CN107176977A - Application of the Mycoplasma bovis MbovP730 albumen in natural infection and vaccine immunity differentiate - Google Patents
Application of the Mycoplasma bovis MbovP730 albumen in natural infection and vaccine immunity differentiate Download PDFInfo
- Publication number
- CN107176977A CN107176977A CN201610144587.2A CN201610144587A CN107176977A CN 107176977 A CN107176977 A CN 107176977A CN 201610144587 A CN201610144587 A CN 201610144587A CN 107176977 A CN107176977 A CN 107176977A
- Authority
- CN
- China
- Prior art keywords
- mycoplasma bovis
- albumen
- mbov
- mbovp730
- bovis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/30—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycoplasmatales, e.g. Pleuropneumonia-like organisms [PPLO]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56933—Mycoplasma
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/30—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Mycoplasmatales, e.g. Pleuropneumonia-like organisms [PPLO]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Pulmonology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to zoonosis Prevention Technique field, and in particular to application of the Mycoplasma bovis MbovP730 albumen in natural infection and vaccine immunity differentiate.According to the codon-bias of Escherichia coli, M.bovis HB0801 Mbov_730 genes are cloned, by Mbov_730 genetic modifications, Mycoplasma bovis serine codon UGA is mutated into the serine codon UGG in Escherichia coli, and then the Mycoplasma bovis MbovP730 albumen recombinated in expression in escherichia coli.The nucleotide sequence such as SEQ ID NO of the MbovP730 albumen of the present invention:Shown in 13, the application that the albumen can be as antigen protein in the infection of antidiastole Mycoplasma bovis street strain and vaccine strain Immune dctection kit is prepared.
Description
Technical field
The invention belongs to zoonosis Prevention Technique field, and in particular to a kind of Mycoplasma bovis MbovP730 albumen and its application.
Antidiastole street strain Mycoplasma bovis HB0801 infection can be being prepared by albumen after purification as antigen protein
With the application in vaccine strain Mbov HB0801-150.2 immune reagent kits.
Background technology
Mycoplasma bovis (Mycoplasma bovis, M.bovis) is the important pathogen microorganism of beef cattle and milk cow, is to cause China's meat
The main pathogens of ox respiration syndrome, transport stress syndrome and mastadenitis of cow, clinical symptoms are mainly shown as pneumonia, breast
Adenositis, arthritis, can also behave as a variety of symptoms such as tympanitis, conjunctivitis and genital inflammation.Mycoplasma bovis was in head in 1961
It is secondary to be found in the U.S., it is isolated from the milk for suffering from mammitis milk cow.It is to cause the important pathogen body of pneumonia to confirm within 1976 it.
Hereafter find, Mycoplasma bovis pneumonia and mastitis are widely current (Caswell etc., 2010 in the whole world；White etc., 2010).
It is estimated that Europe it is annual there are about 25%~33% calf pneumonia be as caused by Mycoplasma bovis, equivalent to annual loss 1.44~
1.92 hundred million Euros, wherein Britain just has 1,900,000 oxen to suffer from Mycoplasma bovis pneumonia every year, and death is up to 15.7 ten thousand.U.S. cattle farm
Mycoplasma bovis infection rate loses also up to 1.40 hundred million dollars caused by Mycoplasma bovis pneumonia and mammary gland disease every year up to 70%.
As China's cattle-raising is to scale and intensivization development, ox cultivation amount is greatly increased, and specialized degree is increased substantially,
Beef cattle " fattening in strange land " turns into important steer ration pattern.Long-distance transportation is the important step of " strange land transport ", and transport should
A variety of important epidemic diseases can be induced by swashing, and Mycoplasma bovis pneumonia is exactly one of which.The disease reports that (stone is built for 2008 first in Hubei Province
Deng 2008), from other places introduce beef cattle, after introduction 2 weeks or sos fall ill, show as heating, cough, rhinorrhea, calf with
Low ox morbidity is serious.The incidence of disease is 50%~100%.The clinical treatment cycle is long, and effect is poor, case fatality rate average 10%,
Up to 60%, main pathological change is pulmonary consolidation, suppuration or caseous necrosis, and massive losses are brought to China's cattle-raising.
After 2008 first report after, different researchers confirm the disease be widely current in the whole nation (it is pungent nine celebrate etc., 2008；Hu Changmin etc.,
2009)。
Mycoplasma bovis is acellular wall, it is insensitive to conventional beta-lactam class antibiotic, to other medicines such as tetracycline, macrolide
Also it is easy to produce drug resistance (Mustafa etc., 2013) with the sensitive medicaments such as fluorine quinoline butyrone class.Due to insensitive, the epidemic disease of antibiotic
Seedling is considered as the effective measures for preventing Mycoplasma bovis disease.Applicant is previously by Mycoplasma bovis street strain (Mycoplasma bovis
HB0801) in the generation of continuous passage 150, obtains vaccine strain Mbov HB0801-150.2 in vitro, demonstrate,proves the vaccine strain by ox experience and exempts from
There is good resistance (Zhang etc., 2014) to the attack of Mycoplasma bovis street strain after epidemic disease.
To M.bovis HB0801 (GenBank accession number：CP002058) and Mbov HB0801-150.2 full-length genome
Sequence analysis (Qi etc., 2012) finds that Mbov HB0801-150.2 have lacked a length of 14kb's compared with M.bovis HB0801
DNA fragmentation, this provides good molecule for immune and M.bovis HB0801 infection the differentiations of Mbov HB0801-150.2
Mark.Clonal expression is carried out to the gene in missing DNA fragmentation, serum is parallel with vaccine immune sera progress to be examined using infecting
Survey, screening finds that one can distinguish the infection of Mycoplasma bovis street strain and the antidiastole of vaccine immunity mark molecule MbovP730.
The content of the invention
It is an object of the invention to overcome the defect of prior art, its first purpose is to provide one can be former with antidiastole ox branch
Body street strain (M.bovis HB0801) infects and the immune molecular marker of mycoplasma bovis vaccine strain (Mbov HB0801-150.2)
Mycoplasma bovis MbovP730 albumen.
It is another object of the present invention to provide a kind of antibody detection method of Mycoplasma bovis MbovP730 albumen, assembling is used for
Distinguish the application in the infection of Mycoplasma bovis street strain and mycoplasma bovis vaccine strain ELISA kit.In order to realize above-mentioned purpose,
The present invention uses following technical scheme：
Isolated one plant of ox branch in the lung tissue for the ox that applicant falls ill in June, 2008 from Hubei Province Yingcheng City vaccary
Substance Mycoplasma bovis HB0801, applicant is named as Mycoplasma bovis HB0801, Mycoplasma bovis
HB0801, the China typical culture collection center preservation of Chinese Wuhan Wuhan Universitys was delivered on 2 1st, 2010, and preservation is compiled
Number be CCTCC NO：C2010040；The nucleotides sequence of the genome of the separation strains is listed on GenBank simultaneously and logged in, is stepped on
Record number is：CP002058.
Using this plant of ox Zhi Yuanben Genome Accession as CP002058) in Mbov_730 gene orders be with reference to design primer,
The gene is cloned from the bacterium genomic DNA, according to the codon-bias of Escherichia coli, Mbov_730 genes are carried out
Modification, Mycoplasma bovis serine codon UGA is mutated into the serine codon UGG in Escherichia coli, and then in large intestine
Expressed in bacillus, the Mycoplasma bovis MbovP730 albumen (rMbovP730) recombinated.
Further, the invention also discloses the purification process of Mycoplasma bovis MbovP730 albumen.
Biometric authentication shows that rMbovP730 albumen of the invention can be used as the infection of antidiastole Mycoplasma bovis street strain and vaccine
Application in strain immune reagent kit.
Specifically, Mycoplasma bovis MbovP730 albumen of the invention is in the infection of differentiation Mycoplasma bovis street strain and vaccine strain are immune
Applying step include：
Differentiate the infection of Mycoplasma bovis street strain using indirect ELISA method, antigen coat ELISA Plate is used as using rMbovP730 albumen
In 4 DEG C overnight, added after being washed through PBST and close 1h after 5% skimmed milk at 37 DEG C, then detection is added after being washed with PBST
Sample is incubated 1h in 37 DEG C, and Sample Dilution ratio is 1：1600.Goat-anti ox (IgG Fc-HRP) enzyme is added after PBST washings
Mark secondary antibody (1：5000, V/V) 37 DEG C of incubation 45min.The colour developing of tmb substrate nitrite ion is added after finally being washed with PBST.
The present invention has advantages below：
After vaccine strain Mbov HB0801-150.2 are immune, body can also produce high-level serum antibody, but the country does not have also now
There is the diagnostic kit for differentiating that the infection of Mycoplasma bovis street strain and vaccine strain are immunized.MbovP730 albumen is vaccine strain Mbov
HB0801-150.2 missing albumen, finds that it has good immunogenicity again, therefore, is built using rMbovP730 albumen
Indirect ELISA can accurately distinguish Mycoplasma bovis street strain infection and vaccine strain be immunized, ROC curve analysis shows are with the albumen
The detection method specificity and sensitiveness of foundation can reach 90%.
More detailed scheme of the invention is shown in《Embodiment》It is described.
Brief description of the drawings
Sequence table SEQ ID NO:1 is the primer 730a1 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:2 be the primer/730a2 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:3 be the primer 730b1 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:4 be the primer 730b2 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:5 be the primer 730c1 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:6 be the primer 730c2 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:7 be the primer 730d1 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:8 be the primer 730d2 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:9 be the primer 730e1 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:10 be the primer 730e2 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:11 be the primer 730f1 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:12 be the primer 730f2 sequences for expanding Mbov_730 genetic fragments.
Sequence table SEQ ID NO:13 be that preserving number is CCTCC NO：The nucleosides of M2010040 Mycoplasma bovis MbovP730 albumen
Acid sequence, sequence length is 867bp.In 471 of the sequence, 531,615,663 and 738 generation equipotentials
Gene mutation.
Sequence table SEQ ID NO:14 be that preserving number is CCTCC NO：The albumen of M2010040 Mycoplasma bovis MbovP730 albumen
Matter sequence, encodes 288 amino acid.
Fig. 1：It is starting plasmids (empty carrier) pET-30a of present invention collection of illustrative plates.PET-30a is that a kind of business plasmid (is purchased from Novagen
Company).
Fig. 2：It is recombinant plasmid pET-30-Mbov_730 prepared by present invention collection of illustrative plates.Description of reference numerals：Recombinant plasmid
PET-30-Mbov_730 is to pass through digestion with restriction enzyme by the Mbov_730 full length genes after pET-30a plasmids and mutation
Recombinate and form after connecting afterwards.
Fig. 3：It is the SDS-PAGE glue figures of the Mycoplasma bovis MbovP730 protein purifications of the embodiment of the present invention.Description of reference numerals：
Swimming lane：M albumen marker；1 expresses bacterium for the BL21 of the pET-30-Mbov_730 containing recombinant plasmid before induction；2 be to lure
The BL21 expression bacterium of the pET-30-Mbov_730 containing recombinant plasmid after leading；3 be to contain recombinant plasmid pET-30-Mbov_730
BL21 expression bacterium it is broken after percolation liquid on supernatant after Ni posts；4 be Mycoplasma bovis MbovP730 recombinant proteins after purification.
Fig. 4：It is Western blot detection Mycoplasma bovis MbovP730 protein-specific figures.Description of reference numerals：Swimming lane：M albumen
marker；1 is HB0801 plants of whole bacterial proteins of Mycoplasma bovis；2 be Mbovis-150 plants of whole bacterial proteins of Mycoplasma bovis；3 be agalasisa
PG2 plants of whole bacterial proteins of mycoplasma；4 be Pasteurella whole bacterial protein；5 be haemolysis Mannheimia whole bacterial protein；6 be prapes point
Branch bacillus whole bacterial protein；7 be infectious bovine rhinotrachetis virus total protein.
Fig. 5：It is coated with HB0801 plants of whole bacterial protein screening Mycoplasma bovis natural infection serum results of Mycoplasma bovis.Description of reference numerals：
F1 is HB0801 plants of natural infection serum of Mycoplasma bovis；F150 is Mbov HB0801-150.2 vaccine strain Post-immunisation serums；
It is negative：M. bovis negative serum
Fig. 6：It is coated with rMbovP 730 and Mycoplasma bovis natural infection and vaccine immunity is differentiated by indirect ELISA.Description of reference numerals：
Mycoplasma bovis natural infection and the determination of vaccine strain immune detection and threshold value, when threshold value is 0.673, sensitiveness is 95.45%, special
The opposite sex is 90.91%.
Embodiment
Embodiment 1：The clonal expression of Mycoplasma bovis Mbov_730 albumen
1.1 Mycoplasma bovis Mbov_730 gene cloning and expressions
Due to preferences of the Escherichia coli to codon, the codon UGA of codes for amino acid tryptophan is in Escherichia coli quilt in Mycoplasma bovis
As terminator, therefore, with during Bacillus coli expression Mycoplasma bovis Mbov_730 genes, it is necessary to mycoplasma Mbov_730
Gene is mutated, i.e. make Mycoplasma bovis codon UGA sport can expression in escherichia coli tryptophan codon
UGG。
Applicant will obtain Escherichia coli and be named as Escherichia coli pET-30-Mbov-730, Escherichia coli after mutation,
PET-30-Mbov-730, the China typical culture collection center preservation of Chinese Wuhan Wuhan Universitys is sent on December 18th, 2015,
Deposit number is CCTCC NO：M2015762.
The present embodiment is mutated using PCR primer to corresponding gene.Initial strain for mutation is Mycoplasma bovis HB0801,
The bacterial strain be the ox that applicant falls ill in June, 2008 from Hubei Province Yingcheng City vaccary lung tissue in it is isolated, application
People is named Mycoplasma bovis HB0801, Mycoplasma bovis HB0801, and Chinese Wuhan was delivered on 2 1st, 2010
Wuhan University's China typical culture collection center preservation, preserving number is CCTCC NO：C2010040.The base of the Mycoplasma bovis
Because group is logged in GenBank, accession number is：CP002058.
Using accession number to be template for CP002058 Mbov_730 genes, the 6 primer pairs (numbering point designed as follows is utilized
It is not：730a1/730a2,730b 1/730b2,730c1/730c2,730d1/730d2,730e1/730e2,730f1/730f2)
6 fragments of the Mbov_730 genes after mutation are amplified respectively, then, using 6 fragments after mutation as template, make profit
The complete sequence of the Mbov_730 genes after mutation is amplified with 730a1/730f2, sequence length is 867bp (see sequence table SEQ
ID NO:13)。
Specific primer sequence is as follows：
(1) position of the 730a1/730a2 amplified fragments in Mbov_730 genes is 863600-863101, PCR amplification productions
Thing length is 509bp.
Forward primer 730a1:5’ GAATTC(underscore part is EcoR I to ATGCCTAATGATGGTTCA 3 '
Restriction enzyme site, wave part is protectiveness base；That is sequence table SEQ ID NO：Sequence shown in 1).
Reverse primer 730a2：5’ACAATTTTTTTGCCATTTTTTATACTGATC(lower stroke of CAGTTTTTA 3 '
Line part is mutational site, and C is sported by T；That is sequence table SEQ ID NO：Sequence shown in 2).)
(2) position of the 730b1/730b2 amplified fragments in Mbov_730 genes is 863140-863045, pcr amplification product
Length is 96bp.
Forward primer 730b1：5’ATAAAAACTGGATCAGTATAAAAAATGGCAAAAAAATTGT
3 ' (underscore part be mutational site, G is sported by A；That is sequence table SEQ ID NO：Sequence shown in 3).
Reverse primer 730b2：5’GAAGAACAGTGAGCTTAATTCCTGTC(underscore part is prominent to CAATC 3 '
Become site, C is sported by T；That is sequence table SEQ ID NO：Sequence shown in 4).
(3) position of the 730c1/730c2 amplified fragments in Mbov_730 genes is 863081-862913, pcr amplification product
Length is 169bp.
Forward primer 730c1：5’CACAAAGATTGG(underscore part is mutation to ACAGGAATTAAGCTCACT 3 '
Site, G is sported by A；That is sequence table SEQ ID NO：Sequence shown in 5).
Reverse primer 730c2：5’CAGCATACTTAATATTTGATGTATCC(the underscores of CATTCATTAAGGTT 3 '
Part is mutational site, and C is sported by T；That is sequence table SEQ ID NO：Sequence shown in 6).
(4) position of the 730d1/730d2 amplified fragments in Mbov_730 genes is 862952-862846, pcr amplification product
Length is 107bp.
Forward primer 730d1：5’AACCTTAATGAATGG(lower stroke of GATACATCAAATATTAAGTATGCTG 3 '
Line part is mutational site, and G is sported by A；That is sequence table SEQ ID NO：Sequence shown in 7).
Reverse primer 730d2：5’ACGCTACCTCTAATTTTC(lower stroke of CAATTTTTTAAAGACTGATCTA3 '
Line part is mutational site, and C is sported by T；That is sequence table SEQ ID NO：Sequence shown in 8).
(5) position of the 730e1/730e2 amplified fragments in Mbov_730 genes is 862875-862771, pcr amplification product
Length is 105bp.
Forward primer 730e1：5’TTTAAAAAATTGG(lower stroke of AAAATTAGAGGTAGCGTTAATACCAAG 3 '
Line part is mutational site, and G is sported by A；That is sequence table SEQ ID NO：Sequence shown in 9).
Reverse primer 730e2：5’GTTTTCCAAGCGGTAGCCATATCCTT 3 ' (underscore part is mutational site,
C is sported by T；That is sequence table SEQ ID NO：Sequence shown in 10).
(6) position of the 730f1/730f2 amplified fragments in Mbov_730 genes is 862797-862734, pcr amplification product
Length is 73bp.
Forward primer 730f1：5’AAAGGATATGGCTACCGCTTGGAAAAC 3 ' (underscore part is mutational site,
G is sported by A；That is sequence table SEQ ID NO：Sequence shown in 11).
Reverse primer 730f2：5’ AAGCTT(the underscores of TTATGCTTTTTTATAGTTATATAGCATATTT 3 '
Part is Hind III digestions site, and wave part is protectiveness base；That is sequence table SEQ ID NO：Sequence shown in 1).
The reaction system of 6 fragments of the above is as follows：
μ L, the pfu buffer with MgSO of 2.5 μ L, pfu enzymes (Thermo) of template DNA 1.54(Thermo) 5 μ L, 10
Times the μ L of dNTP mix (Thermo) 1, each 2 μ L of primer, the μ L of ultra-pure water 36.
The pcr amplification product of above-mentioned six fragments is reclaimed, as template, after primer 730a1 to 730f2 amplification mutation
Mbov_730 genes, its PCR reaction system is as follows：2.5 μ L, pfu enzymes (Thermo) of each fragment 1.5 μ L, pfu buffer
with MgSO4(Thermo) 5 μ L, 10 times of μ L of dNTP mix (Thermo) 1, each 2 μ L of primer, the μ L of ultra-pure water 36.
Above-mentioned primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Mbov_730 gene amplification products are reclaimed, with EcoR I and Hind III digestions, while pET-30a plasmids (are purchased from
Co., Ltd in Merck) carry out double digestion with EcoR I and Hind III.By the Mbov_730 genes and pET-30a after digestion
Plasmid is connected with DNA ligase (T4 DNA ligase), obtains recombinant plasmid pET-30-Mbov_730 (see Fig. 2).With
After the α of recombinant plasmid pET-30-Mbov_730 conversion Escherichia coli DH 5, it is placed in 37 DEG C of shaking tables and cultivates 12 under 180r/min
Hour, extract plasmid and convert e. coli bl21 after sequencing is correct, the Escherichia coli are cultivated in LB fluid nutrient mediums
1mL bacterium solutions are taken during to OD=0.6 as being compareed before induction, while adding isopropylthiogalactoside (IPTG) to final concentration
For 0.8mM, 37 DEG C of shaking table induced expressions 3 hours.1mL bacterium solutions are taken to be handled.Sample treatment is 12000r/min
The i.e. PBS of 1mL phosphate buffers (formulas are added from supernatant is discarded after 1min：KCl 0.2g, NaCl 8g, Na2HPO41.44g,
KH2PO40.24g, 1000mL distilled water, pH=7.6) solution be resuspended after again with 12000r/min centrifugation 1min discard supernatant,
Then PBS the and 30uL sample-loading buffers for adding 30uL (are purchased from Wuhan Keqian Animal Biological Products Co., Ltd., 1M
Tris-HCl, pH=6.8) 1mL, 200mM DDT 0.31g, 4%SDS 0.4g, 0.2% bromophenol blue 0.02g, 20% glycerine 2mL,
7mL ultra-pure waters) it is resuspended.10min is boiled in 100 DEG C of boiling water.Whether expressed with PAGE gel electroresis appraisal.
The purifying of 1.2 Mycoplasma bovis rMbovP730 albumen
After the e. coli bl21 of restructuring as stated above induced expression, bacterium solution 8000r/min is taken to be discarded after centrifuging 10min
Supernatant, centrifuges 10min in 8000r/min after being washed once with 500mL PBS, repeats and washed once with 500mL PBS.
The PBS resuspensions that 30mL is added after supernatant are discarded, protease inhibitors (being purchased from Roche Holding Ag) is added, uses hydraulic crushing instrument
It is broken.With 12000r/min from 30min after broken, take 30 μ L of supernatant to add 30 μ L sample-loading buffers, 10min is boiled in boiling water
It is used as supernatant group.A little 30 μ L of precipitation addition PBS and 30 μ L sample-loading buffers is taken to boil 10min and make precipitation group.By
After PAGE gel electrophoresis, determine that rMbovP730 albumen is largely expressed in supernatant.
The specific purification step of rMbovP730 albumen is as follows：
(1) 1mL Ni-NTA metal-chelating His protein purifications medium filler (being purchased from GE companies) is added into affinity column；
(2) 12mL ddH are added into affinity column2O is washed；
(3) 12mL binding buffer buffer solutions (20mM Na are added3PO4, 0.5M NaCl, 20mM imidazoles,
PH=7.4 pillar) is balanced；
(4) the protein expression supernatant by 0.45 μm of aperture filter filtering is added, former liquid for dripping and filtering out are collected, numbering is
1；
(5) 50mL binding buffer balance pillars are added, former drop of liquid are collected, numbering is 2；
(6) 50mL washing buffer (20mM Na are added3PO4, 0.5M NaCl, 60mM imidazoles, pH=7.4) wash
Foreigh protein removing, collects former drops, numbering is 3；
(7) 12mL elute buffer (20mM Na are added3PO4, 0.5M NaCl, 1M imidazoles, pH=7.4) and elution destination protein,
Former drops are collected, numbering is 4；
(8) each 50 μ L sample-loading buffers that add in the pipe for being 1 to 4 will be numbered and boil 10min；
(9) the poly- propionamide gels of SDS-PAGE are configured, the sample handled well (20 μ L/ are per hole) are added into hole, electrophoresis is (dense
Contracting gel electrophoresis condition is that DC voltage is 80 volts, and separation gel deposition condition is that DC voltage is 120 volts), after the completion of electrophoresis,
Gel is removed to be stayed overnight with coomassie brilliant blue staining.Then decolourize, it is determined that the destination protein purified.
Embodiment 2：Mycoplasma bovis rMbovP730 protein-specifics are detected
The preparation of 2.1 polyclonal antibodies
Using the rMbovP730 protein immunization BALB/C mices of above-mentioned preparation, immune programme for children is as follows：
(1) initial immunity, the μ g/ mouse of Mycoplasma bovis rNOX antigen 1s 00, plus the subcutaneous multi-point injection of Freund's complete adjuvant nape part,
0.2mL/ mouse.
After (2) two weeks, second immune, and the μ g/ mouse of Mycoplasma bovis rMbovP730 antigen doses 100, plus Freund are incomplete
The subcutaneous multi-point injection of adjuvant nape part.
(3) after four weeks, third time is immune, and the μ g/ mouse of Mycoplasma bovis rMbovP730 antigen doses 100, plus Freund are incomplete
The subcutaneous multi-point injection of adjuvant nape part.
After (4) 7 days, tail point blood sampling is cut, serum is separated, its potency is surveyed with indirect ELISA, that is, uses Mycoplasma bovis rNOX
Antigen wrapper sheet, adds mice serum dilution product and (is purchased from the sheep anti mouse secondary antibody that HRP marks are added after 37 DEG C of incubations, board-washing
Southern Biotech companies) in addition tmb substrate colour developing after 37 DEG C of incubations, board-washing.Choose the high serum of potency and do many grams
Grand antibody is used.
2.2MbovP730 protein-specifics are detected
In PPLO culture mediums, (PPLO 10.5g, dusty yeast 2.5g, Sodium Pyruvate 0.5g, ultra-pure water is settled to 440mL, 121
DEG C sterilizing 20min after, add horse serum 50mL, sterilize 10 × MEM 5mL, sterile 80,000 units/mL penicillin solution 5mL,
The sterile μ L of 1% phenol red solution 500) in cultivate HB0801 plants of Mycoplasma bovis (CCTCC deposit number CCTCC NO respectively：
M2010040), Mycoplasma bovis (vaccine strain) Mbov HB0801-150.2, (Mycoplasma bovis Mbov HB0801-150.2,
Mycoplasma bovis Mbov HB0801-150.2 delivered Chinese Wuhan Wuhan Universitys Chinese Typical Representative on March 31st, 2011
Culture collection preservation；Deposit number CCTCC NO:M2011102), mycoplasma agalactiae type strain PG2 is (purchased from U.S.
State's Type Tissue Collection, numbering ATCC NO:35890).Pasteurella (Pm-AL) is cultivated in LB fluid nutrient mediums
(state Key Laboratory of Agricultural Microbiology virus part room is clinically separated for Mh-L plants of strain and haemolysis Mannheimia
Preserve strain, document see thank it is pretty eat, 2015), 7H9 (4.7g 7H9 powder be dissolved in 900mL distilled water (contain glycerine
2mL or 0.5g Tween-80s), 121 DEG C, 10min high pressure steam sterilizations.When culture medium temperature is down to 45 DEG C, sterile bar
100mL OADC enrichment liquids (BD companies) are added under part) 1458 plants of (Hua Zhong Agriculture University of middle culture mycobacterium tuberculosis var bovis
Agromicrobiology National Key Laboratory virus part room is clinically separated identification, and document is shown in Chen et al., 2009), in bovine kidney cells
Middle BHV-1 plants of infectious bovine rhinotrachetis virus of culture (document is shown in Zhang et al., 2011).Except the full bacterium egg of mycobacterium tuberculosis
To obtain outer by adding 2 × SDS heating (95 DEG C, 30min) in vain, remaining whole bacterial protein all by ultrasonication (power 200W,
The broken 20 minutes time) obtain.Take HB0801 plants of whole bacterial proteins, Mbovis-150 plants of whole bacterial proteins, the full bacterium of mycoplasma agalactiae
Albumen, Pasteurella whole bacterial protein, haemolysis Mannheimia whole bacterial protein, mycobacterium tuberculosis var bovis whole bacterial protein, ox infectiousness nose
Bronchitis virus total protein carries out SDS-PAGE electrophoresis, and (50V, 120min), 5% are transferred on nitrocellulose filter through overly moist
Defatted milk is stayed overnight in 4 DEG C of closings, and TBST washes film three times, with the polyclonal antibody (1 of preparation：500 dilutions) exist as primary antibody
Act on 1 hour at room temperature, film is washed with TBST three times, with 1：The HRP- sheep anti-mouse iggs of 10000 times of dilutions are incubated 1 hour,
Film is washed with TBST three times, then wash with TBS film three times, (Thermo is purchased from Super Signal West Pico Trial Kit
Scientific) develop the color.As a result show that polyclonal antibody can recognize 36KD or so target protein (MbovP730), in ox branch
The destination protein of this particular size can be detected in PG2 plants of HB0801 plants of substance and mycoplasma agalactiae.
Embodiment 3：Mycoplasma bovis MbovP730 albumen is immune in differentiation Mycoplasma bovis street strain's natural infection and mycoplasma bovis vaccine strain
In application
3.1 detect serum using M.bovis HB0801 whole bacterial proteins as envelope antigen by indirect ELISA method
(1) animal blood serum sample is collected：Mycoplasma bovis street strain natural infection serum origin is doubtful in the Mycoplasma bovis of clinical test
Infected cattle, mycoplasma bovis vaccine strain Mbov HB0801-150.2 (i.e. Mycoplasma bovis Mbov HB0801-150.2) are (by M.bovis
HB0801 is inoculated with PPLO fluid nutrient mediums in vitro, is within 3 days a generation, the generation of serial passages in vitro 150 gained) immune serum source
In clinical test, negative serum derives from the blank group that clinical immunization is tested.
(2) prepared by whole bacterial protein：M.bovis HB0801 (compound methods on PPLO culture mediums：PPLO powder 10.5g are taken,
Dusty yeast 2.5g, Sodium Pyruvate 0.5g, are settled to after 440mL, 121 DEG C of sterilizing 20min with ultra-pure water, add horse serum 50mL,
Sterilize 10 × MEM 5mL, sterile 80,000 units/mL penicillin solutions 5mL, the sterile μ L of 1% phenol red solution 500) culture 2
My god, take 100ml nutrient solutions in being centrifuged 10 minutes under 10000rpm, washed with PBS after 2 times, add 1ml PBS weights
Outstanding precipitation.It is broken (power 200W crushes 20 minutes time) using Ultrasonic Cell Disruptor, take the albumen after crushing to freeze in -20 DEG C.
(3) it is coated with：With coating buffer (Na2CO31.59g, NaHCO32.93g, plus ddH2O to 1000ml) dilution concentration
M.bovis HB0801HB0801 whole bacterial proteins afterwards, 96 hole elisa Plates press the M.bovis that the amount per hole 1250ng is added after dilution
The μ l of HB0801 whole bacterial proteins liquid 100,4 DEG C of coatings are stayed overnight.Coating buffer is discarded, adds 300 μ l PBST buffer solutions (preparation sides per hole
Method, PBS is prepared:NaCl 8.0g, KCl 0.2g, Na2HPO4·12H2O 2.9g, NaH2PO40.2g, plus ddH2O
To 1000ml.PBST buffers:Add in 0.05% Tween-20 to PBS is PBST buffer solutions) washing 3
It is secondary, 2 minutes every time.
(4) close：100 μ l 5% skim milk (5g skim milks add PBST to 100ml) is added per hole to 96 hole elisa Plates,
It is placed in 37 DEG C of incubators and closes 1h, dry confining liquid, the PBST for adding 300 μ l is washed 3 times, every time 2 minutes.
(5) it is loaded：With PBST (adding 1000ml PBS by 500 μ l Tween-20s to be made) with 1:100 (V/V) ratios are dilute
Serum to be detected is released, adds to 96 hole elisa Plates per hole and cultivates 1h at the serum after 100 μ l dilutions, 37 DEG C；Solution in hole is dried,
The PBST for adding 300 μ l is washed 3 times, every time 2 minutes.
(6) goat-anti ox (IgG Fc-HRP) ELIAS secondary antibody is added)：(1000ml PBS are added with PBST by 500 μ l Tween-20s
It is made) with 1:5000 (V/V) dilution proportion ELIAS secondary antibody (being purchased from Southernbiotech companies), to 96 hole elisa Plates
Goat-anti ox (IgG Fc-HRP) ELIAS secondary antibody added per hole after 100 μ l dilutions, is placed in 37 DEG C and is incubated 60 minutes；Dry hole
Middle solution, adds 300 μ l PBST and washes 5 times, every time 2 minutes.
(7) substrate colour developing is added：Tmb substrate nitrite ion A liquid and tmb substrate nitrite ion B are added per hole to 96 hole elisa Plates
Liquid (being purchased from Wuhan Keqian Animal Biological Products Co., Ltd.) each 50 μ l, lucifuge colour developing 10min；50 μ l are added to terminate per hole
Liquid (being purchased from Wuhan Keqian Animal Biological Products Co., Ltd.) terminating reaction；Determined with ELIASA under 630nm wavelength
OD630Value.
(8) average value (M) and standard deviation (SD), serum to be detected are calculated by sample of 17 parts of negative serum OD values
OD values are considered as positive when being more than M+2SD.The positive serum filtered out, Post-immunisation serum, blank group serum are used
GraphPad softwares carry out variance analysis.
3.2 indirect ELISA using the rMbovP730 albumen of the present invention as antigen differentiates that mycoplasma bovis vaccine is immunized and street strain's natural sense
Dye
Using 3.1 positive serums screened as the serum of Mycoplasma bovis street strain natural infection and with mycoplasma bovis vaccine strain Mbov
Serum after HB0801-150.2 is immune is primary antibody, and serum sample, serum sample are detected by above-mentioned 2.1 step methods described
Detected value is shown in Table 1.GraphPad software threshold values are used according to detected value.
The Mycoplasma bovis street strain natural infection of table 1 and vaccine strain Post-immunisation serum antidiastole value
Embodiment 3：Mycoplasma bovis rMbovP730 albumen distinguishes Mycoplasma bovis street strain's natural infection and mycoplasma bovis vaccine strain is immune
The assembling of ELISA kit
The ELISA kit essential core reagent of the present embodiment includes rMbovP730 albumen (being used as antigen) 2 pieces of plate of coating
96 hole elisa Plates, 50ng/ holes), Mycoplasma bovis ELISA is negative, and (i.e. mycoplasma bovis vaccine strain Mbov HB0801-150.2 are immunized
Serum afterwards), each 1 pipe (0.5ml/ pipes) of Mycoplasma bovis positive control (M.bovis HB0801 natural infections serum), sample is dilute
1 bottle of liquid (40ml/ bottles) is released, goat-anti ox (IgG Fc-HRP) enzyme mark secondary antibody 1 manages (200 μ l/ pipes), 20 times of concentrated cleaning solutions
1 bottle (30ml/ bottles), tmb substrate nitrite ion A liquid, each 1 bottle of tmb substrate nitrite ion B liquid (10ml/ bottles), terminate liquid 1
Bottle (10ml/ bottles)；Remaining reagent is prepared according to the following steps：
(1) 20 times of concentrated cleaning solution：NaCl 160g、KCl 4g、Na2HPO4·12H2O 58g、KH2PO44g, Tween-20
10ml is settled in 1000ml purified waters.
(2) goat-anti ox (IgG Fc-HRP) ELIAS secondary antibody：Purchased from Southernbiotech, with protective agent (containing 1%BSA's
PBST solution (M/V) is diluted to 1:500 times of intermediate concentrations.
(3) confining liquid：Phosphate buffer containing 5% skimmed milk.
(4) sample diluting liquid：Phosphate buffer containing 0.05% Tween-20.
(5) substrate solution：Tmb substrate nitrite ion A liquid is prepared：Na2HPO414.6g, citric acid 9.33g, carbamide peroxide
0.52g, plus purified water is to 1000ml, is adjusted to pH value 5.0~5.4；Tmb substrate nitrite ion B liquid is prepared：TMB20mg,
Absolute ethyl alcohol 10ml, plus purified water is to 1000ml.
(6) terminate liquid：0.25% hydrofluoric acid.
Vocabulary of terms explanation：
In this manual：
Mycoplasma bovis street strain, is represented with Mycoplasma bovis HB0801, is abbreviated as M.bovis HB0801；
Mycoplasma bovis vaccine strain, is represented with Mbov HB0801-150.2.
Leading reference
1. thank it is pretty eat, Jiang Peng, the oxen Mannheimia haemolytica such as Peng Qingjie and pasteurella multocida A types, the Chinese milk cows of Identification research of Type B,
2015,14:0048‐0053.
2.Chen Y,Chao Y,Deng Q,et al.Potential challenges to the Stop TB Plan for humans in China；cattle maintain M.
bovis and M.tuberculosis.Tuberculosis,2009,89:95‐100.
3.Zhang M,Fu S,Deng M,et al.Attenuation of bovine herpesvirus type 1 by deletion of its glycoprotein G and
tk genes and protection against virulent viral challenge.Vaccine,2011,29(48):8943‐50。
Claims (4)
1. a kind of antidiastole Mycoplasma bovis street strain infection and the Mycoplasma bovis specific proteins MbovP730 of vaccine strain, it is special
Levy and be, encode the nucleotide sequence such as sequence table SEQ ID NO of the albumen:Shown in 13.
2. a kind of antidiastole Mycoplasma bovis street strain infection and the Mycoplasma bovis specific proteins MbovP730 of vaccine strain, it is special
Levy and be, the protein sequence such as sequence table SEQ ID NO of the albumen:Shown in 14.
3. a kind of pET-30-Mbov_730 of the Mycoplasma bovis MbovP730 albumen containing described in expression claim 1 recombinates matter
The Escherichia coli of grain, are deposited in China typical culture collection center, and deposit number is CCTCC NO:M2015762.
4. the Mycoplasma bovis MbovP730 albumen described in claim 1 is preparing the infection of antidiastole Mycoplasma bovis street strain and epidemic disease
Application in seedling strain kit, it is characterised in that used as antigen protein, the antigen protein includes SEQ ID NO:13
Shown nucleotide sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610144587.2A CN107176977B (en) | 2016-03-11 | 2016-03-11 | Application of mycoplasma bovis Mbovp730 protein in natural infection and vaccine immune identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610144587.2A CN107176977B (en) | 2016-03-11 | 2016-03-11 | Application of mycoplasma bovis Mbovp730 protein in natural infection and vaccine immune identification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107176977A true CN107176977A (en) | 2017-09-19 |
| CN107176977B CN107176977B (en) | 2020-10-27 |
Family
ID=59830424
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610144587.2A Active CN107176977B (en) | 2016-03-11 | 2016-03-11 | Application of mycoplasma bovis Mbovp730 protein in natural infection and vaccine immune identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107176977B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107759674A (en) * | 2017-09-26 | 2018-03-06 | 中国农业科学院哈尔滨兽医研究所 | A kind of Mycoplasma bovis immune-related albumen, the detection kit containing the albumen and its purposes in Mycoplasma bovis antibody test |
| CN109750054A (en) * | 2019-02-21 | 2019-05-14 | 华中农业大学 | A kind of Mycoplasma bovis protein gene MbovGdpP and its application |
| CN110483625A (en) * | 2019-06-20 | 2019-11-22 | 华中农业大学 | A kind of Mycoplasma bovis imagination albumen MbovP732 and its application |
| CN111748507A (en) * | 2020-06-02 | 2020-10-09 | 华中农业大学 | Mycoplasma bovis Mbov _0475 gene mutant strain and application thereof |
| CN111856006A (en) * | 2020-06-22 | 2020-10-30 | 华中农业大学 | Application of mycoplasma bovis secretory protein MbovP274 |
| CN111850002A (en) * | 2020-06-22 | 2020-10-30 | 华中农业大学 | Application of mycoplasma bovis secretory protein MbovP570 |
| CN112125962A (en) * | 2020-07-20 | 2020-12-25 | 天康生物股份有限公司 | Antigen for identifying infection of mycoplasma bovis vaccine strain or wild strain and indirect ELISA detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103172752A (en) * | 2013-03-06 | 2013-06-26 | 重庆市动物疫病预防控制中心 | Mycoplasma bovis diagnosis reagent and its application |
| CN103509756A (en) * | 2012-06-19 | 2014-01-15 | 华中农业大学 | Mycoplasma bovis monoclonal antibody, and preparation method and application thereof |
-
2016
- 2016-03-11 CN CN201610144587.2A patent/CN107176977B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509756A (en) * | 2012-06-19 | 2014-01-15 | 华中农业大学 | Mycoplasma bovis monoclonal antibody, and preparation method and application thereof |
| CN103172752A (en) * | 2013-03-06 | 2013-06-26 | 重庆市动物疫病预防控制中心 | Mycoplasma bovis diagnosis reagent and its application |
Non-Patent Citations (2)
| Title |
|---|
| JINGJING QI ET AL.: "Comparative Geno-Plasticity Analysis of Mycoplasma bovis HB0801 (Chinese Isolate)", 《PLOS ONE.》 * |
| NCBI: "hypothetical protein [Mycoplasma bovis]", 《NCBI REFERENCE SEQUENCE: WP_014829978》 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107759674B (en) * | 2017-09-26 | 2021-12-28 | 中国农业科学院哈尔滨兽医研究所 | Mycoplasma bovis immunity-related protein, detection kit containing protein and application of protein in mycoplasma bovis antibody detection |
| CN107759674A (en) * | 2017-09-26 | 2018-03-06 | 中国农业科学院哈尔滨兽医研究所 | A kind of Mycoplasma bovis immune-related albumen, the detection kit containing the albumen and its purposes in Mycoplasma bovis antibody test |
| CN109750054B (en) * | 2019-02-21 | 2021-07-02 | 华中农业大学 | Mycoplasma bovis protein gene MbovGdpp and application thereof |
| CN109750054A (en) * | 2019-02-21 | 2019-05-14 | 华中农业大学 | A kind of Mycoplasma bovis protein gene MbovGdpP and its application |
| CN110483625A (en) * | 2019-06-20 | 2019-11-22 | 华中农业大学 | A kind of Mycoplasma bovis imagination albumen MbovP732 and its application |
| CN111748507B (en) * | 2020-06-02 | 2021-12-03 | 华中农业大学 | Mycoplasma bovis Mbov _0475 gene mutant strain and application thereof |
| CN111748507A (en) * | 2020-06-02 | 2020-10-09 | 华中农业大学 | Mycoplasma bovis Mbov _0475 gene mutant strain and application thereof |
| CN111850002A (en) * | 2020-06-22 | 2020-10-30 | 华中农业大学 | Application of mycoplasma bovis secretory protein MbovP570 |
| CN111856006B (en) * | 2020-06-22 | 2021-07-30 | 华中农业大学 | Application of mycoplasma bovis secretory protein MbovP274 |
| CN111856006A (en) * | 2020-06-22 | 2020-10-30 | 华中农业大学 | Application of mycoplasma bovis secretory protein MbovP274 |
| CN111850002B (en) * | 2020-06-22 | 2022-04-19 | 华中农业大学 | Application of mycoplasma bovis secretory protein MbovP570 |
| CN112125962A (en) * | 2020-07-20 | 2020-12-25 | 天康生物股份有限公司 | Antigen for identifying infection of mycoplasma bovis vaccine strain or wild strain and indirect ELISA detection kit |
| CN112125962B (en) * | 2020-07-20 | 2022-06-14 | 天康制药(苏州)有限公司 | Antigen for identifying infection of mycoplasma bovis vaccine strain or wild strain and indirect ELISA detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107176977B (en) | 2020-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107176977A (en) | Application of the Mycoplasma bovis MbovP730 albumen in natural infection and vaccine immunity differentiate | |
| Harrison et al. | Detection and relationships of cotton leaf curl virus and allied whitefly‐transmitted geminiviruses occurring in Pakistan | |
| CN107118262A (en) | A kind of Mycoplasma bovis MbovP579 albumen and its application | |
| CN107298716A (en) | A kind of recombinant helicobacterpylori protein vaccine and preparation method thereof | |
| CN105296441B (en) | A kind of bovine viral diarrhea virus strain and its application | |
| CN103059109B (en) | Mycoplasma pneumonia antigen, preparation method and immunodetection kit | |
| CN107056898A (en) | 3 type of carp herpesviral, 1301 plants of ORF136 DNA recombinant expressions albumen, antibody and its application | |
| CN113943714A (en) | Cat calicivirus strain and application thereof | |
| CN114807060A (en) | Coxsackie virus A6 type strain and immunogenic composition and application thereof | |
| Andrianova et al. | Foot and mouth disease virus polyepitope protein produced in bacteria and plants induces protective immunity in guinea pigs | |
| CN110483625A (en) | A kind of Mycoplasma bovis imagination albumen MbovP732 and its application | |
| KR102707584B1 (en) | Recombinant nucleocapsid protein for diagnosis and vaccine of COVID-19 and use thereof | |
| CN105039233B (en) | A kind of B. abortus molecular marker vaccine strain and its application | |
| CN116445448B (en) | Acinetobacter baumannii PLPFP recombinant protein, preparation method and application | |
| CN111621506B (en) | Mycoplasma bovis secretory protein Mbovp0145 and application thereof | |
| CN104726413B (en) | The monoclonal antibody of one plant of Mycoplasma bovis nadh oxidase | |
| CN116478953A (en) | Acinetobacter baumannii DlaT recombinant protein, preparation method and application | |
| CN110257405A (en) | Mycoplasma bovis alcohol dehydrogenase gene and its coding albumen and application | |
| CN105693831A (en) | Livestock S2 vaccine immunity and Brucella melitensis/abortus infection IELISA (enzyme linked immunosorbent assay) detection reagent | |
| CN113512098B (en) | Indirect ELISA (enzyme-Linked immuno sorbent assay) method for identifying swine fever virus and bovine viral diarrhea virus serum antibodies and application thereof | |
| CN106397546B (en) | Artificial recombinant antigen of O-type foot-and-mouth disease virus, preparation and application thereof | |
| CN104888208B (en) | The application of Rhodococcus equi Disease-causing gene VapA recombinant proteins | |
| CN107586323A (en) | One mycoplasma species albumen and its application in vaccine | |
| CN105384800B (en) | Staphylococcus aureus TAF fusion protein preparation method and applications | |
| CN103596588B (en) | For the compositions of dog prdc |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |