CN105018496A - DNA fragment pENP5 with endosperm specific expression characteristic and application of DNA fragment pENP5 - Google Patents
DNA fragment pENP5 with endosperm specific expression characteristic and application of DNA fragment pENP5 Download PDFInfo
- Publication number
- CN105018496A CN105018496A CN201510493103.0A CN201510493103A CN105018496A CN 105018496 A CN105018496 A CN 105018496A CN 201510493103 A CN201510493103 A CN 201510493103A CN 105018496 A CN105018496 A CN 105018496A
- Authority
- CN
- China
- Prior art keywords
- dna
- penp5
- expression vector
- plant
- dna fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a DNA fragment pENP5 with the endosperm specific expression characteristic and application of the DNA fragment pENP5. The invention discloses the DNA fragment. The DNA fragment comprises (1), a DNA sequence shown in SEQ ID NO:1 in a sequence table; or (2), DNA molecules hybrid with the DNA sequence in (1) under a strict condition, wherein the DNA molecules have the promoter functions; or (3), a DNA fragment with the promoter functions, wherein homology between the DNA fragment and the DNA sequence defined in (1) or (2) is larger than 90%. The DNA fragment can be used as an endosperm specific expression promoter. The invention further provides an expression box with the promoter and a plant expression vector with the promoter. The expression box with the promoter and the plant expression vector with the promoter are applied to plant genetic engineering. The DNA fragment pENP5 with the endosperm specific expression characteristic and the application of the DNA fragment pENP5 have wide application and market prospects.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to a kind of rice endosperm specific expression promotor pENP5 and application thereof, this promotor plant, can be expressed in the endosperm of especially paddy rice by specific driving target gene in Transgenic Rice adjustment and control system.
Background technology
Paddy rice is the most important food crop of China, and the daily edible rice of people is the endosperm of paddy rice, the formation of endosperm and grow the yield and quality directly affecting paddy rice, and endosperm is also an excellent expression of recombinant proteins system simultaneously.The common problem that high-yield rice kind exists at present is that Cooking Quality is poor, far can not adapt to the requirement of raising to rice quality of living standards of urban and rural residents level.Rice quality is poor, and price is relative also lower, and volume increase can not increase income, and thus dampens the kind grain enthusiasm of peasant.
The major cause of these high-yield variety Cooking Quality differences is caused to be that the amylose content of the grain of rice is higher.Starch in rice paddy seed endosperm can be divided into amylose starch and amylopectin two kinds, and the amylose content in different rice varieties rice endosperm is different, and rice variety is generally 20% ~ 30%, and japonica rice variety is 15% ~ 22%, and glutinous rice is 0 ~ 2%.Amylose content is higher, often makes that meal qualitative change is hard, mouthfeel is poor.
So-called tissue-specific promoter refers to except having the structure of general promotor, usually also has the general characteristic of enhanser and silencer.Under the regulation and control of tissue-specific promoter, the expression of gene usually only occurs in some specific organ or tissue position, and usually shows the characteristic of Growth adjustment.The regulation and control of these promotors are often subject to the induction of the material such as histocyte physiological status and chemical physics signal, are also subject to the regulation and control of etap, and its expression is the result of multiple factor interaction.
Fruit and seed are the reproductive organ of plant, are also the main storage site of nutritive substance.Utilize the organ specific promoters regulate gene expressions such as fruits and seeds, not only can improve the expression amount of gene at these positions, biological energy consumption is dropped to minimum, is beneficial to the separation of expression product, and on purpose can improve the nutrition of transgenic plant fruits and seeds or improve its quality.Sandhu etc. utilize the E8 promotor promotor of ethylene response gene (in the mature fruit) to drive respiratory syncystial virus F antigen gene successful conversion tomato plant, with fruit specific expression antigen feeding mice, special mucosal immunoreaction, serology antibody response and Th1 type cell immune response (Sandhu etal., 2000) can be produced by inducing mouse.The rice endosperm specific glutenin gene promoters driven soybean ferritin gene such as Vasconcelos, in render transgenic rice grain, the content of iron and zinc increases all to some extent, and ferritin is mainly accumulated in endosperm, can not lose in food processing process (Vasconcelos et al., 2003).Researchist has also been separated the cis-acting elements of some endosperm specific expressions in some monocotyledonous seed storage proteins, and it is necessary (Wu et al., 1998) that foremost GCN4 element is considered to maintenance endosperm specific expression activity.But also have reported in literature, GCN4 element is only play the effect strengthening the expression intensity of promotor in endosperm, and it can not determine the characteristic (Vickers et al., 2006) of promotor endosperm specific expression.In addition, in some seeds, promotor such as PsGNS2 promotor (Buchner et al., 2002), FAE1 (Rossak et al., the 2001) promotor etc. of specifically expressing also has relevant report.
Screen be separated some have tissue specificity, high expression level DNA fragmentation and analyze the function of relevant important specific regulatory control element, in genetically engineered research, have purposes widely.Endosperm is the most important components of grain effect nutrition, and the improvement of DNA fragmentation to plant quality being therefore separated endosperm-specific strongly expressed has great importance.
Summary of the invention
The object of this invention is to provide a kind of there is endosperm specific expression characteristic DNA fragmentation, obtain containing the transformant of this DNA fragmentation and the application of this promotor.Wherein, involved herein " plant " refers to monocotyledons, such as paddy rice, wheat, corn, barley, jowar or oat, is preferably paddy rice.
To achieve these goals, on the one hand, the invention provides a kind of DNA fragmentation with endosperm specific expression characteristic, described DNA fragmentation comprises:
1) DNA sequence dna shown in SEQ ID NO:1 in sequence table; Or
2) under strict conditions with 1) described in DNA sequence dna hybridize and there is the DNA molecular of promoter function; Or
3) with 1) or 2) DNA sequence dna that limits have more than 90% homology, and there is the DNA molecular of promoter function.
2) DNA sequence dna shown in the sequence and 3) with SEQ ID No:1 has identical function, namely drives target gene to express in plant.
Preferably, DNA sequence dna of the present invention is the sequence shown in SEQ ID No:1.
Preferably, in sequence table, the DNA sequence dna shown in SEQ ID No:1 can be used as rice endosperm specific expression promotor.
In sequence table, the DNA sequence dna shown in SEQ ID No:1 can extract from Japanese fine paddy rice (Oryzasativa L cv.Nipponbare), is called pENP5 or promotor pENP5 herein.Specifically, present inventor finds that Japanese fine paddy rice (Oryza sativa L cv.Nipponbare) upstream region of gene comprises the DNA sequence dna of the 2062bp of transcription initiation site, have and drive the function specific expressed in paddy endosperm of target gene, and separating clone identify the function of this DNA sequence dna.But needs illustrate, the identical sequence of follow-up people synthetic according to the disclosure of invention is also contained in scope of the present invention.
On the other hand, the present invention also provides a kind of expression cassette comprising above-mentioned rice endosperm specific strongly expressed promotor.
On the other hand, the present invention also provides one group for the total length of the DNA fragmentation according to claim 1 that increases or the primer pair of its any fragment, it is characterized in that, described primer pair comprises the first primer and the second primer, and the DNA sequence dna of described first primer comprises fragment: CACAGAAACACACAGGGGATGT; The DNA sequence dna of described second primer comprises fragment: TTTTGTAGGATTCTACTACTAT.
Another aspect, the present invention also provides a kind of recombinant expression vector, described recombinant expression vector is insert in the multiple clone site of plant expression vector pCAMBIA1391 the recombinant plasmid that described DNA fragmentation obtains, in described recombinant expression vector, described rice endosperm specific expression promotor pENP5 is connected to the upstream of gene order to be expressed in carrier; Preferably, described gene to be expressed is gene paddy endosperm being improved to function.Specific expressed in endosperm by promoters driven gene of the present invention, thus reach the effect of Crop Improvement proterties.
Again on the one hand, the invention provides above-mentioned rice endosperm specific strongly expressed promotor and cultivate the application in transgenic plant.Described application comprises above-mentioned rice endosperm specific strongly expressed promotor provided by the invention is connected to the gene order upstream to be expressed of carrier (such as, before described promoter sequence is placed in target gene), thus structure recombinant expression vector, described recombinant expression vector is transformed in vegetable cell, tissue or organ and cultivates.
And preferably, described application may be used for improving plant growth characteristic, described plant is monocotyledons, such as paddy rice, wheat, corn, barley, jowar or oat, is preferably paddy rice.
The DNA sequence dna of the promotor provided in the present invention is (identical with SEQ ID No:1 in sequence table):
TTTAAACTCCAATTTTTATATATTTGGCATTATTCAAATTGCAAACAAATATGATGACTCTCTTTCTCAAAGAAACATATGCCGTTAGGGTGATCCCAGCGCTTCACTTAGAATGGTTTTTCATAGCATTAAATGATATGCCACGTAGGAAAAAACATGATGTGCCATTTTATTAACTTAGGAAAGAGAAGAAAATTGGGTCTTCTCAAAATGATCATCATCTAACAAAATGTCTCTTTGTTTATTTGTGCAAAGAGTAAATGTGCATCGTGCAATGTCATGCATGCTGCCAACCAAGATTAATTTCTATTTAGTTGAACCTGTGCAACATTTAAAGTGTGAAGTAATTTTTGTTGGACTTGAAGCGACAAAGCACCTTGGTCGATTAGGCCATCCCCAACCCATGGTGTCCATGGGTGGTGTCTAGAGCAGTGAGAGATCAATAAATGCATATATGGACACTACCTCCCCATTGCATCGTTTATATACCAGTTTTCATAGGCAAAAAAAAATTAGTAGCTCTTTGCATGTAACATTAACAGAGGAGGGTCAGCTGTGGCAAGCAAGCAAGCAGACGCGGGAGGGGAGGCGCGCAGCAGGCATGGTGACGGGGTAGGGCGCAGCGGATCGAGATGCGAGGATTTTTTTTTGGGGGGGTGGGGTGGGGGGAGAGAAACGAGTCATCCAACCCAACGCGGATTTAGCTAGTTTCCAGTGCCTTGGAACAGCCGCCGAAACGGTGTCGCGCATGCGACCTGGTTTCTATGTTTTTGCTTCTTTCTCTTCTTTTATTCCGTTGCCACATCAACTTTTTGTCTAGTTGGCAGCCTAATTAATTCTATGGAAACCAGGTGACATGGAGGGTTGGGGACATGGTGGAAAAAACCGGAACGGGCCGACAGTTCAACCGGAAAAAACCAGAACCCGTTCAGTTCAAAAGAAAGACCGGACATGCATATGACCCGCTTTGAACCGGCAGAACCGGTCGGTTTTTCTATGAACCGGTCATTAAACCGTCCCCGGTTAGACCGAACAAGCCACAATAATCTTGAAATGGGCCTTGATGTGGCCCAATTGGTCTGCCTAGAGCGTTTTGGTTGGCAAAAATCAATCTCCTATTCTCGGCACGTGTGATATACAATGGTAAGTGAGATATACAATTCTCGGCACGGCTACATTACAAGGTGTCGCATTGTGTCAATGTTTGGTTAATTTGCTAGATTCACATAATACATGCCAGGAAGTTCAGAACAATGTGTTGCCTTTCACCGGAAAACTTTGTTGGAGCAAATGCCTTCTTCTTTTTTGCTTCTGCTTCTTGAGTCCATGTGGAGGAAGCAGTAGATAGCTGATGATATCAGGATTCCTTCTGTGTCTGTGTAGGTGTAGCAACACCACTATAATTTTTATTTAGCAACACAATATCAATTTGGTCTATAAAAGTATGAATTAAATCAATCCCCAACCACAATTAGAGTAAGTTGGTGAGTTATTGTAAAGCTCTGCAAAGTTAATTTAAAAGTTATTGCATTAACTTATTTCGTATCACAAACAAGTTTTCACAAGAGTATTAATGGAACAATGAAAACCATTGAACATACTATAATTTTTTTTCTTACTGAAATTATATAATTCAAAGAGCATAAACCCACACAGTCGTAAAGTTCCACGTGTAGTGCATTATCAAAATAATAGCTTACAAAACATAACAAACTTAGTTTCAAAAGTTGCAATCCTTATCACATTGACACATAAAGTGAGCGATGAGTCATGTCATTATTTTTTTGCTCACCATCATGTATATATGATGGGCATAAAAGTTACTTTGATGATGATATCAAAGAACATTTTTAGGTGCACCTAACAGAATATCCAAATAATATGACTCACTTAGATCCTAATATAGCATCAAGCAAAACTAACACTCTAAAGCAACCGATAGGGAAACATCTATAAATAGACAAGCATAATGAAAACCCTCCTCATCCTTCACACAATTCAAACATTATAGTTGAAGC
It should be noted that: in the DNA sequence dna of above-mentioned promotor, sequence beginning is with italic and the sequence " CACAGAAACACACAGGGGATGT " that overstriking represents is the retention sequence obtaining the forward primer used in promotor process, amounts to 22bp; Sequence end is with italic and the sequence " ATAGTAGTAGAATCCTACAAAA " that overstriking represents is the retention sequence (corresponding sequence of this retention sequence and reverse primer is complementary) obtaining the reverse primer used in promotor process, amounts to 22bp; In this DNA sequence dna, remaining part is then available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that mentioned promotor both can refer to above-mentioned whole DNA sequence dna herein, also can refer to the DNA sequence dna after removing above-mentioned primer retains sequence.It should be noted that, even if those skilled in the art are on basis of the present invention, adopt other primers to obtain similar sequence, it also falls within protection scope of the present invention.
In sum, the present inventor finds, extract and identify the DNA sequence dna that Japanese fine paddy rice (Oryzasativa L cv.Nipponbare) pENP5 upstream region of gene comprises the 2062bp of transcription initiation site, and by its called after promotor pENP5.This sequence is connected to after enzyme is cut on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (i.e. recombinant expression vector), utilize this recombinant plasmid transformed Agrobacterium tumefaciens strain EHA105, then carry out the conversion of paddy rice by agriculture bacillus mediated method, obtain transgenic rice plant.Carry out Gus histochemical stain to the transgenic paddy rice obtained and detect discovery, transfer-gen plant only has Gus to express at endosperm position, thus proves that the sequence of this 2062bp has the activity driving gene to express at endosperm site specific.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.Further, this promoter sequence can be connected with required target gene, builds recombinant plant expression vector, after transforming, in the expression of the driving target gene of the endosperm site specific of paddy rice, increases genetically modified effect, the characteristic of improvement paddy rice.
Technique effect
The rice starter pENP5 that the present invention clones regulatory gene specificity in paddy endosperm can concentrate expression, has remarkable value in actual applications.By this promotor, genetic modification is carried out to variety of crops, as expressed in plant endosperm by this promoters driven target gene, can improve and improve the reproductive characteristic, Specific character etc. of paddy rice, thus cultivating desirable transgenic plant kind.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 is schematic diagram pENP5 promotor be implemented in pCAMBIA1391 vector plasmid, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, in Fig. 1, B is pCAMBIA1391-pENP5 schematic diagram, illustrated therein is the Gus genetic expression utilizing pENP5 promoters driven to be positioned at its downstream;
Fig. 2 is the result schematic diagram of promotor of the present invention being carried out to digestion verification;
Fig. 3 is the root (a) of ripe plant (90 days), stem (b), leaf (c), the mature seed (d) of band shell and vertical section (e) thereof and cross section (f).The activity of the blue signal reaction promotor that Gus dyeing produces.As figure shows, on root, stem, leaf and kind shell, Gus reporter gene is not all expressed, and also only has very faint expression in protoblast, and main blue signal is concentrated and come across in albuminous cell, shows that pENP5 promotor has the characteristic of endosperm specific expression.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiments are only for illustration of the present invention, its scope do not limited the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Medicinal raw material used in following embodiment, reagent material etc., if no special instructions, be commercially available purchase product.
the acquisition of the pENP5 promotor containing restriction enzyme site
The design of step 1, primer
According to the rice varieties Japan provided in NCBI fine (Oryza sativa L cv.Nipponbare) whole genome sequence, according to the sequences Design amplimer of paddy rice pENP5 gene, and according to the feature of the carrier selected and target gene, the restriction enzyme site of design primer.
(CAMBIA is come from paddy rice binary expression vector pCAMBIA1391 in this experimental example, openly use carrier, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) be example, target gene is Gus gene, the primer of specific design is: forward primer (SEQ ID No:2) 5 ' end band HindIII, restriction enzyme site (AAGCTT), reverse primer (SEQ ID No:3) 5 ' end band SalI, restriction enzyme site (GTCGAC), primer sequence is as follows:
Forward primer: AAGCTTCACAGAAACACACAGGGGATGT HindIII
Reverse primer: GTCGACTTTTGTAGGATTCTACTACTAT SalI
Synthesized by Shenzhen Hua Da genome company.
The acquisition of step 2, promotor pENP5
With the fine DNA of rice varieties Japan for template, utilize the amplification of forward primer, reverse primer promotor pENP5, routinely PCR system, adopt following amplification program:
95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 2min30s, circulate 35 times; Last 72 DEG C extend 10min.
Reclaim the object fragment of pcr amplification, object fragment length 2062bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, ratio mixing in carrier specification sheets) on, after cold shock method transformation of E. coli XL-Blue competent cell, competent cell is activated, and then object fragment is transferred to the competent cell of activation, then, screen through bacterium colony PCR and obtain positive colony, picking mono-clonal bacterium liquid upgrading grain, carries out double digestion checking with HindIII and SalI, as shown in Figure 2.Positive colony through qualification is sent and the order-checking of Invitrogen company.Verify that correct clone is the promotor pENP5 that will obtain, its nucleotide sequence is as shown in SEQ ID No:1.
the structure of plant expression vector and the conversion of Agrobacterium
Extract plasmid in the positive colony obtained " acquisition of promotor pENP5 " process from above, cut with HindIII and SalI enzyme, reclaim promotor pENP5 fragment.Utilize HindIII and SalI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned pENP5 fragment is connected with pCAMBIA1391 fragment T4 ligase enzyme (being purchased from TaKaRa company), obtain the plant expression vector pCAMBIA1391-pENP5 of promotor pENP5 and Gus gene fusion, freeze-thaw method is utilized plant expression vector to be proceeded to agrobacterium tumefaciens (Agrobacteriumtumefaciens) EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved).
promotor pENP5 is utilized to drive Gus reporter gene to express in paddy rice
Step 1: agriculture bacillus mediated rice transformation
After mature seed removes clever shell, with 70% alcohol-pickled seed 1min, outwell alcohol.With 50% clorox (stoste effective chlorine density is greater than 4%) the solution soaking seed 40min (150r/min) containing 1 Tween20.Outwell clorox, aseptic washing is clarified, without clorox taste to solution for 5 times.Sterilized water soaks seed and spends the night.With the aleurone layer of scalper along seed, embryo is peeled, embryo is inoculated on calli induction media.At 30 DEG C light culture after 11 days by callus and endosperm and germ separation, by go bud in good condition, divide vigorous elementary callus and carry out preculture is used for Agrobacterium conversion after 3 ~ 5 days.
The agrobacterium tumefaciens having proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process is adopted to carry out Agrobacterium-mediated genetic transformation, obtain pENP5::Gus transgenic rice plant, this genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to YongboDuan (Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughputprotocol for Agrobacterium mediated transformation based onphOsphomannOse isomerase pOsitive selection in Japonica rice (Oryza sativaL.) [J] .Plant Cell Report, method 2012.DOI10.1007/s00299-01201275-3.) etc. proposed.
The histoorgan dyeing of step 2, transgenic paddy rice seedling
To transform the histoorgan of the transgenic paddy rice of pENP5 promotor, namely root, stem, leaf, seed carry out Gus dyeing respectively: be dipped in Gus staining fluid respectively by each organizing, and 37 DEG C, spend the night 24 hours, 75% ethanol decolorization, are taken off by the chlorophyll in tissue.Then observe under dissecting microscope and record Gus dyeing result.Result as shown in Figure 3, in root, stem, blade and kind shell, does not substantially detect the expression of Gus gene, only has very faint expression in protoblast yet.Endosperm is then coloured to the very strong blueness that naked eyes can obviously observe and (it should be noted that, although consider in patent application and change Fig. 3 into gray level image to the requirement of picture, from the colour darkness of Fig. 3, still can tell the difference of each position coloration result).This shows, promotor of the present invention can instruct the Gus protein expression in its downstream specifically in the endosperm of transfer-gen plant, and this expression has endosperm tissue expression specificity.
Specific description of embodiments of the present invention does not above limit the present invention, and those skilled in the art can make various change or distortion according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Although be described in detail principle of the present invention in conjunction with the preferred embodiments of the present invention, it should be appreciated by those skilled in the art that above-described embodiment is only the explanation to exemplary implementation of the present invention above, not the present invention is comprised to the restriction of scope.Details in embodiment does not form limitation of the scope of the invention; when not deviating from the spirit and scope of the present invention; the apparent changes such as any equivalent transformation based on technical solution of the present invention, simple replacement, all drop within scope.
Claims (9)
1. have a DNA fragmentation for endosperm specific expression characteristic, it is characterized in that, described DNA fragmentation comprises:
1) DNA sequence dna shown in SEQ ID NO:1 in sequence table; Or
2) under strict conditions with 1) described in DNA sequence dna hybridize and there is the DNA molecular of promoter function; Or
3) with 1) or 2) DNA sequence dna that limits have more than 90% homology, and there is the DNA molecular of promoter function, wherein:
Shown in SEQ ID NO:1, DNA sequence dna is:
CACAGAAACACACAGGGGATGTTTTAAACTCCAATTTTTATATATTTGGCATTATTCAAATTGCAAACAAATATGATGACTCTCTTTCTCAAAGAAACATATGCCGTTAGGGTGATCCCAGCGCTTCACTTAGAATGGTTTTTCATAGCATTAAATGATATGCCACGTAGGAAAAAACATGATGTGCCATTTTATTAACTTAGGAAAGAGAAGAAAATTGGGTCTTCTCAAAATGATCATCATCTAACAAAATGTCTCTTTGTTTATTTGTGCAAAGAGTAAATGTGCATCGTGCAATGTCATGCATGCTGCCAACCAAGATTAATTTCTATTTAGTTGAACCTGTGCAACATTTAAAGTGTGAAGTAATTTTTGTTGGACTTGAAGCGACAAAGCACCTTGGTCGATTAGGCCATCCCCAACCCATGGTGTCCATGGGTGGTGTCTAGAGCAGTGAGAGATCAATAAATGCATATATGGACACTACCTCCCCATTGCATCGTTTATATACCAGTTTTCATAGGCAAAAAAAAATTAGTAGCTCTTTGCATGTAACATTAACAGAGGAGGGTCAGCTGTGGCAAGCAAGCAAGCAGACGCGGGAGGGGAGGCGCGCAGCAGGCATGGTGACGGGGTAGGGCGCAGCGGATCGAGATGCGAGGATTTTTTTTTGGGGGGGTGGGGTGGGGGGAGAGAAACGAGTCATCCAACCCAACGCGGATTTAGCTAGTTTCCAGTGCCTTGGAACAGCCGCCGAAACGGTGTCGCGCATGCGACCTGGTTTCTATGTTTTTGCTTCTTTCTCTTCTTTTATTCCGTTGCCACATCAACTTTTTGTCTAGTTGGCAGCCTAATTAATTCTATGGAAACCAGGTGACATGGAGGGTTGGGGACATGGTGGAAAAAACCGGAACGGGCCGACAGTTCAACCGGAAAAAACCAGAACCCGTTCAGTTCAAAAGAAAGACCGGACATGCATATGACCCGCTTTGAACCGGCAGAACCGGTCGGTTTTTCTATGAACCGGTCATTAAACCGTCCCCGGTTAGACCGAACAAGCCACAATAATCTTGAAATGGGCCTTGATGTGGCCCAATTGGTCTGCCTAGAGCGTTTTGGTTGGCAAAAATCAATCTCCTATTCTCGGCACGTGTGATATACAATGGTAAGTGAGATATACAATTCTCGGCACGGCTACATTACAAGGTGTCGCATTGTGTCAATGTTTGGTTAATTTGCTAGATTCACATAATACATGCCAGGAAGTTCAGAACAATGTGTTGCCTTTCACCGGAAAACTTTGTTGGAGCAAATGCCTTCTTCTTTTTTGCTTCTGCTTCTTGAGTCCATGTGGAGGAAGCAGTAGATAGCTGATGATATCAGGATTCCTTCTGTGTCTGTGTAGGTGTAGCAACACCACTATAATTTTTATTTAGCAACACAATATCAATTTGGTCTATAAAAGTATGAATTAAATCAATCCCCAACCACAATTAGAGTAAGTTGGTGAGTTATTGTAAAGCTCTGCAAAGTTAATTTAAAAGTTATTGCATTAACTTATTTCGTATCACAAACAAGTTTTCACAAGAGTATTAATGGAACAATGAAAACCATTGAACATACTATAATTTTTTTTCTTACTGAAATTATATAATTCAAAGAGCATAAACCCACACAGTCGTAAAGTTCCACGTGTAGTGCATTATCAAAATAATAGCTTACAAAACATAACAAACTTAGTTTCAAAAGTTGCAATCCTTATCACATTGACACATAAAGTGAGCGATGAGTCATGTCATTATTTTTTTGCTCACCATCATGTATATATGATGGGCATAAAAGTTACTTTGATGATGATATCAAAGAACATTTTTAGGTGCACCTAACAGAATATCCAAATAATATGACTCACTTAGATCCTAATATAGCATCAAGCAAAACTAACACTCTAAAGCAACCGATAGGGAAACATCTATAAATAGACAAGCATAATGAAAACCCTCCTCATCCTTCACACAATTCAAACATTATAGTTGAAGCATAGTAGTAGAATCCTACAAAA。
2. DNA fragmentation according to claim 1, is characterized in that, described DNA fragmentation extracts from Genus Oryza plant, is preferably Japanese fine paddy rice.
3. one group for the total length of the DNA fragmentation according to claim 1 that increases or the primer pair of its any fragment, it is characterized in that, described primer pair comprises the first primer and the second primer, and the DNA sequence dna of described first primer comprises fragment: CACAGAAACACACAGGGGATGT; The DNA sequence dna of described second primer comprises fragment: TTTTGTAGGATTCTACTACTAT.
4. the recombinant expression vector containing DNA fragmentation according to claim 1, it is characterized in that, described recombinant expression vector is insert in the multiple clone site of plant expression vector pCAMBIA1391 the recombinant plasmid that DNA fragmentation according to claim 1 obtains, in described recombinant expression vector, described DNA fragmentation is connected to the upstream of gene order to be expressed in carrier.
5. recombinant vectors according to claim 5, is characterized in that, described gene to be expressed is have the gene improving albumen proterties function.
6. an expression cassette, is characterized in that, described expression cassette comprises the DNA fragmentation described in claim 1.
7. cultivating the application in transgenic plant according to the DNA fragmentation in claim 1 described in any one for one kind, it is characterized in that, described application comprises: utilize the DNA fragmentation described in claim 1 to build recombinant expression vector, in described recombinant expression vector, described DNA fragmentation is connected to the upstream of target gene; Utilize freeze-thaw method to be transferred in agrobacterium tumefaciens by described recombinant expression vector, adopt agriculture bacillus mediated method to be cultivated in vegetable cell, tissue or organ by described Agrobacterium tumefaciens transformation.
8. application according to claim 8, is characterized in that, described application is used for improving plant growth characteristic, and described plant is monocotyledons: paddy rice, corn, wheat, barley, jowar or oat.
9. application according to claim 8, is characterized in that, described gene to be expressed is have the gene improving albumen proterties function.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510493103.0A CN105018496A (en) | 2015-08-12 | 2015-08-12 | DNA fragment pENP5 with endosperm specific expression characteristic and application of DNA fragment pENP5 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510493103.0A CN105018496A (en) | 2015-08-12 | 2015-08-12 | DNA fragment pENP5 with endosperm specific expression characteristic and application of DNA fragment pENP5 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105018496A true CN105018496A (en) | 2015-11-04 |
Family
ID=54408798
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510493103.0A Pending CN105018496A (en) | 2015-08-12 | 2015-08-12 | DNA fragment pENP5 with endosperm specific expression characteristic and application of DNA fragment pENP5 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018496A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1748032A (en) * | 2003-02-04 | 2006-03-15 | 作物培植股份有限公司 | Rice promoters |
| WO2009021041A2 (en) * | 2007-08-06 | 2009-02-12 | Monsanto Technology Llc | Rice metallothionein promoters |
| CN103667291A (en) * | 2013-11-28 | 2014-03-26 | 中国科学院植物研究所 | Rice-derived endosperm specific expression promoter and application thereof |
| CN103710344A (en) * | 2013-12-27 | 2014-04-09 | 安徽省农业科学院水稻研究所 | Plant endosperm specificity expression promoter pENP2 and application thereof |
| CN103725680A (en) * | 2013-12-27 | 2014-04-16 | 安徽省农业科学院水稻研究所 | Plant endosperm specificity expression promoter pENP3 and application thereof |
| CN103937799A (en) * | 2014-04-30 | 2014-07-23 | 中国农业科学院作物科学研究所 | Endosperm specific expression promoter |
| CN104560998A (en) * | 2014-12-26 | 2015-04-29 | 中国科学院东北地理与农业生态研究所 | Plant endosperm specific promoter and application thereof |
-
2015
- 2015-08-12 CN CN201510493103.0A patent/CN105018496A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1748032A (en) * | 2003-02-04 | 2006-03-15 | 作物培植股份有限公司 | Rice promoters |
| WO2009021041A2 (en) * | 2007-08-06 | 2009-02-12 | Monsanto Technology Llc | Rice metallothionein promoters |
| CN103667291A (en) * | 2013-11-28 | 2014-03-26 | 中国科学院植物研究所 | Rice-derived endosperm specific expression promoter and application thereof |
| CN103710344A (en) * | 2013-12-27 | 2014-04-09 | 安徽省农业科学院水稻研究所 | Plant endosperm specificity expression promoter pENP2 and application thereof |
| CN103725680A (en) * | 2013-12-27 | 2014-04-16 | 安徽省农业科学院水稻研究所 | Plant endosperm specificity expression promoter pENP3 and application thereof |
| CN103937799A (en) * | 2014-04-30 | 2014-07-23 | 中国农业科学院作物科学研究所 | Endosperm specific expression promoter |
| CN104560998A (en) * | 2014-12-26 | 2015-04-29 | 中国科学院东北地理与农业生态研究所 | Plant endosperm specific promoter and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946649B (en) | A kind of Rice Anther specific expression promoter OsAnth1 | |
| CN103849622B (en) | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof | |
| CN103740717B (en) | A kind of EMBRYO IN RICE specific expressing promoter and application thereof | |
| CN103540592B (en) | A kind of rice endosperm specific expresses promotor and application thereof | |
| CN105063047B (en) | Vegetable seeds specific expression promoter OsSee1 | |
| CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
| CN103740720B (en) | Identification and application of rice root specific strong promoter POsRo2 | |
| CN103740719B (en) | The separation of Rice Vascular Bundle specific expression promoter POsvas 1 and application | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
| CN104046629A (en) | Plant salt inducible expression promoter POsSalt1 and application thereof | |
| CN103849621A (en) | Plant cold inducible expression promoter Poscold1 and application thereof | |
| CN104087588A (en) | Rice drought-induced promoter POsDro4 responding to environmental water stress | |
| CN103773766B (en) | A kind of rice root specific expressing promoter POsRo1 and application thereof | |
| CN103710344B (en) | Plant endosperm specificity expression promoter pENP2 and application thereof | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN105087589A (en) | Promoter element OsEmb2 as well as method and application thereof in breeding transgenic rice | |
| CN105018496A (en) | DNA fragment pENP5 with endosperm specific expression characteristic and application of DNA fragment pENP5 | |
| CN104946652B (en) | Plant gynoecium specific expression promoter OsPis1 and its derivative | |
| CN103834661A (en) | Thermal induction expression promoter Posheat1 of plant and application of promoter Posheat1 | |
| CN103882021A (en) | Plant drought induced expression promoter PosDro1 and application thereof | |
| CN104073493A (en) | Cold-induced and strong-expressed plant promoter Poscold4 and application thereof | |
| CN103740721B (en) | A kind of Plant coleoptile specific expression promoter and application thereof | |
| CN105567695A (en) | Rice non-endosperm expression promoter SAFES3 and application thereof | |
| CN104073492A (en) | Specific expression promoter PosAL1 for crop aleurone layer and application of specific expression promoter PosAL1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151104 |