primer includes fragment： TCCACAGGATTCACAATAACGT；The DNA sequence dna of second primer includes fragment：CACCGAGTATGGTAGAGGCAAT.

4. a kind of recombinant vector of the DNA fragmentation containing described in claim 1, it is characterised in that the recombinant expression carrier is The recombinant plasmid that the DNA fragmentation described in multiple cloning sites insertion claim 1 in plant expression vector is obtained, in the restructuring In expression vector, the DNA fragmentation is connected to the upstream of gene order to be expressed in carrier.

5. recombinant vector according to claim 4, it is characterised in that the gene to be expressed is to have to ovary position character There is the gene for improving function.

6. a kind of expression cassette, it is characterised in that the expression cassette includes the DNA fragmentation described in claim 1.

7. a kind of application of DNA fragmentation according to any one in claim 1 in genetically modified plants are cultivated, its feature It is, the application includes：DNA fragmentation according to claim 1 is connected to gene order to be expressed in carrier Upstream, so as to build recombinant expression carrier；The recombinant expression carrier is transformed into plant cell, tissue or organ and trained Educate.

8. application according to claim 7, it is characterised in that the application is used for improving plant growth characteristic, the plant Thing is paddy rice.

9. application according to claim 7, it is characterised in that the gene to be expressed is to have specific function to ovary position Gene.