CN101745104B - Tuberculosis subunit vaccine containing compound adjuvant - Google Patents
Tuberculosis subunit vaccine containing compound adjuvant Download PDFInfo
- Publication number
- CN101745104B CN101745104B CN201010107449XA CN201010107449A CN101745104B CN 101745104 B CN101745104 B CN 101745104B CN 201010107449X A CN201010107449X A CN 201010107449XA CN 201010107449 A CN201010107449 A CN 201010107449A CN 101745104 B CN101745104 B CN 101745104B
- Authority
- CN
- China
- Prior art keywords
- vaccine
- cpg
- bcg
- dna
- tuberculosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a tuberculosis subunit vaccine which takes Ag85b, ESAT6, CFP10 and HspX protein as antigen components of the vaccine and takes Al (OH)3 and BCG-CpG-DNA (DNA extract of BCG) as a compound adjuvant. By taking Ag85b, ESAT6, CFP10 and HspX protein as the antigen components of the vaccine, the vaccine not only can prevent the infection from the tubercle bacillus, but also can prevent the tuberculosis of the person infected with tubercle bacillus and has the function of preventive treatment. By taking Al (OH)3 and BCG-CpG-DNA as the compound adjuvant, the vaccine can effectively improve the immune effect of the vaccine, promotes the T cell proliferation, adjusts the dynamic balance of Th1 and Th2, and leads the T cell immunity to transform towards Th1 predominant response.
Description
Technical field
The application relates to a kind of tuberculosis subunit vaccine, and this Vaccinum Calmette-Guerini is the antigen composition with Ag85b, ESAT6, CFP10 and HspX albumen, with Al (OH)
3And BCG-CpG-DNA (deriving from the DNA extraction thing of BCG) is a composite adjuvant.
Background technology
Tuberculosis is a kind of ancient infectious disease that but still has a strong impact on human health, and in recent years, global tuberculosis is revivable, becomes public health problem and social problem that the whole world is paid close attention to once more.World Health Organization (WHO) is again with the infectious disease of tuberculosis as emphasis control, and points out, the main cause that tuberculosis is staged a comeback is that the popular and tuberculosis of appearance, AIDS of a large amount of tuberculosis Resistant strain is out in the cold in global public health policy.China is the high burden of second-biggest-in-the-world tuberculosis country, and a large amount of the flowing of population is one of China's tuberculosis principal element occurred frequently, and the annual death toll that causes because of tuberculosis is other infectious disease death toll sums.At present, still there are a large amount of tubercule bacillus latent infection persons in China except 4,500,000 tuberculosis patients are arranged.Therefore, the research of the tuberculosis vaccine of China must be based on China specific national conditions and infection state.
Since few to the effective antibiotic kind of tubercule bacillus, and a large amount of tuberculosis Resistant strains has appearred, therefore to finally control and defeat tuberculosis, just must rely on effective vaccine.
Vaccinum Calmette-Guerini can be divided into preventative vaccine and therapeutic vaccine according to its application.Be accustomed to said vaccine and just be meant preventative vaccine, mainly play the disease prevention effect; Therapeutic vaccine has the disease treatment effect; Briefly say and be meant the immunocompetence of in the body that infects tubercule bacillus, passing through vaccine immunity transfer host; The tubercule bacillus (the especially antibacterial of latent infection) of killing and wounding or suppressing to invade and hide, thus play the treatment or the effect of assistant chemical Drug therapy.
Bacillus calmette-guerin vaccine (BCG) is as present unique available tuberculosis vaccine; The particularly heavy tuberculosis of infant tuberculosis there is remarkable preventive effect; But the overall protection poor effect to total man crowd is mainly reflected in two aspects: the one, and the BCG effective protecting time is short, to adult's unprotect effect, and the 2nd, bacillus calmette-guerin vaccine only can prevent primary infection; To several no preventive effect of the crowd who infects tubercule bacillus, so be difficult to control the growth of new tuberculosis case.
So ideal Vaccinum Calmette-Guerini preferably can prevent the infection of tubercule bacillus; Tuberculosis takes place in the person to prevent from the mycobacterium tuberculosis infection again; Therefore, to the above-mentioned defective of BCG, tuberculosis vaccine research at present just is being superior to the alternative vaccine of BCG by early stage single searching; Carry out the transition to prevention demand, the dissimilar tuberculosis vaccine of research gradually, mainly contain following three research directions to different crowd:
(1) first immune Seedling will substitute vaccine as BCG, the primary infection of prevention tulase.But be limited to current mankind pathogenesis lungy and immunoprotection mechanism etc. is still had a lot of indefinite places, the research that BCG substitutes vaccine does not make a breakthrough for many years, and this research will be a long process.
(2) just exempt from-strengthen vaccine, strengthen the protection effect of BCG or the guard time of prolongation BCG, improve existing vaccine the phthisical protection effect of being grown up.
(3) infection population is used vaccine, and tuberculosis takes place prevention tubercule bacillus latent infection person, or as the adjunctive therapeutic vaccine of active tuberculosis.There are nearly 600,000,000 tubercle bacillus affection persons in China, and wherein 10% people finally tuberculosis can take place, and its sickness rate is high, number is huge.Therefore, infection population most possibly has an immense impact on to China's tuberculosis control with vaccine in a short time.
Therefore in the research field of tuberculosis vaccine, progressively occurred adopting different immunization strategies to prevent the dissimilar vaccine researches of same pathogen associated diseases, this is unique on the vaccine research history, but possibly be the only stage which must be passed by of controlling tuberculosis.
From angled the saying of the present vaccine group of studying, Vaccinum Calmette-Guerini can be divided into whole-bacterial-vaccine, dna vaccination and subunit vaccine etc. according to its kind:
1) whole-bacterial-vaccine: comprise attenuated live vaccine and killed mycobacterium vaccine.What attenuated live vaccine research was at present relatively concentrated is recombinant BCG (rBCG), attenuation mycobacteria vaccine (like the auxotrophy strain) and other mycobacteria carrier or vector-viral vaccine.Wherein, rBCG research at most, expressions/overexpression specific antigen in BCG normally is strengthening BCG protection effect, in the hope of as first immune Seedling, in order to prevent the primary infection of tubercule bacillus.Other mycobacteria carrier or vector-viral vaccines comprise with branch bacillus such as shame dirts being carrier, being the vaccine that vector expression has strong immunogenic tubercle bacillus antigen with adenovirus, vaccinia virus, can be used for the postvaccinal booster immunization of BCG.Attenuated live vaccines such as auxotrophy property MTB owing to there is the probability of variation back reversion, make its research and application receive certain restriction.The safety of killed mycobacterium vaccine is good, has good immunoregulation effect, can be used for latent infection person's the prevention and the auxiliary treatment of tuberculosis patient.
2) dna vaccination: though have prospect preferably, the development of tuberculosis dna vaccination depends on the development of whole nucleic acid vaccine, and the dna vaccination immune protective effect of report is difficult to surpass BCG mostly at present.Do not obtain as yet confirming about great number of issues such as the safety of dna vaccination, immunization ways, continuous expression abilities.
3) subunit vaccine: how to be the basis, mainly to comprise the antigenic substance of tubercule bacillus secretory protein (how by RD1 district gene code) and cell wall protein and rest period tubercule bacillus expression etc. with the tubercule bacillus protective antigen.Subunit vaccine can the specific CD that induces
4 +Th1 cell and CD
8 +The CTL cell activation, and safe in utilization, be one of ideal vaccine form.Because have genetic diversity among the crowd, though single proteantigen can have certain immune protective, spectrotype is narrow, also is not enough to cause effective immunoprotection, a plurality of antigens or polypeptide amalgamation and expression are helped to improve the immune protective rate of vaccine.The effective adjuvant of subunit vaccine needs is auxiliary in addition just can cause ideal immunne response, and different immunological adjuvants can cause the immunoreation of Th1 or Th2 different directions.Therefore subunit vaccine is mainly considered two factors when design: the one, and antigenic selection, the 2nd, the application of adjuvant.
In antigenic selection; With regard to the tuberculosis subunit vaccine; The tuberculosis protective immunity mainly is a cellular immunization; The immunoreactive antigen of inducing cell mainly is present in cell wall, Cytoplasm and the culturing filtrate of mycobacterium tuberculosis, and wherein the albumen on secretory protein and cell wall surface is main protective antigen.
The Ag85 complex is the main secretory protein of tubercule bacillus (accounting for 30%); Can be divided into three component: Ag85a, Ag85b, Ag85c; Main effect is to make mycobacteria and fibronectin produce high-affinity; Activity with branched acyl transferring enzyme is that trehalose synthesis two branch acid esters are necessary, and the latter keeps the necessary important structure of mycobacterium tuberculosis cell wall integrity.Wherein the Ag85b full name is antigen 85 complex B (antigen 85 complex B); Have another name called branched acyl transferring enzyme (Mycolyl transferase 85B); Fibronectin binding protein B (fibronectin-binding protein B) is expressed by gene Rv1886c (gene fbp).Full length gene 978bp, albumen total length 325 aminoacid have mainly been participated in branch's acylated process of mycobacterium tuberculosis cell wall.Ag85b is ID:885785 at the serial number of Genebank; Its preparation method can be with reference to following document: De Wit L; Palou M, Content J.Nucleotide sequence of the85B-protein gene of Mycobacterium bovis BCG and Mycobacterium tuberculosis.DNA Seq.1994; 4 (4): 267-70; Harth G; Lee BY; Wang J, Clemens DL, Horwitz MA.Novel insights into the genetics; Biochemistry, and immunocytochemistry of the30-kilodalton major extracellular protein of Mycobacterium tuberculosis.InfectImmun.1996 Aug; 64 (8): 3038-47; Erratum in:Infect Immun 1997 Feb; 65 (2): 852.CFP-10 (10kDa culture filtrate protein) and ESAT6 (early secretory antigenictarget 6kDa) all are the early stage secretory proteins of tubercule bacillus, all have the ability of very strong inducing cell immunity.Two proteic genes all belong to tubercle bacillus gene difference district 1 (RD1), and the RD1 district lacks in BCG and most of non-tuberculous mycobacteria.
The serial number of CFP-10 in Genebank is ID:886194; Its preparation method can be with reference to following document: Berthet FX; Rasmussen PB; Rosenkrands I, Andersen P, Gicquel B.AMycobacterium tuberculosis operon encoding ESAT-6 and a novellow-molecular-mass culture filtrate protein (CFP-10) .Microbiology.1998 Nov; 144 (Pt 11): 3195-203; Barnes PF, Mehra V, Rivoire B; Fong SJ, Brennan PJ, VoegtlineMS; Minden P; Houghten RA, Bloom BR, Modlin RL.Immunoreactivity of a 10-kDaantigen of Mycobacterium tuberculosis.J Immunol.1992 Mar 15; 148 (6): 1835-40.
The serial number of ESAT6 in Genebank is ID:886209; Its preparation method can be with reference to following document:
AL; Nagai S; Houen G; Andersen P, Andersen AB.Purification andcharacterization of a low-molecular-mass T-cell antigen secreted by Mycobacteriumtuberculosis.Infect Immun.1995 May; 63 (5): 1710-7; Berthet FX; Rasmussen PB; Rosenkrands I; Andersen P, Gicquel B.A Mycobacterium tuberculosis operonencoding ESAT-6 and a novel low-molecular-mass culture filtrate protein (CFP-10) .Microbiology.1998 Nov; 144 (Pt 11): 3195-203.
The method for preparing of fusion rotein CFP10-ESAT6 can be with reference to following document: Li H, Chen J, Liu G; Yao W; Yang J, Liu Y, Zeng L; Tian Y, Wang T.Construction and expression of theprokaryotic expression vector of MTB cfp10-ESAT6 fusion gene.Sheng Wu Yi XueGong Cheng Xue Za Zhi.2007 Jun; 24 (3): 636-40; Wang XY; Bao L; Zhao MC; ZhangHD, Long Y.Expression of the fusion protein CFP 10-ESAT6 of Mycobacteriumtuberculosis and the study of its immunogenicity.Sichuan Da Xue Xue Bao Yi XueBan.2006 May; 37 (3): 353-6.Chinese.
HspX has another name called alpha-crystal albumen (alpha-crystallin); It is a kind of inboard heat shock protein (heat shock protein) of mycobacterium tuberculosis cell membrane that is positioned at; Belong to little heat-shock protein family (small heat shockprotein family), express by gene Rv2031c (hspX).Full length gene 435bp, albumen total length 144 aminoacid.Possible effect is to keep the activity of tubercule bacillus at incubation period (symptomless infection state), and duplicating for thalline in initial infection also to have effect, possibly be the preclinical important target antigen of tubercule bacillus.
The serial number of HspX in Genebank is ID:887579; Its preparation method can be with reference to following document: Haile Y; Bjune G; Wiker HG.Expression of the mceA, esat-6 and hspX genes inMycobacterium tuberculosis and their responses to aerobic conditions and torestricted oxygen supply.Microbiology.2002Dec; 148 (Pt 12): 3881-6; Roupie V; Romano M; Zhang L; Et al.Immunogenicity of eight dormancy regulon-encodedproteins of Mycobacterium tuberculosis in DNA-vaccinated and tuberculosis-infectedmice.Infect Immun, 2007,75 (2): 941-9.
Ag85b and ESAT6 are used as the tuberculosis subunit vaccine and demonstrate certain protection power at present.Research shows; In the mice body of mycobacterium tuberculosis infection; ESAT6 has produced certain protection effect (document: Olsen AW; Hansen PR, Holm A, Andersen P.Efficient protection against Mycobacteriumtuberculosis by vaccination with a single subdominant epitope from the ESAT-6antigen.Eur J Immunol 2000; 30:1724-1732).And behind the fusion rotein and adjuvant coupling based on ESAT6 and Ag85b; In the mice body, produced more persistent protective effect (document: Weinrich Olsen A; Van Pinxteren LA; Meng Okkels L, Birk Rasmussen P, Andersen P.Protection of micewith a tuberculosis subunit vaccine based on a fusion protein of antigen 85b andesat-6.Infect Immun 2001; 69:2773-2778).
And HspX is used for the research not discovery as yet of subunit vaccine; But there is article to point out the albumen that expression raises as incubation period; HspX has certain advantage (document: Andersen P.Vaccine strategies against latent tuberculosis infection.TRENDS inMicrobiology.2006 Vol.15 No.1) as tubercule bacillus latent infection person's preventative vaccine.
In the application of adjuvant, in tuberculosis subunit vaccine, the adjuvant of research mainly contains MPL (monophosphoryl lipid A at present; 3-0-descyl-4 '-monophosphoryl lipidA), Freund's complete adjuvant and Freund, DDA (dimethyl hexatriacontane base amine; Dimethyl dioctadecyl ammoniumbromide), QS21, AS01; AS02, AS04 etc.
The adjuvant that unique approval is used in the listing vaccine at present is Al (OH)
3But, Al (OH)
3Mainly cause Th2 type immunne response, when being used in Vaccinum Calmette-Guerini separately, can not cause enough cellullar immunologic responses, and the latter is antiphthisic main protective immunity.In addition, Al (OH)
3The untoward reaction meeting significantly increases after the multiple injection, and tuberculosis latent infection person prevention or tuberculosis adjunctive therapeutic vaccine all need multiple injection in vivo, and therefore, the conventional aluminum adjuvant seldom is considered in present tuberculosis subunit vaccine.
MPL uses comparatively extensive; Use or all better (for example: OlsenAW separately with DDA associating result of use; Williams A; Okkets IM, Hatch G, Andersen A.Protective effect of a subunitvaccine based on a fusion of antigen 85B and ESAT-6 in the aerosol guinea pig model.Infect Immun 2004; 72:6146-50.).MPL and Saponin class adjuvant QS21 add the main component that Squalene and vitamin E have just constituted adjuvant AS01 and AS02 after with a certain amount of proportioning again, and some obtains effect preferably to back two kinds of adjuvants in grinding Vaccinum Calmette-Guerini abroad.
But the reasonable adjuvant of these present effects is formed complicacy, costs an arm and a leg, and final vaccine product price is raise, on the other hand also can be because of obtaining to be difficult for limiting their application in Vaccinum Calmette-Guerini research and development and evaluation.
In addition; It is main immunne response that the oligodeoxynucleotide (CpG ODN) that contains non-methylated CpG dinucleotide can be induced the Th1 type as immunostimulatory sequence; Potential using value is arranged in tumor, anaphylactic disease, also begin progressively in vaccine adjuvant, to attempt experiment and research at present.Though synthetic and filtered out some activated CpG ODN sequences, because the immunostimulation of CpG ODN has species specificity, activatedly in the zoopery may not necessarily produce immunostimulation at human body.Owing to also do not come to understand the structure activity relationship of CpG ODN, design and synthesize out the yet non-easy thing of CpG ODN that people's physical ability is produced immunostimulation, and the safety of CpG ODN do not verified also.Therefore, also there is certain difficulty with CpG ODN as vaccine adjuvant.
Summary of the invention
As what point out in the background technology, there are nearly 600,000,000 tubercle bacillus affection persons in China, and wherein 10% people finally tuberculosis can take place, and its sickness rate is high, number is huge.Therefore, infection population most possibly has an immense impact on to China's tuberculosis control with vaccine in a short time.This just needs to adopt different immunization strategies, develops dissimilar vaccines and prevents and treats tuberculosis.
In addition, from the present situation that tuberculosis is treated at present, the effect that relies on chemotherapy to come controlling tuberculosis in the crowd, to spread merely is also unsatisfactory.Therefore developing the vaccine with prevention and therapeutical effect will be to chemotherapy extremely favourable replenishing lungy.
Based on such demand and research and development design, the present inventor will have the tubercule bacillus protective antigen combination of different characteristics, and filter out suitable adjuvant, form Vaccinum Calmette-Guerini of the present invention.
On antigenic composition, tuberculosis subunit vaccine of the present invention comprises Ag85b, ESAT6, CFP10 and four kinds of albumen compositions of HspX.These four kinds of albumen compositions can exist with absolute version separately, also can any two or three or the form of four kind of proteic fusion rotein be present in the vaccine, preferred existence form is Ag85b, fusion rotein CFP10-ESAT6, HspX.The weight ratio of these four kinds of albumen compositions in vaccine is: 0.5-2: 0.5-2: 0.5-2: 0.5-2; Be preferably 1: 0.5: 0.5: 1; With the UD vaccine; The content of four kinds of albumen compositions is every kind of albumen 5-20 μ g, is preferably every kind of albumen 5-10 μ g, more preferably Ag85b10 μ g, ESAT6 5 μ g, CFP10 5 μ g, HspX 10 μ g.When the form with Ag85b, CFP10-ESAT6, HspX is present in the vaccine; These three kinds of antigenic weight ratios consist of: 0.5-2: 0.5-2: 0.5-2.; Preferred weight ratio is 1: 1: 1; With the UD vaccine, these three kinds of antigenic content are: every kind of albumen 5-20 μ g is preferably every kind of protein 10 μ g.
Ag85b, ESAT6 and CFP10 albumen belong to the tubercule bacillus protective antigen; Behind vaccine composition immunity human body; Stimulate body to produce for these three kinds of proteic specific cellular immunities, when tubercule bacillus got into or hides in human body, this stronger cellular immunization helped to suppress the propagation of tubercule bacillus; Or promote its removing prevention lungy is had pivotal role.HspX albumen belongs to tubercule bacillus advantage incubation period albumen; Because in incubation period; Other PEs of tubercule bacillus are few, so HspX can induce body to produce stronger cellular immunization tubercule bacillus as vaccine composition incubation period; Help to remove the tubercule bacillus that has got into human body and be in latency, and then help preventing tubercule bacillus latent infection person to develop into tuberculosis patient.The present inventor all has good immunogenicity through above-mentioned immunogenicity of antigens research having been confirmed Ag85b, CFP10-ESAT6 and three kinds of albumen of HspX; Unite to use and all can bring into play antigenic action separately; The vaccine that they are combined to form; Be not only applicable to prevent mycobacterium tuberculosis infection, be applicable to tubercule bacillus latent infection person's treatment yet.
As aforementioned, in subunit vaccine, adjuvant is to improve the active important composition of antigen immune, can produce effective immune response in order to guarantee the subunit vaccine that the present invention forms, and also need filter out suitable adjuvant.
The factor that influences adjuvant effect is a lot, as with the albumen kind of its compatibility, with proteic proportioning, factors such as the preparation technology of adjuvant.Therefore be applicable to the adjuvant of at present existing tuberculosis subunit vaccine, maybe and be suitable for the tuberculosis subunit vaccine of other compositions; And; The reasonable adjuvant of effect is formed complicated at present; Cost an arm and a leg; Their application can make final vaccine product price raise on the one hand, on the other hand also can be because of obtaining to be difficult for limiting their application in Vaccinum Calmette-Guerini research and development and evaluation, and this Vaccinum Calmette-Guerini research and development, production and social bearing capability for China all can produce very big burden.For these reasons, the present inventor studies and screens the adjuvant that is applicable to Vaccinum Calmette-Guerini antigen composition of the present invention.
Consider Al (OH)
3Be at present unique adjuvant that in the listing vaccine, uses, its safety is by checking and approval, and Al (OH)
3Have slow releasing function, helpful to the lasting release realization sustained-release administration of vaccine, therefore hope to use performance Al (OH) through compatibility with other adjuvants
3These advantages.And Al (OH)
3The untoward reaction meeting significantly increases after the multiple injection, needs its content in vaccine of control, and this needs repeatedly the safety of the vaccine of injection most important to improving.
The present inventor discovers that through early stage BCG-CpG-DNA is the DNA extraction thing of BCG, is rich in unmethylated CpG motif among the DNA of BCG, has immunoregulation effect.Consider BCG extensive use in the crowd, the safety of its DNA extraction thing is secure, so the present inventor attempts BCG-CpG-DNA as immunological adjuvant and Al (OH)
3Be used; The result is unexpected to be found, The combined can effectively improve the cellullar immunologic response of body to tuberculosis subunit vaccine of the present invention during as the adjuvant of tuberculosis subunit vaccine of the present invention; Promote the propagation of T cell, regulate the balancing steering Th1 advantage of Th1/Th2 and reply.The effect of composite adjuvant is much better than independent Al (OH)
3Or the result of use of independent BCG-CpG-DNA, also be much better than Al (OH)
3With the compatibility effect of BCG-CpG-DNA and other antigen compositions, such as hepatitis B antigen, epidemic encephalitis polysaccharide antigen etc., this explains not only Al (OH)
3Have synergism with uniting of BCG-CpG-DNA, and Al (OH)
3And synergy arranged also between the antigenic component of BCG-CpG-DNA composite adjuvant and tuberculosis subunit vaccine of the present invention.
The BCG-CpG-DNA of indication of the present invention is the DNA extraction thing of BCG, and it is the mixture of the BCG dna fragmentation of fragment varying length, and it contains unmethylated CpG motif, therefore abbreviates as " BCG-CpG-DNA ".Realizing aspect the immunological adjuvant effect that the size of BCG dna fragmentation is not had special demands,, or more preferably during 5-10kb, can obtain better immunological adjuvant effect if preferred dna fragmentation is not less than 1kb.The DNA of BCG is rich in unmethylated CpG motif, therefore can produce the effect of immunological adjuvant, if the quality percentage composition of CpG more preferably when 21.5-23.5%, can produce better immunological adjuvant effect at 15.75%-24.75% among the preferred BCG-CpG-DNA.
BCG-CpG-DNA can adopt the method for distilling of conventional bacterial genomes DNA to prepare; Also can adopt the method for preparing of Tohru Tokunaga etc., referring to JNCI, 1984; Vol; 72, No.4:955-962 " Antitumor activity of deoxyribonucleic acid fraction from mycobacterium bovisBCG.I.isolation, physicochemical characterization; and antitumor activity " also can adopt the method for preparing of putting down in writing among the Chinese invention patent ZL200410033878.1: collect thalline when bacterial classification inoculation is cultured to logarithmic (log) phase in the culture medium that is fit to mycobacterium growth; Thalline is centrifugal collection supernatant after fragmentation; Supernatant through the precipitate of CTAB (cetyltrimethylammonium base amine) with NaCl solution dissolving back with the no albumin layer of organic solvent extracting collection, this no albumin layer supernatant after the extracting is once more used the Ethanol Treatment collecting precipitation, and this deposition is carried out post processing.The BCG-CpG-DNA that is obtained by these exemplary methods can both be used for tuberculosis subunit vaccine of the present invention, produces good immunological adjuvant effect.On the simplicity of method for preparing, preferably adopt the method for preparing of putting down in writing among the Chinese invention patent ZL200410033878.1, quote in full ZL200410033878.1 as a reference at this.
The CpG content of BCG-CpG-DNA can detect through high performance liquid chromatogram and obtain among the present invention; For example can adopt put down in writing among the ZL200410033878.1 pass through anti-phase-high-efficient liquid phase technique (RP-HPLC), the cytosine (dC) that adopts special methylase SssI to modify the CpG dinucleotide is 5-methylcytosine (m
5-dC), utilize nuclease P 1 and bacterial alkaline phosphatase (BAP) that DNA is hydrolyzed to single deoxynucleoside, utilize anti-phase-high-efficient liquid phase technique (RP-HPLC) to m in the DNA hydrolyzation sample of modification and unmodified
5The difference of-dC detected level and CpG is carried out quantitatively.
In tuberculosis subunit vaccine of the present invention, adjuvant consist of Al (OH)
3And BCG-CpG-DNA, the weight ratio of two kinds of compositions is 28: 1-1: 4, be preferably 14: 3-4: 3; With the UD vaccine, Al (OH)
3With the content of BCG-CpG-DNA be: Al (OH)
30.05mg-0.7mg BCG-CpG-DNA 25 μ g-200 μ g are preferably Al (OH)
30.1mg-0.35mg, BCG-CpG-DNA 75 μ g.
After adding BCG-CpG-DNA, not only improved Al (OH)
3Immunological adjuvant usefulness, and reduced Al (OH)
3Consumption, the present inventor finds under situation about being used, Al (OH)
3Only need the 0.35mg/ agent, just can produce good immunne response effect, this dosage is far below Al (OH)
3Common amount ranges in vaccine.Following table 1 is the aluminium hydroxide consumption requirement of relevant vaccine in three ones of the Chinese Pharmacopoeias (2005 editions), and contrast is visible, through with BCG-CpG-DNA compatibility, Al in the tuberculosis subunit vaccine of the present invention (OH)
3Consumption far below present Al (OH)
3Conventional amount used.
Three (2005 editions) middle vaccines of table 1 Chinese Pharmacopoeia are with the consumption requirement of aluminium hydroxide
| The vaccine title | Aluminium hydroxide content (mg/ml) | Child's consumption (ml/ time) | Adult's consumption (ml/ time) |
| Absorption pertussis diphtheria combined vaccine | 1.0-1.5 | 0.5 | - |
| Absorption whooping cough combined vaccine | 1.0-1.5 | 0.5 | - |
| Adsorb acellular whooping cough combined vaccine | 1.0-1.5 | 0.5 | - |
| Adsorbed Tetanus Vaccine | Be not higher than 3.0 | 0.5 | 0.5 |
| Adsorbed diphtheria Vaccine | Be not higher than 3.0 | 0.5 | - |
| Adsorbed diphtheria Vaccine (adult and teenager are used) | Be not higher than 2.5 | - | 0.5 |
| Adsorbed diphtheria,tetanus toxoid and pertussis vaccine tetanus combined vaccine | Be not higher than 2.5 | 0.5 | - |
| Adsorbed diphtheria,tetanus toxoid and pertussis vaccine tetanus combined vaccine (adult and teenager are used) | Be not higher than 2.5 | - | 0.5 |
| I type hemorrhagic fever with renal syndrome inactivated vaccine | Be not higher than 0.7 | 1.0 | 1.0 |
| II type hemorrhagic fever with renal syndrome inactivated vaccine | Be not higher than 0.7 | 1.0 | 1.0 |
| Two valency hemorrhagic fever with renal syndrome inactivated vaccines | Be not higher than 0.7 | 1.0 | 1.0 |
| Antirabic Vaccine's (Vero cell) | Be not higher than 0.7 | 1.0 | 1.0 |
| Antirabic Vaccine's (hamster kidney cell) | Be not higher than 0.7 | 1.0 | 1.0 |
Beneficial effect of the present invention:
1, cellular immunization is antituberculotic main protective immunity, and wherein, the T lymphocyte immunity is replied and played crucial effects.The present invention replys as the basic index of estimating the body cell immunologic function with the T lymphocyte immunity, finds that tuberculosis subunit vaccine of the present invention has significant reinforced effects to body T lymphocyte responses.
The Th cell is important adjusting cell and effector lymphocyte of immune system, and is different according to excretory cytokine, and the Th cell is divided into Th1 and Th2 two big classes, the former main secretion of gamma-IFN and IL-2 etc., and the latter mainly secretes IL-4, IL-5 and IL-10 etc.The dynamic equilibrium of Th1/Th2 receives multifactor adjusting, and wherein IL-12 is considered to the initiation factor that Th1 replys, and promotes the Th0 cell to the Th1 cell differentiation; Activated T h1 emiocytosis IFN-γ, the latter helps effect sexual cells such as activating macrophage, impels the latter to secrete effect molecules such as NO, and then realizes suppressing or killing the purpose of tubercule bacillus.Have now found that the multiple disease of respiratory system is unbalance relevant with Th1/Th2's, as far as tuberculosis; The Th1 advantage is replied the immunoreation of mediate protection property, and the Th2 advantage is replied and then mediated with the reaction of tardy paraphilia to be master's reaction, to be accompanied by pathologic immunologic injury (Mosmann TR; Sad S.The expanding universeof T-cell subsets:Th1; Th2 andmore.Immunol Today, 1996,17:138-146.).Tuberculosis subunit vaccine of the present invention is the generation of enhancing body Th1 type cytokines effectively, and body Th1/Th2 has been replied significant regulating action, and it is main that body is replied with the Th1 advantage immunoreation lungy.
2, the compositing characteristic of vaccine makes vaccine have prevention and treats two kinds of effects.
3, the adjuvant composition of vaccine is strong to the skeptophylaxis potentiation of antigen composition of the present invention, and its effect is much better than independent Al (OH)
3With independent BCG-CpG-DNA, also be much better than Al (OH)
3With the compatibility effect of BCG-CpG-DNA and other vaccine activity compositions, such as hepatitis B antigen, epidemic encephalitis polysaccharide antigen etc., this explains not only Al (OH)
3Have synergism with uniting of BCG-CpG-DNA, and Al (OH)
3And between the antigenic component in BCG-CpG-DNA composite adjuvant and the tuberculosis subunit vaccine of the present invention synergy is arranged also.
4, the Al (OH) that adopted of the adjuvant composition of vaccine
3All be medicine or the biological product that have been widely used in human body with BCG-CpG-DNA, safe; Mature preparation process is cheap in addition.
Description of drawings
The proteic SDS-PAGE electrophoretogram of Figure 1A g85b
The proteic SDS-PAGE electrophoretogram of Fig. 2 HspX
The proteic SDS-PAGE electrophoretogram of Fig. 3 CFP10-ESAT6
Produce the result of anti--Ag85b-IgG in Fig. 4 tuberculosis subunit vaccine body of the present invention
Produce the result of anti-HspX-IgG in Fig. 5 tuberculosis subunit vaccine body of the present invention
Produce result's (C/E is fusion rotein CFP10-ESAT6) of anti-C/E-IgG antibody in Fig. 6 tuberculosis subunit vaccine body of the present invention
Fig. 7-9 tuberculosis subunit vaccine of the present invention promotes the lymphopoietic result of T
Figure 10-12 tuberculosis subunit vaccine of the present invention promotes the result of peritoneal macrophage secretion IL-12
Figure 13-15 tuberculosis subunit vaccine enzyme linked immunological of the present invention speckle experimental result
Figure 16 tuberculosis subunit vaccine of the present invention is to the organ disease index result of mycobacterium tuberculosis infection Cavia porcellus
Figure 17 tuberculosis subunit vaccine of the present invention is to the spleen tubercule bacillus lotus bacterium amount result of mycobacterium tuberculosis infection Cavia porcellus
The specific embodiment
Below the present invention is carried out the elaboration of optimal way with the mode of embodiment.
Embodiment 1Ag85b, CFP10-ESAT6, three kinds of antigenic preparations of HspX
1, the proteic purification of the clonal expression of Ag85b gene and Ag85b
Discover and seize nucleic acid and the aminoacid sequence of antigen A g85b the tubercule bacillus H37Rv from gene bank, according to aim sequence design primer.Wherein, forward primer P1:5 '-CACG
CATATGACAGACGTGAGCC-3 ' (the line part is the NdeI restriction enzyme site), downstream primer P2:5 '-TT
GAATTCTCAGCCGGCGCCT-3 ' (the line part is the EcoRI restriction enzyme site).With the full genome of H37Rv is template, with above-mentioned primer the purpose fragment is carried out pcr amplification, and amplification system is 50ul (ddH
2O 20.5ul, 10 * Buffer 5ul, Taq enzyme 0.5ul, dNTP 4ul, forward primer 5ul, downstream primer 5ul, dna profiling 10ul); Amplification condition is 94 ℃ of 10min, 94 ℃ of 45s, 62.2 ℃ of 45s, 72 ℃ of 1min, 33 times, 72 ℃ 5min of circulation, 4 ℃ of preservations.The PCR product is through agarose gel electrophoresis, carries out glue and reclaims, and obtains the purpose fragment, behind NdeI and EcoRI double digestion, under the catalysis of T4DNA ligase, is connected for 16 ℃ with pET30a clonal expression carrier respectively and spends the night.The plasmid that connects transforms DH5 α, 37 ℃ of overnight incubation.Choosing colony is in the amplification of 10ml LB culture medium, and with above-mentioned restriction endonuclease digestion, 1% agarose gel electrophoresis is identified behind the extraction plasmid.Positive bacterium colony after identifying is correctly further verified through the plasmid order-checking, and is confirmed that its gene order is correct.
From the correct bacterium colony that checks order, extract plasmid and transform the BL-21 competent cell; Obtain the reorganization bacterium; In the LB fluid medium, cultivate the reorganization bacterium, treat bacterium liquid 600nm optical density (optical density, OD) value reaches at 0.6～0.8 o'clock; It is 0.8mmol/L that adding isopropyl-(IPTG) makes its final concentration, abduction delivering 4h.
Centrifugal bacterium liquid through abduction delivering, (Tris 50mmol/L, EDTA2mmol/L) washing back is resuspended, and is centrifugal after the ice-bath ultrasonic cracking, abandon supernatant with the T-E buffer for bacterial sediment.Deposition is washed the centrifugal supernatant of abandoning 1-3 time after using the T-E buffer that contains 4mol/L Urea resuspended.Deposition is resuspended with the T-E buffer that contains 6mol/L Urea, the centrifugal deposition of abandoning.Supernatant is dialysed fully to the T-E buffer that contains 6mol/L Urea.Carry out purification with Source 30Q anion-exchange column; Go up appearance (flow velocity 2ml/min) after promptly using A liquid (the T-E buffer that contains 6mol/L Urea) balance pillar; Collect stream and wear the peak, after the baseline stability with B liquid (the T-E buffer that contains 6mol/LUrea and 1mol/L NaCl) linear elution (3ml/min).After collection stream was worn, the gradient renaturation is (6-4-2-0mol/L) to the T-E buffer.
2, the proteic purification of the clonal expression of HspX gene and HspX
Nucleic acid and the aminoacid sequence of antigen HspX from gene bank inquiry tubercule bacillus H37Rv are according to aim sequence design primer.Wherein, forward primer P1:5 '-TTCAT
CATATGGCCACCACCCT-3 ' (the NdeI restriction enzyme site of line part) for adding, downstream primer P2:5 '-GTGC
AAGCTTTCAGTTGGTGGAC-3 ' (the Hind III restriction enzyme site of line part) for adding.With the full genome of H37Rv is template, with above-mentioned primer the purpose fragment is increased in 50 μ l PCR systems, and amplification system is 50ul (ddH
2O 20.5ul, 10 * Buffer 5ul, Taq enzyme 0.5ul, dNTP 4ul, forward primer 5ul, downstream primer 5ul, dna profiling 10ul); Amplification condition is 94 ℃ of 10min, 94 ℃ of 45s, 53.7 ℃ of 45s, 72 ℃ of 1min, 33 times, 72 ℃ 5min of circulation, 4 ℃ of preservations.Behind the PCR product agarose gel electrophoresis; Carry out glue and reclaim, obtain the purpose fragment, behind NdeI and Hind III double digestion, under the catalysis of T4 dna ligase, be connected for 16 ℃ and spend the night with pET30a clonal expression carrier; The plasmid that connects transforms DH5 α, 37 ℃ of overnight incubation.Choosing colony is in the amplification of 10ml LB culture medium, and with above-mentioned restriction endonuclease digestion, 1% agarose gel electrophoresis is identified behind the extraction plasmid.Positive bacterium colony after identifying is correctly further verified through the plasmid order-checking, and is confirmed that its gene order is correct.
From the correct bacterium colony that checks order, extract plasmid and transform the BL-21 competent cell; Obtain the reorganization bacterium; In the LB fluid medium, cultivate the reorganization bacterium, treat bacterium liquid 600nm optical density (optical density, OD) value reaches at 0.6～0.8 o'clock; It is 0.8mmol/L that adding isopropyl-(IPTG) makes its final concentration, abduction delivering 4h.
Centrifugal bacterium liquid through abduction delivering, bacterial sediment is resuspended with T-E buffer washing back, and is centrifugal after the ice-bath ultrasonic cracking, gets supernatant purification to be done.Carry out purification with anion-exchange column (QHP, Q Sepharose HighPerformance) and hydrophobic (Phenyl Sepharose High Performance) post.With going up appearance (a flow velocity 2ml/min) behind A liquid (T-E buffer) the balance pillar, treat stream wear flow out baseline stability fully after, use 15%, 50% respectively, 100%B liquid (the T-E buffer that contains 1mol/L NaCl) linear elution (3ml/min), collect the 50%B eluent; Behind the T-E buffer balance pillar that contains 40% ammonium sulfate, go up appearance (flow velocity 2ml/min); Treat stream wear flow out baseline stability fully after, respectively with 60%, 80%, 100%B liquid (T-E buffer) eluting, collect the 100%B eluent; Behind the T-E buffer balance pillar that contains 35% ammonium sulfate, go up appearance (flow velocity 2ml/min) again; Treat stream wear flow out baseline stability fully after, respectively with 90%, 100%B liquid (T-E buffer) eluting, collect 100% eluent.
3, the proteic purification of the clonal expression of cfp10-esat6 gene and CFP10-ESAT6
Nucleic acid and the aminoacid sequence of antigen cfp10 and ESAT6 from gene bank inquiry tubercule bacillus H37Rv are according to aim sequence applying gene splicing method design primer.Wherein, forward primer P1:5 '-GATAGTCT of cfp10
CATATGGCAGAGATGAAGACCG-3 ' (the NdeI restriction enzyme site of line part) for adding; The overlapping primer P2:5 ' in the downstream of cfp10-GCTTCCACCTCCTCCGCTTCCACCACCTCCGCTTCCACCGCCACCGAAGCCCATTT GCG-3 '; The overlapping primer P3:5 ' in the upper reaches of esat6-GCTGGCGGTGGAAGCGGAGGTGGTGGAAGCGGAGGAGGTGGA AGCATGACAGAGCAGCAG_-3 '; ESAT6 downstream primer P4 5 '-CAT
GAA TTCCTATGCGAA CATCCCAGTGAC G-3 ' (the EcoRI restriction enzyme site of line part) for adding; P2 deletion termination codon TGA; Introduce complementary Linker (Gly respectively at the 5 ' end of P2 and the 5 ' end of P3
4Ser
1)
3
With the full genome of H37Rv is template, with above-mentioned primer cfp10 and esat6 is increased in the 50ulPCR system respectively, and amplification system is 50ul (ddH
2O 30.5ul, 10 * Buffer 5ul, Taq enzyme 0.5ul, dNTP 4ul, forward primer 4ul, downstream primer 4ul, dna profiling 2ul); Utilize Overlap PCR reaction amplification cfp10-esat6 fusion gene then, amplification system is 50ul (ddH
2O 31.5ul, 10 * Buffer5ul, Taq enzyme 0.5ul, dNTP 4ul, forward primer 4ul, downstream primer 4ul, cfp10 PCR pure products 2ul, ESAT6PCR pure products 2ul).The cfp10 amplification condition is 96 ℃ of 5min, 96 ℃ of 45s, 60 ℃ of 45s, 72 ℃ of 1min, 30 times, 72 ℃ 7min of circulation, 4 ℃ of preservations; The esat6 amplification condition is 96 ℃ of 5min, 96 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min, 30 times, 72 ℃ 7min of circulation, 4 ℃ of preservations; The amplification condition of cfp10-esat6 fusion gene is 96 ℃ of 5min, 96 ℃ of 1min, 64 ℃ of 1min, 72 ℃ of 1min, 30 times, 72 ℃ 7min of circulation.Behind the PCR product agarose gel electrophoresis, carry out glue and reclaim, obtain the purpose fragment, behind NdeI and EcoRI double digestion, under the catalysis of T4DNA ligase, be connected for 16 ℃ and spend the night the plasmid conversion DH5 α that connects, 37 ℃ of overnight incubation with pET30a clonal expression carrier.Choosing colony is in the amplification of 10ml LB culture medium, and with above-mentioned restriction endonuclease digestion, 1% agarose gel electrophoresis is identified behind the extraction plasmid.Positive bacterium colony after identifying is correctly further verified through the plasmid order-checking, and is confirmed that its gene order is correct.
From the correct bacterium colony that checks order, extract plasmid and transform the BL-21 competent cell; Obtain the reorganization bacterium; In the LB fluid medium, cultivate the reorganization bacterium, treat bacterium liquid 600nm optical density (optical density, OD) value reaches at 0.6～0.8 o'clock; It is 0.8mmol/L that adding isopropyl-(IPTG) makes its final concentration, abduction delivering 4h.
Centrifugal bacterium liquid through abduction delivering, bacterial sediment is resuspended with PB buffer washing back, and is centrifugal after the ice-bath ultrasonic cracking, gets supernatant purification to be done.(QHP, Q Sepharose HighPerformance) carries out purification with anion-exchange column.With going up appearance (a flow velocity 2ml/min) behind A liquid (PB buffer) the balance pillar, treat stream wear flow out baseline stability fully after, with 5%B liquid (the PB buffer that contains 1mol/L NaCl) gradient elution (2ml/min), the collection eluent.
4, Identification of Fusion Protein
The SDS-PAGE electrophoresis of the albumen warp 12% behind the purification; And carry out N-terminal and measure, the result, three kinds of albumen molecular weight sizes conform to Ag85b, HspX, CFP10-ESAT6 respectively with the N-terminal aminoacid sequence: three kinds of albumen molecular weight sizes are respectively 34.4kD; 16kD, 23kD; Three kinds of proteic N-terminal aminoacid sequences are respectively MTDVSRKIRAWGRRL, MATTLPVQRHPRSLF and MAEMKTDAATLAQEAG.
The extraction of embodiment 2BCG-CpG-DNA and preparation
Method with reference to record in ", BCG-CpG-DNA preparation " in the ZL200410033878.1 Instructions Page 3-7 specific embodiment and " two, the detection of CpG effective ingredient in the extract "; Preparation is used for the BCG-CpG-DNA of the used tuberculosis subunit vaccine of following experiment, and measures the content of CpG in the extract.The quality percentage composition of CpG is 22.5% among the BCG-CpG-DNA that the employing said method extracts.
The research that embodiment 3 tuberculosis subunit vaccine inducing mouses of the present invention produce immunne response
BALB/c mouse is divided into antigen group (with " Ag " representative), BCG-CpG-DNA group (with " CpG " representative), antigen and Al (OH) at random
3Group (with " Ag+Al " representative), antigen and BCG-CpG-DNA group (with " Ag+CpG " representative), antigen, Al (OH)
3With BCG-CpG-DNA group (with " Ag+Al+CpG " representative), and normal saline matched group (with " NS " representative).
According to dividing into groups to the subcutaneous immune relative medicine of each group mice difference; Each every mouse immune 0.2ml of administration group, wherein each constituent content is that (content among the 0.2ml, i.e. the immunity amount of every animal): Ag comprises each 10 μ g of Ag85b, CFP10-ESAT6 and HspX; CpG 75 μ g, Al (OH)
30.35mg; Every injection of normal saline control group mice 0.2ml normal saline.
The medication synopsis of table 2 administration experimental group
| Group | Dosage (every mouse immune amount) |
| Ag (antigen group) | Each 10 μ g of Ag85b, CFP10-ESAT6 and HspX |
| CpG (BCG-CpG-DNA group) | CpG?75μg |
| Ag+Al (antigen and Al (OH) 3Group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg |
| Ag+CpG (antigen and BCG-CpG-DNA group) | Each 10 μ g CpG, 75 μ g of Ag85b, CFP10-ESAT6 and HspX |
| Ag+Al+CpG (antigen, Al (OH) 3With the BCG-CpG-DNA group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg CpG?75μg |
Immunity 1 time weekly, continuous immunity 3 times.1 week after the last immunity, pluck eyeball and put to death mice, separate peripheral blood serum, be used for the detection of serum antibody; The aseptic spleen of getting, preparation spleen mononuclearcell suspension, the adjustment cell concentration is 1 * 10
6/ ml or 2 * 10
6/ ml; Collect peritoneal lavage fluid, separate peritoneal macrophage, the adjustment cell concentration is 2.5 * 10
6/ ml.
1, serology detects:
With adding after 1000 times of dilutions of mice serum in the enzyme mark version that encapsulates in advance with Ag85b, HspX or C/E albumen (C/E albumen is the CFP10-ESAT6 fusion rotein); After the incubated at room 2 hours, wash and add anti-mouse IgG antibody (HRP labelling) behind the plate, incubated at room is after 2 hours; Wash plate; Add TMB colour developing liquid, room temperature reaction 10-15min adds 2M H
2SO
4Cessation reaction.Measure the 450/620nm absorbance.Anti--Ag85b-IgG, anti-HspX-IgG and anti-C/E-IgG antibody content in the serum analysis.
Testing result is referring to Fig. 4-6.
Visible by experimental result, the subunit vaccine that only contains active ingredient Ag85b, CFP10-ESAT6 and HspX can make body produce corresponding antibody, but wherein the antibody horizontal of HspX is lower, but has added Al (OH)
3Perhaps Al (OH)
3After BCG-CpG-DNA, can improve the antibody horizontal of body HspX significantly, and Al (OH)
3The effect of uniting use with BCG-CpG-DNA is better than independent use Al (OH)
3Or BCG-CpG-DNA; For improving body CFP10-ESAT6 antibody horizontal, Al (OH)
3The effect of uniting use with BCG-CpG-DNA is better than independent use BCG-CpG-DNA; For improving body Ag85b antibody horizontal, Al (OH)
3The effect of uniting use with BCG-CpG-DNA is better than independent use Al (OH)
3Or BCG-CpG-DNA.
Comprehensive these three kinds antigenic antibody situation are visible, antigen, Al (OH)
3With the BCG-CpG-DNA group body is effectively produced to three kinds of antigenic antibody, as the Al (OH) of adjuvant
3Unite use with BCG-CpG-DNA, the effect that is produced is better than independent use Al (OH)
3Perhaps BCG-CpG-DNA, and the result has significant difference.
2, lymphocyte proliferation assay:
With above-mentioned splenocyte packing 96 orifice plates, (cell concentration is 1 * 10 to every hole 200 μ l
6/ ml), add the following stimulus of 20 μ l then, making its final concentration in the hole is ConA (0.8 μ g/ml), PPD (2 μ g/ml), Ag85b (10 μ g/ml), CFP10-ESAT6 (10 μ g/ml), HspX (10 μ g/ml) and culture medium (making blank).37 ℃, 5%CO
2Behind the complete moistening cultivation 70h, every hole adds 15 μ lMTT (5mg/ml), after continuing to cultivate 4h, and the centrifugal supernatant that goes.Every hole adds 100 μ l 20%SDS-DMF cell pyrolysis liquids, and 37 ℃ are spent the night, and puts ELIASA (Wellscan MK3) and goes up colorimetric, and the mensuration wavelength is 570nm, and reference wavelength is 630nm.The OD value meansigma methods of calculating multiple hole is with reaction T cell proliferation intensity.
Experimental result is referring to Fig. 7-9.
Visible by experimental result, no matter be independent antigen, still added Al (OH)
3Perhaps the antigen of BCG-CpG-DNA promotes that the ability of T cell proliferation is all not obvious, and has added Al (OH)
3Significantly improve with T cell proliferation in the antigen group of BCG-CpG-DNA, show the obvious synergistic effect, reflect that body has produced intensive cellullar immunologic response to tuberculosis vaccine of the present invention from numerical value.This shows, Al (OH)
3Unite use with BCG-CpG-DNA and can effectively improve the lymphocytic propagation of T that three kinds of antigens cause, the effect that is produced is better than independent use Al (OH)
3Perhaps BCG-CpG-DNA has synergism.
3, the detection (ELISA method) of peritoneal macrophage secretion IL-12:
With above-mentioned peritoneal macrophage packing 24 orifice plates, (cell concentration is 2.5 * 10 to every hole 1ml
6/ ml); Adhere-wall culture is flush away attached cell not after 2 hours; Add the 1ml culture medium again; And stimulation is former as follows to add 100 μ l respectively, and making its final concentration in the hole is Ag85b (10 μ g/ml), CFP10-ESAT6 (10 μ g/ml), HspX (10 μ g/ml), LPS (10 μ g/ml) and culture medium (making blank).37 ℃, 5%CO
2Centrifugal behind the complete moistening cultivation 48h, get supernatant ,-80 ℃ of preservations.With IL-12 content in the mice IL-12p70ELISA kit measurement peritoneal macrophage culture supernatant.
Experimental result is referring to Figure 10-12.
Visible by experimental result, compare independent antigen and independent Al (OH) with matched group
3Perhaps BCG-CpG-DNA and antigen combination induces the ability of macrophage secretion IL-12 lower; And Al (OH)
3Unite use with BCG-CpG-DNA; With the antigen combination, greatly promoted the ability of macrophage secretion IL-12, reflect of the enhancing of Th0 cell to the Th1 cell differentiation; The balance of T cellular immunization Th1/Th2 is replied conversion to the Th1 advantage, and the effect that is produced is much better than to use separately Al (OH)
3Perhaps BCG-CpG-DNA, the result has significant difference, shows the obvious synergistic effect.
The antigen that this explanation is independent, and independent Al (OH)
3Perhaps BCG-CpG-DNA and antigen combination all can not effectively promote the Th0 cell to the Th1 cell differentiation, is about to the T cellular immunization and is directed to the Th1 advantage and replys.Use Al (OH) and unite
3, BCG-CpG-DNA and antigen, can effectively promote the Th0 cell to the Th1 cell differentiation, will induce the Th1 advantage to reply.
4, enzyme linked immunological speckle experiment (ELISPOT):
Encapsulate culture plate with anti-IFN-γ monoclonal antibody, the sealing of 10%FBS-1640 culture medium is spent the night.The cell suspension (100ul/ hole, 2 * 10 that add above-mentioned every mice in the culture plate
6/ ml), and stimulation is former as follows to add 20 μ l respectively, making its final concentration in the hole is ConA (0.8 μ g/ml), PPD (2 μ g/ml), Ag85b (16 μ g/ml), CFP10-ESAT6 (16 μ g/ml), HspX (16 μ g/ml) and culture medium (making blank).37 ℃, 5%CO
2Complete moistening cultivation 24h, behind the flush away cell, it is anti-to add biotin labeling two to every hole, and room temperature reaction 2h adds enzyme mark Avidin to every hole after washing plate, and room temperature reaction 1h washes and adds substrate to speckle to every hole behind the plate and obviously occur, and after the cessation reaction, dries culture plate.Read the plate appearance with CTL Elispot and count every hole speckle number.
Experimental result is referring to Figure 13-15.
Visible by experimental result, independent antigen does not almost act in the secretion that improves lymphocyte IFN-γ; Contrast is as the Al (OH) of adjuvant composition
3And BCG-CpG-DNA, BCG-CpG-DNA slightly is better than Al (OH) in the ability that auxiliary antigen improves in the lymphocyte IFN-γ secretion
3, but mass action is still very low; And antigen, Al (OH)
3After uniting use with BCG-CpG-DNA, the secretion that has improved lymphocyte IFN-γ greatly reflects that the activation of Th1 cell and the activity after the activation are very high, and the effect that is produced is much better than to use separately Al (OH)
3Perhaps BCG-CpG-DNA, the result has significant difference, shows very obvious synergistic effect.
The antigen that this explanation is independent, and independent Al (OH)
3Perhaps BCG-CpG-DNA and antigen combination all can not effectively produce the Th1 advantage and reply, and uses Al (OH) and unite
3With BCG-CpG-DNA and antigen, can effectively induce the Th1 advantage and reply, and make the activity behind the Th1 cell activation improve the very big raising that shows IFN-γ secretory volume.
The experiment of embodiment 3 shows that the subunit vaccine that only contains antigen composition Ag85b, CFP10-ESAT6 and HspX can make body produce corresponding antibody, but wherein the antibody horizontal of HspX is very low, and is approaching with matched group, but added Al (OH)
3Perhaps Al (OH)
3With the composite adjuvant of BCG-CpG-DNA, can improve the antibody horizontal of HspX in the body significantly, also can improve the antibody horizontal of Ag85b in the body, CFP10-ESAT6.
But with regard to the cellular immunization that causes body, no matter be antigen composition Ag85b, CFP10-ESAT6 and HspX itself, BCG-CpG-DNA itself, or Al (OH)
3Or BCG-CpG-DNA is independent and antigen composition Ag85b, CFP10-ESAT6 and HspX coupling, and effect is all far below Al (OH)
3Unite the effect of use with BCG-CpG-DNA, especially to go up this species diversity obvious especially for the Th1 cell activity after activation (being reflected in the secretion of IFN-γ).
This has proved absolutely, antigen composition Ag85b, CFP10-ESAT6 and HspX are with Al (OH)
3Cooperate the tuberculosis subunit vaccine that forms with BCG-CpG-DNA; Can effectively cause immune response; Especially forming cellullar immunologic response, regulate the balance of Th1/Th2, make it to helping protective immunological reaction lungy---the direction that the Th1 advantage is replied transforms.
Embodiment 4 tuberculosis subunit vaccines of the present invention are to the immune protective effect of mycobacterium tuberculosis infection Cavia porcellus
Cavia porcellus is more responsive to mycobacterium tuberculosis, is the optimization model of tuberculosis vaccine effect evaluation.The present invention is the basis with the guinea pig model, and the immune protective effect of tuberculosis subunit vaccine of the present invention is studied.
With the m tuberculosis infection Cavia porcellus, will infect Cavia porcellus and be divided into Ag, Ag+Al, Ag+CpG, Ag+Al+CpG experimental group and NS matched group at random.Give each administration treated animal immunity relative medicine according to dividing into groups back 5 days of infection, every later at a distance from 2 week immunity 1 time, immune 3 times altogether.Each immunization ways is back leg intramuscular injection 0.2ml/, and wherein each constituent content is that (content among the 0.2ml, i.e. the immunity amount of every animal): Ag comprises each 10 μ g of Ag85b, CFP10-ESAT6 and HspX, CpG 75 μ g, Al (OH)
30.35mg; Normal saline treated animal injection 0.2ml normal saline.
The medication synopsis of table 3 administration experimental group
| Group | Dosage (every Cavia porcellus immunity amount) |
| AG (antigen group) | Each 10 μ g of Ag85b, CFP10-ESAT6 and HspX |
| Ag+Al (antigen and Al (OH) 3Group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg |
| Ag+CpG (antigen and BCG-CpG-DNA group) | Each 10 μ g CpG, 75 μ g of Ag85b, CFP10-ESAT6 and HspX |
| Ag+Al+CpG (antigen, Al (OH) 3With the BCG-CpG-DNA group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg CpG?75μg |
2 weeks were dissected all Cavia porcelluss after the last immunity, each internal organs tuberculosis degree such as the liver of observation Cavia porcellus, spleen, lung, lymph node, and carry out pathological changes with double-blind method and mark; Spleen tubercule bacillus lotus bacterium amount: make serial dilution after the spleen homogenate, inoculate modified Russell medium, counting tubercule bacillus CFU calculates its logarithm value, takes statistics to learn and handles.
Each is organized the scoring of internal organs tuberculosis and sees table 4 and Figure 16.
The scoring of table 4 organ disease
Spleen tubercule bacillus lotus bacterium amount result sees table 5 and Figure 17.
Table 5 spleen tubercule bacillus lotus bacterium amount (lgCFU)
Visible from above-mentioned experimental result, each organ disease scoring of Ag+Al+CpG experimental group Cavia porcellus is lower than other each experimental grouies, and significantly is lower than matched group.Spleen tubercule bacillus lotus bacterium amount also has identical variation tendency.
What deserves to be mentioned is that in Vaccinum Calmette-Guerini effect evaluation field, tubercule bacillus lotus bacterium amount reduces 1-2 lgCFU in the Cavia porcellus spleen, all is very very difficult, this has reduced by one to two one magnitude corresponding to whole lotus bacterium amount.If a Vaccinum Calmette-Guerini is compared with the blank group, can on spleen tubercule bacillus lotus bacterium amount, reduce 1-2 lgCFU, can point out this vaccine to have good protection effect.Bibliographical information is arranged; The effective vaccine of anti-mycobacterium tuberculosis (like bacillus calmette-guerin vaccine) also is to reduce 1-2 lgCFU on the protection effect: compare with negative control group like document (1) BCG group; In 20-60 days, lung and lymph node lotus bacterium amount reduce about 1 lgCFU (DianeOrdway, Marcela Henao-Tamayo after attack; Crystal Shanley; Et al.Infl uence ofMycobacterium bovis BCG Vaccination on Cellular Immune Response of GuineaPigs Challenged with Mycobacterium tuberculosis.CLINICAL AND VACCINEIMMUNOLOGY, Aug.2008, p.1248-1258); Document (2) BCG group is compared with matched group; Lung lotus bacterium amount reduces about 1.35 lgCFU (SUSAN L.BALDWIN; CELINE D ' SOUZA, ALAN D.ROBERTS, et al.Evaluation of New Vaccines in the Mouse and Guinea Pig Model ofTuberculosis.INFECTION AND IMMUNITY; June 1998, p.2951-2959).Vaccinum Calmette-Guerini of the present invention is compared with the normal saline matched group, and spleen lotus bacterium amount reduces nearly 1 lgCFU, with Al (OH)
3Group, perhaps the BCG-CpG-DNA group is compared, and the value of lgCFU has reduced 0.4-0.5 lg value, explains that this kind combination vaccine has the better protect effect.
Embodiment 5 various dose BCG-CpG-DNA and Al (OH)
3Behind composite adjuvant that constitutes and antigen (Ag85b+CFP10-ESAT6+HspX) combined immunization to the tuberculosis protective effect of Cavia porcellus
With the m tuberculosis infection Cavia porcellus, will infect Cavia porcellus and be divided into Ag, Ag+Al, Ag+Al+CpG1, Ag+Al+CpG2, Ag+Al+CpG3, Ag+Al+CpG4, Ag+Al+CpG5 experimental group and NS matched group at random.Give each treated animal immunity relative medicine according to dividing into groups back 5 days of infection, every later at a distance from 2 week immunity 1 time, immune 3 times altogether.Each immunization ways is for only retreating intramuscular injection 0.2ml/, and each concentration of component is in the vaccine: Ag is that Ag85b, CFP10-ESAT6 and HspX mixed by 1: 1: 1, and concentration is 50 μ g/ml (it is 10 μ g that every kind of antigen is injected to every Cavia porcellus); CpG1, CpG2, CpG3, CpG4 and CpG5 concentration are respectively 62.5 μ g/ml, 250 μ g/ml, 375 μ g/ml, 500 μ g/ml and 750 μ g/ml (the CpG dosage of every Cavia porcellus acceptance is respectively 12.5 μ g, 50 μ g, 75 μ g, 100 μ g and 150 μ g); Al (OH)
3Concentration is 1.75mg/ml (dosage of every Cavia porcellus acceptance is 0.35mg); Normal saline treated animal injection 0.2ml normal saline.
The medication synopsis of table 6 administration experimental group
| Group | Dosage (every Cavia porcellus immunity amount) |
| Ag (antigen group) | Each 10 μ g of Ag85b, CFP10-ESAT6 and HspX |
| Ag+Al (antigen and Al (OH) 3Group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg |
| Ag+Al+CpG1 (antigen, Al (OH) 3With the BCG-CpG-DNA group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg?CpG?12.5μg |
| Ag+Al+CpG2 (antigen, Al (OH) 3With the BCG-CpG-DNA group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg?CpG?50μg |
| Ag+Al+CpG3 (antigen, Al (OH) 3With the BCG-CpG-DNA group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg?CpG?75μg |
| Ag+Al+CpG4 (antigen, Al (OH) 3With the BCG-CpG-DNA group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg?CpG?100μg |
| Ag+Al+CpG5 (antigen, Al (OH) 3With the BCG-CpG-DNA group) | Each 10 μ g Al (OH) of Ag85b, CFP10-ESAT6 and HspX 3?0.35mg?CpG?150μg |
7 weeks were dissected all Cavia porcelluss behind mycobacterium tuberculosis infection, each internal organs tuberculosis degree such as the liver of observation Cavia porcellus, spleen, lung, lymph node, and carry out pathological changes with double-blind method and mark; Spleen tubercule bacillus lotus bacterium amount: make serial dilution after the spleen homogenate, inoculate modified Russell medium, counting tubercule bacillus CFU calculates its logarithm value, takes statistics to learn and handles.The result is following:
Scoring of table 7 organ disease and spleen tubercule bacillus lotus bacterium amount (lgCFU)
| Group | The organ disease index (X ± SD) | Spleen tulase lotus bacterium amount lgCFU (X ± SD) |
| N.S | 50.8±16.9 | 5.45±0.76 |
| Ag | 62.2±20.2 | 5.61±0.51 |
| Ag+Al | 58.3±25.5 | 5.30±0.35 |
| Ag+Al+CpG1 | 59.4±15.3 | 5.68±0.44 |
| Ag+Al+CpG2 | 35.6±18.1 | 5.04±0.81 |
| Ag+Al+CpG3 | 42.2±19.2 | 4.47±1.82 |
| Ag+Al+CpG4 | 39.4±17.2 | 4.96±0.97 |
| Ag+Al+CpG5 | 42.8±18.9 | 4.88±0.61 |
Internal organs outward appearance: a large amount of, tangible TB focus is arranged on negative control group and Ag group Guinea pig lung and the spleen, also can see typical TB focus on the liver; Ag+Al and each internal organs tuberculosis of Ag+Al+CpG1 group Cavia porcellus are still serious; Ag+Al+CpG2, Ag+Al+CpG3, Ag+Al+CpG4 and each internal organs tuberculosis of Ag+Al+CpG5 group Cavia porcellus obtain inhibition in various degree; The propagation that tubercule bacillus is described receives effective inhibition, and particularly each internal organs TB focus of Ag+Al+CpG3 group Cavia porcellus obviously reduces.
Similar with the pathological changes appraisal result; The load of Ag group, Ag+Al, Ag+Al+CpG1 group and negative control group GPS coagulation of YIN-cold in ZANG-organ nuclear bacillus is all higher; But Ag+Al+CpG2, Ag+Al+CpG3, Ag+Al+CpG4 and Ag+Al+CpG5 group GPS coagulation of YIN-cold in ZANG-organ nuclear bacillus obtain inhibition in various degree; Further specify vaccine of the present invention and can effectively suppress tubercule bacillus in the intravital propagation of Cavia porcellus, particularly Ag+Al+CpG3 group GPS coagulation of YIN-cold in ZANG-organ nuclear bacillus load obviously reduces.
See that from experiment the BCG-CpG-DNA consumption is 25 μ g-200 μ g, Al (OH)
3Amount when being 0.05mg-0.7mg, both couplings can produce better immune effect.
Claims (16)
1. a tuberculosis subunit vaccine is characterized in that comprising Ag85b, ESAT6, CFP10 and HspX albumen, and further comprises Al (OH)
3And BCG-CpG-DNA, described BCG-CpG-DNA is the DNA extraction thing of BCG, it is the mixture of the BCG dna fragmentation of fragment varying length.
2. tuberculosis subunit vaccine as claimed in claim 1 is characterized in that Ag85b, ESAT6, CFP10 and HspX exist with albumen form independently, perhaps with any two or three or four kind of proteic fusion rotein form exist.
3. tuberculosis subunit vaccine as claimed in claim 2, the content that it is characterized in that Ag85b, ESAT6, CFP10, HspX are every kind of albumen 5 μ g-20 μ g in the UD vaccine.
4. tuberculosis subunit vaccine as claimed in claim 3, the content that it is characterized in that Ag85b, ESAT6, CFP10, HspX are every kind of albumen 5 μ g-10 μ g in the UD vaccine.
5. tuberculosis subunit vaccine as claimed in claim 4, the content that it is characterized in that Ag85b, ESAT6, CFP10, HspX are Ag85b 10 μ g, ESAT65 μ g, CFP105 μ g, HspX10 μ g in the UD vaccine.
6. tuberculosis subunit vaccine as claimed in claim 2, the weight ratio that it is characterized in that Ag85b, ESAT6, CFP10, HspX is 0.5-2: 0.5-2: 0.5-2: 0.5-2.
7. tuberculosis subunit vaccine as claimed in claim 6, the weight ratio that it is characterized in that Ag85b, ESAT6, CFP10, HspX is 1: 0.5: 0.5: 1.
8. tuberculosis subunit vaccine as claimed in claim 2 is characterized in that Ag85b, ESAT6, CFP10 and HspX exist with the form of Ag85b, fusion rotein CFP10-ESAT6 and HspX.
9. tuberculosis subunit vaccine as claimed in claim 8, the content that it is characterized in that Ag85b, CFP10-ESAT6, HspX are every kind of albumen 5-20 μ g in the UD vaccine.
10. tuberculosis subunit vaccine as claimed in claim 9, the content that it is characterized in that Ag85b, CFP10-ESAT6, HspX are every kind of protein 10 μ g in the UD vaccine.
11. tuberculosis subunit vaccine as claimed in claim 8, the weight ratio that it is characterized in that Ag85b, CFP10-ESAT6, HspX is 0.5-2: 0.5-2: 0.5-2.
12. tuberculosis subunit vaccine as claimed in claim 11, the weight ratio that it is characterized in that Ag85b, CFP10-ESAT6, HspX is 1: 1: 1.
13., it is characterized in that Al (OH) like each described tuberculosis subunit vaccine of claim 1-12
3With the content of BCG-CpG-DNA be Al in the UD vaccine (OH)
30.05mg-0.7mg, BCG-CpG-DNA25 μ g-200 μ g.
14. tuberculosis subunit vaccine as claimed in claim 13 is characterized in that Al (OH)
3With the content of BCG-CpG-DNA be Al in the UD vaccine (OH)
30.1mg-0.35mg, BCG-CpG-DNA75 μ g.
15., it is characterized in that Al (OH) like each described tuberculosis subunit vaccine of claim 1-12
3With the weight ratio of BCG-CpG-DNA be 28: 1-1: 4.
16., it is characterized in that Al (OH) like each described tuberculosis subunit vaccine of claim 15
3With the weight ratio of BCG-CpG-DNA be 14: 3-4: 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010107449XA CN101745104B (en) | 2010-02-09 | 2010-02-09 | Tuberculosis subunit vaccine containing compound adjuvant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010107449XA CN101745104B (en) | 2010-02-09 | 2010-02-09 | Tuberculosis subunit vaccine containing compound adjuvant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101745104A CN101745104A (en) | 2010-06-23 |
| CN101745104B true CN101745104B (en) | 2012-04-25 |
Family
ID=42473119
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010107449XA Active CN101745104B (en) | 2010-02-09 | 2010-02-09 | Tuberculosis subunit vaccine containing compound adjuvant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101745104B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103203018A (en) * | 2013-03-27 | 2013-07-17 | 兰州大学 | Compound adjuvant for tuberculosis subunit vaccine, tuberculosis subunit vaccine from same and preparation method and application thereof |
| CN103386128A (en) * | 2013-07-02 | 2013-11-13 | 中国食品药品检定研究院 | Tuberculosis subunit vaccine containing unite adjuvant |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604979A (en) * | 2011-06-02 | 2012-07-25 | 杭州贤至生物科技有限公司 | Nucleotide sequence, fusion protein coded by nucleotide sequence, Mycobacterium tuberculosis vaccine prepared based on nucleotide sequence and preparation method of Mycobacterium tuberculosis vaccine |
| CN104027802A (en) * | 2014-05-09 | 2014-09-10 | 中国食品药品检定研究院 | Reinforced tuberculosis subunit vaccine |
| CN105753989A (en) | 2014-12-15 | 2016-07-13 | 牛津疫苗医学生物科技（英国）有限公司 | Artificial multi-antigen fusion protein, and preparation method and application thereof |
| CN105903009A (en) * | 2016-04-05 | 2016-08-31 | 中国科学院过程工程研究所 | Subunit vaccine against Mycobacterium tuberculosis based on modification by arabinogalactan-polyinosinic acid polycytidylic acid and preparation method thereof |
| CN109078177B (en) * | 2018-08-09 | 2022-07-08 | 安徽智飞龙科马生物制药有限公司 | Vaccine for preventing tuberculosis, combined medicine, preparation method and application |
| CN109776662B (en) * | 2019-03-13 | 2022-05-17 | 中国动物卫生与流行病学中心 | Cocktail antigen for detecting bovine tuberculosis allergy |
| CN112569348B (en) * | 2019-09-29 | 2023-02-28 | 中国食品药品检定研究院 | Herpes zoster vaccine |
| CN114681602B (en) * | 2020-12-25 | 2023-12-01 | 中国食品药品检定研究院 | Bivalent human papillomavirus vaccine |
-
2010
- 2010-02-09 CN CN201010107449XA patent/CN101745104B/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103203018A (en) * | 2013-03-27 | 2013-07-17 | 兰州大学 | Compound adjuvant for tuberculosis subunit vaccine, tuberculosis subunit vaccine from same and preparation method and application thereof |
| CN103386128A (en) * | 2013-07-02 | 2013-11-13 | 中国食品药品检定研究院 | Tuberculosis subunit vaccine containing unite adjuvant |
| CN103386128B (en) * | 2013-07-02 | 2017-02-08 | 中国食品药品检定研究院 | Tuberculosis subunit vaccine containing unite adjuvant |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101745104A (en) | 2010-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101745104B (en) | Tuberculosis subunit vaccine containing compound adjuvant | |
| Duan et al. | Review of newly identified functions associated with the heat-labile toxin of enterotoxigenic Escherichia coli | |
| Zhang et al. | Current progress in developing subunit vaccines against enterotoxigenic Escherichia coli-associated diarrhea | |
| Plotkin et al. | The development of vaccines: how the past led to the future | |
| CN100999550B (en) | Tubercle branch bacillus fusion protein and application thereof | |
| Ellis | New technologies for making vaccines | |
| CN103386128B (en) | Tuberculosis subunit vaccine containing unite adjuvant | |
| Chen et al. | The development and preliminary evaluation of a new Mycobacterium tuberculosis vaccine comprising Ag85b, HspX and CFP-10: ESAT-6 fusion protein with CpG DNA and aluminum hydroxide adjuvants | |
| Dhanasooraj et al. | Vaccine delivery system for tuberculosis based on nano-sized hepatitis B virus core protein particles | |
| Rivera-Hernandez et al. | Self-adjuvanting modular virus-like particles for mucosal vaccination against group A streptococcus (GAS) | |
| CN101691405A (en) | Fusion antigen uses as vaccine | |
| Whitlock et al. | Protective response to subunit vaccination against intranasal Burkholderia mallei and B. pseudomallei challenge | |
| Suzue et al. | Heat shock proteins as immunological carriers and vaccines | |
| CN102268446B (en) | Tubercle bacillus Ag85ab mosaic gene vaccine and preparation method and application thereof | |
| Bakhshaei et al. | Investigation of the cellular immune response to recombinant fragments of filamentous hemagglutinin and pertactin of Bordetella pertussis in BALB/c mice | |
| Sharma et al. | Immune response characterization and vaccine potential of a recombinant chimera comprising B-cell epitope of Aeromonas hydrophila outer membrane protein C and LTB | |
| CN104098700A (en) | Mycobacterium tuberculosis fusion protein (EAMMH) and constructing, expressing and purifying method and application thereof | |
| Zhu et al. | Protective efficacy of a Mycoplasma pneumoniae P1C DNA vaccine fused with the B subunit of Escherichia coli heat-labile enterotoxin | |
| Partidos et al. | Heat-labile enterotoxin of Escherichia coli and its site-directed mutant LTK63 enhance the proliferative and cytotoxic T-cell responses to intranasally co-immunized synthetic peptides | |
| CN104248754B (en) | Streptococcus suis vaccine combination and its preparation method and application | |
| Acosta et al. | Vaccines against cholera, typhoid fever and shigellosis for developing countries | |
| CN102257000A (en) | Novel shigella frotein antigens and methods | |
| Zoeteweij et al. | GM1 binding-deficient exotoxin is a potent noninflammatory broad spectrum intradermal immunoadjuvant | |
| Sagi et al. | Studies on immunogenicity and protective efficacy of DnaJ of Salmonella Typhi against lethal infection by Salmonella Typhimurium in mice | |
| RU2724896C1 (en) | Polyantigenic vaccine for preventing and adjunctive treatment of tuberculosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 100050 Beijing Tiantan, Dongcheng District, West Lane, No. 2 Patentee after: National Institutes of Food and Drug Control Patentee after: ANHUI ZHIFEI LONGCOM BIOPHARMACEUTICAL CO., LTD. Address before: 100050 Beijing Tiantan, Dongcheng District, West Lane, No. 2 Patentee before: National Institutes of Food and Drug Control Patentee before: Longkema Pharmaceutical Co., Ltd., Anhui Prov. |