CN104784687A - Application of flagellar hook protein FlgE of reorganized pseudomonas aeruginosa - Google Patents

Abstract

The invention belongs to the field of biological immunity, and disclosesapplication of flagellar hook protein FlgE of reorganized pseudomonas aeruginosa. The flagellar hook protein FlgE of the reorganized pseudomonas aeruginosa is used for preparing an immunological adjuvant or a vaccine, in particular to be used as the immunological adjuvant in preventing or treating tumors or infectious diseases. The invention provides an FlgE monomer which uses a pseudomonas aeruginosa PAO1 strain as a model bacterial strain and proves recombinant expression, so that corneal epithelial cells of people or lung tissues of mice can be stimulated to generate an inflammatory reaction, remarkable adjuvant effects can be shown, and a foundationis laidfor applying the FlgE monomer to the immunological adjuvant.

Description

The purposes of restructuring bacillus pyocyaneus flagellum hook albumen FlgE

Technical field

The invention belongs to biological immune field, relate to the purposes of restructuring bacillus pyocyaneus flagellum hook albumen FlgE.

Background technology

Although people, animal, fowl there are differences in immunology configuration aspects, there is immunoreactive biological pattern aspect for antigen and there is a lot of common ground, at the immunological adjuvant that human diseases prevention and control field is generally applied, play a role equally in fowl, carcass.As wholly human, the lifting of its health quality, the prolongation of average life, very major part has benefited from the various opposing causing epiphytotics pathogen; The latter then depends on the foundation of research and development for the vaccine of various pathogen and immunization method.At present in certain areas, pathogenic infection is still the great killer threatening human health, and as caused the SARS of the HIV of AIDS, infecting both domestic animals and human, bird flu, Ebola virus infects, and and nonfatal infection as malaria etc.Meanwhile, for some noninfectious diseases, if to lose merit relevant for its pathogenesis and immunity, as tumor, then also can apply vaccination approach, induction body produces the immunity for specific antigen (as tumor associated antigen), thus reaches the object of prevention or disease therapy.

Except enhancing mankind itself health status, for the mankind provide enough and the poultry of health, poultry product, be also one of Means of Ensuring promoting wholly human quality of life.Therefore, the vaccine that research and development are applicable to poultry, fowl produces, to promote the sound development of aquaculture, is significant equally.

Determine that three principal elements of vaccine success or failure comprise specific antigen, adjuvant and immunization route, wherein, both are often public problem to be solved in field, therefore have more great Research Significance.Even if for same antigen, adopt different adjuvants or apply different immunization routes, all may cause different immune protection effects.The immunization route that current public health prevention and control field is commonly used is still sub-mucosal or intramuscular injection.Along with the development of biomedical technology, recent two decades has carried out extensive work in through mucous membrane immunization route, is considered to replace traditional immunization routes the most at last.Corresponding with it is then find novel immunological adjuvant.Be recognized the non-methylated CpG class oligonucleotide that more promising mucosal adjuvant (being also applicable to traditional immunization routes) mainly comprises cholera toxin, Heat-labile Enterotoxin of E. coli and synthetic at present.

In considerable time, aluminum agent (based on aluminium hydroxide, also having aluminum sulfate, alumina gel etc.) is the immunological adjuvant uniquely going through to use in the U.S..Subsequently, at the MF59 gone on the market in Europe and Canada, be Squalene squalene nanometer oil preparation, for influenza; In the vaccine for cervical cancer Cervarix that control 16/18 type papillomavirus causes, use the mixture (AS04) of aluminium hydroxide and LA (MPL).2013, threaten for tackling serious bird flu, U.S. FDA promptly ratified the adjuvant AS03 used in H5N1 vaccine, is the mixture of vitamin E, Squalene and polysorbate (polysorbate, also known as Tween 80); Just this vaccine is unexposed sells use, but can use when health official is thought and needed.There is at present hundreds of based on various mechanism in the world, there are various structure, adjuvant candidates goods for different application target, be in the different phase of research and development.In China, also clearly illustrate in " polypeptide vaccine is produced and Quality Control technological guidance principle " that State Food and Drug Administration on October 14th, 5 to issue in two 〇 〇: " Traditional adjuvants makes-aluminium hydroxide, aluminum phosphate or calcium phosphate on mineral rubber basis, and the adjuvant up to the present ratifying to use is fresh is his class ".For this reason, research and develop the immunologic adjuvant found based on China's autonomous innovation, have great importance.

Good adjuvant energy enhancing body is to an immunne response for specific antigen, but itself does not cause unwanted effect.Current use or the most adjuvants ground, mechanism of action mainly comprises two kinds of modes: the action time being extended vaccine antigen by physical method, or the antagonism of enlarger body acupuncture originates in raw specific immune response by stimulating innate immune system.Apply maximum incomplete Freund's adjuvants in such as zoopery and be not namely rapidly diluted degraded by oil substances protection antigen in it, the thalline in complete Freund's adjuvant then stimulates the immune system of body.Although complete Freund's adjuvant also can cause the specific immune response for somatic antigen in it, because the antibacterial in this adjuvant is pathogenic bacterium in fact, so do not produce ill effect to host for its specific antibody produced or cell immunoreceptor cell.The main mechanism that thalline in present known Freund adjuvant plays a role be its various constituent as pathogen associative mode molecule (Pathogen-Associated Molec μ Lar Pattern) activation to Toll-like receptor on host cell such as DNA in lipopolysaccharide, proteoglycan, born of the same parents, cause follow-up immunization stimulating effect.The adjuvant based on CpG immunostimulation phenomenon that recent researches is more, active antigen presenting cells and B cell by activation Toll sample receptor 9, thus strengthen the reaction to antigen.Endotoxin adjuvant then by the inflammatory reaction of stimulating mucosal local, amplifies the immunoreation to antigen.Adjuvant research and development at present based on CpG immunostimulation phenomenon are more noticeable, mainly due to following reason: CpG immunostimulation phenomenon is comparatively obvious; CpG class oligonucleotide is easily prepared; When CpG ODN cut to lengthen within the specific limits time, its immunogenicity is very faint; Except the CpG sequence at its core position can not change, its flanking sequence can have a lot of alternatives, therefore compared with the product of the sequence research and development oneself of Yi Yixin.

In the adjuvant candidates preparation deriving from antibacterial, based on flagella component, person also merits attention.First; once complete flagellum has adjuvant effect (Ruiz AM, et al. Immunoprotection of mice against Trypanosoma cruzi with a lyophilized flagellar fraction of the parasite plus adjuvant. Immunol Lett 1986 to have document to show; 12:1-4).(Medzhitov R, et al. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997 is found to Toll-like receptor series in 1997; 388:394-397); confirm that the adjuvant effect of flagellum acts on Toll-like receptor 5(TLR5 by the contained flagellin FliC of the major part (i.e. flagellum fiber) of flagellated body in calendar year 2001) and (Hayashi F, et al. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 2001 of realization; 410:1099-1103).The adjuvanticity application of partial monopoly to FliC related preparations is all had to protect at present both at home and abroad.Search for the patent disclosure advertisement data storehouse of State Patent Office with " flagellin and adjuvant ", return four records (Fig. 2), applicant is respectively from Chinese and French, and patent is protected the application of flagellin in people or epiornitic Seedling.It must be noted that; " flagellin " of the middle indication of patent (such as oncotherapy etc.) that current existing domestic and international all application flagellins are applied as adjuvant or other aspects; all refer to the flagellin type B encoded by gene FliC without exception; because it corresponds to flagellated body pars fibrosa; therefore tradition is called as filament C(FliC), be the different albumen (table 1) encoded by different genes from the FlgE that this patent is protected.Adopt the blast program of Pubmed and the CLUSTALW2 program of SimGene to carry out Homology search to the two respectively, display FliC and FlgE homology in protein sequence is extremely low.

In table 1. bacillus pyocyaneus PAO1 bacterial strain, the contrast of " flagellin " and " flagellum hook albumen "

Flagellum hook albumen, English full name is flagellar hook protein FlgE, forms the hook portion of flagellum after about 120 FlgE monomer polymerizations.Research is in the past all around the impact of this albumen on flagella structural, the fractional mutations of such as FlgE can make flagellum shorten to lack even completely, illustrate that FlgE monomer or polymer flagellum hook have material impact to the overall structure of flagellum or biological property, but to the immune related activity of flagellum hook itself, rarely has concern, find through searching document, association area only has one section of document, show to exist in patient Lyme and with FlgE, antibody (the Jwang B that combines can occur, et al. The hook protein of Borrelia burgdorferi, encoded by the flgE gene, is serologically recognized in Lyme disease. Clin Diagn Lab Immunol 1995, 2:609-615).

Bacterial flagellum provides power for bacteria motility and grasps direction, (Fig. 1) is formed primarily of basilar part, flagellum hook, flagellated body, wherein pedestal complex provides rotary power, and flagellum hook is by the bending auger power motion of the spindle-type of pedestal being converted to flagellated body.Flagellated body and flagellum hook are formed by monomer molecule FliC and FlgE poly respectively.Concentrate on flagellated body or monomer whose molecule FliC about the immunobiologic research of bacterial flagellum at present.Known FliC plays immunostimulation by activating cell TLR5, therefore has adjuvanticity.And to flagellum hook, its ingredient FlgE morphs if only there is some research to show, extension and the function of flagellated body will be affected.

Summary of the invention

The technical problem solved: the purposes that the object of the invention is to open restructuring bacillus pyocyaneus flagellum hook albumen FlgE, there is provided with bacillus pyocyaneus PAO1 strain as model bacterial strain, the FlgE monomer that no matter recombinant expressed proof is, or the flagellum hook prepared from antibacterial, Human glioma or mouse lung tissue generation inflammatory reaction can be stimulated, for its adjuvant effect lays the foundation.

Technical scheme: for the problems referred to above, the invention discloses the purposes of restructuring bacillus pyocyaneus flagellum hook albumen FlgE, and described purposes is that restructuring bacillus pyocyaneus flagellum hook albumen FlgE is preparing the purposes in immunological adjuvant or vaccine.

Further, the purposes of described restructuring bacillus pyocyaneus flagellum hook albumen FlgE, described immunological adjuvant is the immunological adjuvant for preventing or treat tumor or infectious disease.

Further, the purposes of described restructuring bacillus pyocyaneus flagellum hook albumen FlgE, described vaccine is the vaccine for prophylaxis of tumours or infectious disease.

Further, the purposes of described restructuring bacillus pyocyaneus flagellum hook albumen FlgE, described vaccine is birds or domestic animal vaccine.

Further, the purposes of described restructuring bacillus pyocyaneus flagellum hook albumen FlgE, described infectious disease comprises disease of viral infection, bacterial infection disease or parasite infectivity disease.

Further, the purposes of described restructuring bacillus pyocyaneus flagellum hook albumen FlgE, described infectious disease comprises pneumonia, meningitis, enteritis, bird flu or acquired immune deficiency syndrome (AIDS).

Further, the purposes of described restructuring bacillus pyocyaneus flagellum hook albumen FlgE, described tumor comprises basal cell carcinoma, transitional cell carcinoma, adenocarcinoma, leiomyosarcoma, hemangiopericytoma, hemangiopericytoma, B cell malignant lymphoma, T cell malignant lymphoma or ameloblastic carcinoma.

beneficial effect:the immunological characteristic that it is possible then for bacillus pyocyaneus flagellum hook albumen, is studied by this project team, and Late Cambrian (detailed in Example): FlgE has very strong non-specific immunostimulating activity.The FlgE protein monomer of application restructuring, the immortal human Characteristic Analysis of Corneal Epithelial Cell Line HCEC of process In vitro culture, application full genome chip of expression spectrum finds that the molecular pathway that cells raises is relevant to inflammation and immunoreactivity, and the expression change of application quantifying PCR method to partial factors (as inflammatory factors such as IL1, IL6, IL8) is verified.Application mouse primary lung tissue cultivating system, adds restructuring FlgE monomer or the flagellum hook albumen composition from bacillus pyocyaneus purification, also can detect that the expression of inflammatory factor rises.These results prompting FlgE has promotion inflammation and immunoreactive ability, has the potential quality of adjuvant.Further, application ovalbumin OVA immune mouse, if add restructuring FlgE, then obviously can increase the reactivity of mice to OVA, prompting FlgE has adjuvant effect in animal body really.In mechanism of action, FliC plays a role mainly through activation TLR5, but adds the antibody of anti-TLR5 in HCEC cultivating system, can not block the activity of FlgE completely, illustrates that FlgE plays immunostimulation and non-fully relies on TLR5.On the other hand, although FlgE also can cause body for the specific immune response of FlgE as albumen, because have no the host protein with this albumen homology so far, so can legitimate inference, the antibody produced for FlgE can not bring any side effect.On the contrary, because bacillus pyocyaneus is prevalent in the opportunist in environment and animal body, use FlgE can help the bacillus pyocyaneus hidden in purged body on the contrary as the specific immune response for FlgE produced during adjuvant.Simultaneously, this molecule on protein sequence with other pseudomonas aeruginosa strains FlgE very high homology (homology ratio is all more than 90%), but with the homology lower (all lower than 62%) of non-P aeruginosa bacteria (note: set Exclude pseudomonas species when blast) FlgE, such as be only 38% with the homology of escherichia coli FlgE, so while FlgE performance adjuvant effect, the sphere of action of the FlgE specific immune response of induction will be confined to bacillus pyocyaneus itself, can not have influence on other and know raw flora.Therefore can not act on other antibacterials in body for the specific immune response that FlgE produces by reasonable prediction, therefore can not destroy the balance between other floras.

Accompanying drawing explanation

Fig. 1 is protein band situation after each step of restructuring FlgE purification.

Fig. 2 is the proinflammatory effect of FlgE inhalation in mice pulmonary.

Fig. 3 is the adjuvant effect of FlgE to mice anti ova cell immune response.

Fig. 4 produces anti-FlgE antibody after FlgE immune mouse.

Detailed description of the invention

Recombinant expressed and the purification (on a small scale preparation) of FlgE

According to bacillus pyocyaneus FlgE coding gene sequence, design and synthesize respectively with the upstream and downstream primer of the amplification total length FlgE coded sequence of NdeI and HindIII restriction enzyme site, forward primer sequence is GGAATTCCATATGAGTTTCAACATCGGCCTG, and downstream primer sequence is TCCCAAGCTTGCGCAGGTTGATGATGGTCT.The bacillus pyocyaneus genomic DNA utilizing above primer pair to extract increases, and PCR program is: 94 DEG C of degeneration 45 seconds, 58 DEG C of annealing 1 minute, and 72 DEG C extend 1 minute, circulate 25 times; 72 DEG C, 10 minutes, its product reclaimed with after NdeI and HindIII enzyme action after agarose gel electrophoresis separation, purification, carries out coupled reaction with the expression vector PET24a through same enzyme action; Connection product conversion is entered escherichia coli jm109 competent cell, be inoculated in containing Kan(final concentration 50 μ g/mL) LB agar plate, Kan resistance clone has been selected after incubated overnight, extract plasmid after shaking bacterium amplification and carry out enzyme action qualification, after being defined as positive transformant, sequence verification is carried out to recombiant plasmid, guarantee that genes of interest and the bonding pad sequence of insertion are correct, called after pET24a-FlgE.Be transformed into E. coli expression strains BL21, the single colony inoculation of picking puts into constant-temperature table to (the Kan antibiotic containing 50 μ g/mL concentration) in the LB fluid medium of 5mL, rotating speed 225r/min, 37 DEG C hatch 16-18h.Then get part bacterium liquid to be forwarded in 100mL fluid medium with 1:100 ratio, continue with 225r/min in shaking table, hatch for 30 DEG C, monitoring OD value, adds derivant IPTG (final concentration 1mmol/ L) when reaching 0.6-0.9; Induction 20 hours under 225r/min rotating speed, the condition of 16 DEG C afterwards.Collect bacterium liquid, in 4 DEG C, abandon supernatant after 1811g, centrifugal 20min, lysozyme (final concentration the is 0.03mg/mL) room temperature that thalline PBS washing once adds 15mL binding buffer liquid (20mM sodium phosphate, 500mM sodium chloride, 30mM imidazoles, PH7.4) and 5 μ L afterwards places 15 minutes.Then ultrasonic method (the power of 20 ﹪ is adopted, every 2s interval 2s of ultrasonic period, total time is 10-15min) broken thalline, with 4 DEG C, 1811g, centrifugal 20min, collect the supernatant (containing expressing protein) after splitting bacterium, with the membrane filtration of 0.45 μm to remove cell debris or other solid material, the filtered solution His-Trap FF crude chromatographic column (bed volume 1mL) being connected in AKTA Explorer carries out purification.In brief, first use the equilibration buffer chromatographic column of at least 5 bed volumes, after system baseline balance and stability, ultraviolet makes zero.With syringe, rough flagellin liquid is injected 2mL loading ring, loading flow velocity 1mL/min.Behind loading peak to appear, foreign protein is washed away with binding buffer liquid, with the elution buffer gradient elution containing 20mM sodium phosphate, 500mM sodium chloride, 500mM imidazoles, PH7.4 after baseline balance and stability, flow velocity 1mL/min, the gradient of 0 ~ 100% completes in 10 bed volumes.Under UV detects, collect protein peak, be collected in the EP pipe of 1.5mL with 1mL/ part.Collect the protein peak under eluting, with similar step by His-Trap Desalting desalting column, by salts substances such as PBS buffer exchange imidazoles, and then removing salts substances, by protein dissolution in PBS buffer, collect protein peak.Then sample is removed endotoxin through endotoxin removal test kit (Toxin Eraser TM Endotoxin Removal Kit).Get appropriate protein liquid between each step to identify through 12 ﹪ SDS-PAGE.Finally measure the FlgE protein concentration after purification by BCA method, and by chromogenic substrate tachypleus amebocyte lysate box, foundation test kit description by standard curve matching type, measure the residual concentration of lipopolysaccharide in protein sample.Through above-mentioned steps, every 100mL cultivates bacterium finally can obtain purification FlgE albumen 6mg, and protein electrophoresis display product band is single.Through removing the process of endotoxin test kit, detecting endotoxin content in protein solution by the method for tachypleus amebocyte lysate is 0.74EU/mg albumen, is applicable to follow-up function research (see figure 1).

The aminoacid sequence of FlgE albumen is as shown in SEQ ID NO:1.

FlgE stimulates the inherent immunity reaction of Human glioma

Human glioma system HCEC is in DMEM/F12 culture fluid (containing 10 ﹪ FBS) Secondary Culture.Results exponential phase cell adds 24 orifice plates, and every hole is containing 500 μ L and cell 1.5 × 10 ⁴individual.Treat that cell covers with to merge to 80 ﹪-90 ﹪, change serum-free medium and continue cultivation 4 hours.Add 25 μ L FlgE, make its final concentration be 20 μ g/mL.Three multiple holes established by each sample, arrange blank and PBS contrast.Cultivate after 4 hours, abandon supernatant, every hole adds 100 μ L Trizol, static 5min, collects sample, extracts sample RNA, detects for chip of expression spectrum.Adopt Agilent SurePrint G3 Human Gene Expression 8x60K (Cat# G2543-60015. Agilent) chip, chip hybridization and data acquisition, analysis are assisted to carry out by Agilent service company.

Main result: this chip is altogether containing 42545 data points, through FlgE(20 μ g/mL) process 4 hours after, 26229 points are judged as " expression " (being all detected in two of 3 chips or three chips), wherein 377 gene expressions are adjusted to 1.5 times of contrast, 332 drop to normal less than 0.667.Through Database for Annotation, Visualization and Integrated Discovery (DAVID, v6.7) analyze, the genetic enrichment raised is in 16 KEGG paths (table 2), raise significant gene and react relevant with path majority to inherent immunity, wherein IL-6 enrichment in 7 KEGG paths, IL-1b is enrichment in 4 paths then; The gene lowered then only has Leukocyte Transendothelial Migration path by enrichment.Wherein change the strongest gene all to react relevant (table 3) with inflammation and inherent immunity.Illustrate that the reaction that FlgE acts on caused by HCEC mainly reacts relevant with inflammatory reaction to inherent immunity.

The path of table 2. up-regulated gene institute enrichment

Table 3 raises the list of genes more than three times; There is no gene deregulation more than 3 times

* these genes arrange two or more probe in an array, comprise all applicable data.

FlgE stimulates the inherent immunity reaction of mice lungs

Application wild type C57Bl/6 mice, with FlgE(5 μ g/mL dosage), LPS(5 μ g/mL dosage is as positive control) or solvent PBS(as negative control) collunarium respectively, put to death mice after 24 hours.Get lung, use PBS lavation, prepare lung immersion, adopt ELISA method to detect IL1b, IL6, CXCL1 concentration in it; Subsequently lung is cut into small pieces; after partial fixing, routine is prepared paraffin section and carries out HE dyeing; part is for extracting RNA application fluorescence quantitative PCR detection IL1b, IL6 and CXCL1(primer sequence: mIL1b F:CAACCAACAAGTGATATTCTCCATG; R:GATCCACACTCTCCAGCTGCA, P:CTGTGTAATGAAAGACGGCACACCCACC; MIL-6 F:TCGGAGGCTTAATTACACATGTTC, R:CAAGTGCATCATCGTTGTTCATAC, P:CAGAATTGCCATTGCACAACTCTTTTCTCA; MCXCL1 F:CCGAAGTCATAGCCACACTC, R:TTTTCTGAACCAAGGGAGCTT, P:AAGGCAAGCCTCGCGACCAT).

Main result: tissue slice display FlgE process, can significantly induce inflammatory cell infiltration in lung, but degree is far below LPS(Fig. 2 A of equal quality), myeloperoxidase (MPO) chromogenic reaction is carried out to section, shows medullary system granulocytosis in lung (Fig. 2 B); Lung tissue RT-PCR(Fig. 2 C) and lung immersion ELISA(Fig. 2 D) show that mouse lung IL1b, IL6 and CXCL1 expression of FlgE collunarium process significantly rises.These results prompting restructuring bacillus pyocyaneus FlgE significantly can promote the tracheal strips inherent immunity reaction responses such as lungs.

The adjuvanticity of FlgE

(1) cell immune response: the TCR transgenic mouse model that application OVA is special, detects FlgE to the adjuvant effect of mice anti ova cellular immunization.From CD45.1 × OT-II F1 mice, get spleen, skin-draining lymph nodes prepares single cell suspension through aseptic, after conventional application eflour450 labelling, close through CD16/32, application CD4 traget antibody labelling, through MACS magnetic bead sorting CD4+ T cell, then use FACS AriaII sorting CD4+TCR/alpha2+ TCR/BETA5+CD62L+CD25-Resting T cells.Through tail venous re-transfusion to C57BL/6 receptor Mus (every only feedback 1.6 × 10 ⁶t cell).Divide into groups after one day, through root of the tail portion subcutaneous injection, immunity is carried out to mice: PBS group, 100 μ L PBS/ Mus; Simple OVA group, 10 μ g OVA/ Mus; OVA+CpG group, 10 μ g OVA+50 μ g CpG/ Mus; OVA+FlgE group, 10 μ g OVA+50 μ g FlgE/ Mus.Latter 3rd day of immunity, gets groin draining lymph node and takes pictures, prepare lymph node single cell suspension, closes after counting with CD16/32, and with antibody labeling (CD4-Percpcy5.5, CD45.1-FITC), the capable FACS of upper machine detects.

Main result: C57Bl/6 Mus accepts OT-II cell and after OVA impacts, lymphopoiesis also causes lymphadenectasis (Fig. 3 A), and specific T-cells proportion increases (Fig. 3 B), eFlour450 detection display lymphopoiesis (Fig. 3 C); In above-mentioned each index, FlgE all shows as further facilitation, shows as significant adjuvant effect, but the action intensity of the FlgE of homogenous quantities is lower than the CpG of homogenous quantities dosage.

The specificity immunology of FlgE is active

Adopt 6-8 C57Bl/6 female mice in age in week, carry out immunity with the bacillus pyocyaneus of FlgE or fixing deactivation.Concrete grammar is: FlgE group: FlgE 50uL i.e. 100 μ g and the equivalent aluminum hydroxide adjuvant getting 2mg/mL mixes, each 25 μ L of left and right toes subcutaneous injection, groin subcutaneous injection 50 μ L, only amounts to 100 μ L/.Expand bacterium in the conventional liquid medium within of PAO1 group: PAO 1 pseudomonas aeruginosa strain, receive bacterium, hatch deactivation in 24 hours with the formaldehyde of final concentration 0.4% in 37 DEG C, adjustment bacterial concentration is about 1 × 108CFU/mL, and only, immunization method is with FlgE group for 100ul/.After immune 2 weeks of first time, immunity again.Second time immunity got serum after 10 days, measured anti-FlgE antibody titer in it with ELISA.ELISA step is: first with 1 μ g/mL FlgE (being dissolved in CBS buffer) coated elisa plate, 4 DEG C are spent the night.Discard coating buffer, place 2 hours all the other non-binding sites closed with 1%BSA in room temperature.By antiserum from 1:3000 concentration, after doing doubling dilution with 1:3, add in plate in incubated at room 60 minutes, after PBST washes plate 5 times, the sheep anti mouse two adding horseradish peroxidase-labeled resists, and 1:3000 dilutes, 37 DEG C hatch 45 minutes after wash plate, add TMB to develop the color 30 minutes, after cessation reaction, read plate at 450nm place.Result is applied after FlgE immune mouse as seen can the anti-FlgE antibody of induced high titers, and the full bacterium of the bacillus pyocyaneus of applying deactivation only can induce the anti-FlgE antibody (Fig. 4) of minuent.

Claims (7)

1. the purposes of restructuring bacillus pyocyaneus flagellum hook albumen FlgE, is characterized in that: described purposes is that restructuring bacillus pyocyaneus flagellum hook albumen FlgE is preparing the purposes in immunological adjuvant or vaccine.

2. the purposes of restructuring bacillus pyocyaneus flagellum hook albumen FlgE according to claim 1, is characterized in that: described immunological adjuvant is the immunological adjuvant for preventing or treat tumor, infectious disease.

3. the purposes of restructuring bacillus pyocyaneus flagellum hook albumen FlgE according to claim 1, is characterized in that: described vaccine is the vaccine for prophylaxis of tumours or infectious disease.

4. the purposes of restructuring bacillus pyocyaneus flagellum hook albumen FlgE according to claim 3, is characterized in that: described vaccine is birds or domestic animal vaccine.

5. the purposes of the restructuring bacillus pyocyaneus flagellum hook albumen FlgE according to Claims 2 or 3, is characterized in that: described infectious disease comprises disease of viral infection, bacterial infection disease or parasite infectivity disease.

6. the purposes of the restructuring bacillus pyocyaneus flagellum hook albumen FlgE according to Claims 2 or 3, is characterized in that: described infectious disease comprises pneumonia, meningitis, enteritis, bird flu or acquired immune deficiency syndrome (AIDS).

7. the purposes of the restructuring bacillus pyocyaneus flagellum hook albumen FlgE according to Claims 2 or 3, is characterized in that: described tumor comprises basal cell carcinoma, transitional cell carcinoma, adenocarcinoma, leiomyosarcoma, hemangiopericytoma, hemangiopericytoma, B cell malignant lymphoma, T cell malignant lymphoma or ameloblastic carcinoma.