CN104558142A - Anti-pseudomonas aeruginosa polypeptide as well as preparation method and application thereof - Google Patents
Anti-pseudomonas aeruginosa polypeptide as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN104558142A CN104558142A CN201410823050.XA CN201410823050A CN104558142A CN 104558142 A CN104558142 A CN 104558142A CN 201410823050 A CN201410823050 A CN 201410823050A CN 104558142 A CN104558142 A CN 104558142A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- pet
- fusion rotein
- gfp
- damping fluid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4732—Casein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to the field of medicines, and discloses an anti-pseudomonas aeruginosa polypeptide as well as a preparation method and application thereof. The amino acid sequence of the anti-pseudomonas aeruginosa polypeptide is as shown in SEQ ID NO:1. The polypeptide is good in anti-pseudomonas aeruginosa action, and can be used for preparing an anti-pseudomonas aeruginosa drug.
Description
Technical field
The invention belongs to biomedicine and biological technical field, relate to a kind of anti Bacillus pyocyaneu Flugge polypeptide and its preparation method and application.
Background technology
The toxic side effect of conventional antibiotic and the appearance of Resistant strain thereof, force people to go to find novel anti-microbial agents.And the antibacterial peptide with the various biological function such as antimicrobial has broad application prospects, they are extensively present in multiple organism, that organism resists extraneous pathogen infection and a series of immunoreactive product produced, pathogenic micro-organism can be killed fast, there is unique Antibacterial Mechanism being different from conventional antibiotic, relatively not there is immunogenicity, and it is also few to its resistive bacterium, molecular weight is little, stable performance, there is stronger broad-spectrum antimicrobial ability, demonstrate wide application potential, therefore potential therapeutic antibacterial peptide is development of new, the important channel of desirable antibiotic medicine.Albumen a large amount of in breast milk is inhibited to pathogenic bacterium, virus and fungi.Some of them albumen can play a role separately, and other albumen then must be worked in coordination with and be played a role.It is a kind of redundancy seemingly that Multiple components acts on same pathogenic bacteria, and it is actual is a kind of multiple-protection system.The hydrolytic action of body endoproteinase creates a large amount of breast milk polypeptide, the physiological function that these breast milk polypeptide also play a role as nutrition except providing amino acid.Further research finds that a large amount of breast milk polypeptide shows multiple anti-microbial effect, for newborn infant provides immunoprotection.
Due to antibacterial peptide (antimicrobial peptides, AMPs) natural resource are limited, the chemosynthesis and the genetic engineering means that are expected to cheap acquisition become focus, chemical synthesising peptide class cost is high, and the approach that gene engineering method great expression antibacterial peptide makes it to become peptide class antibacterials of new generation is more real, and demonstrate good prospect.In antibacterial peptide transgene plant, animal and microorganism etc., all done a large amount of research work before mouthful, progress soon, achievement is many.Although antibacterial peptide function is remarkable, have a extensive future, natural antibacterial peptide output is very low, cannot extract in a large number, and chemical synthesising peptide is expensive in animal and plant body.Therefore, utilize genetic engineering technique to produce antibacterial peptide and just become inevitable choice.
Intein (intein) is the one section of sequence be present in precursor protein, be converted in the process of mature protein at precursor protein, self splicing effect is relied on to discharge from precursor protein, the extein (extein) at two ends links together by the time, this process and protein splicing process.In protein purification, the surface trimming of Intein can avoid adding of exogenous protease and later stage to the removing step of proteolytic enzyme.
ELP (class elastin) can carry out reversible transformation, in the aqueous solution at low ambient temperatures, ELP is disordered structure shape, evenly solvablely to be distributed in solution, but when temperature raise gradually reach certain transformation temperature time, they can slough Bound moisture gradually, the hydrophobic region of each ELP molecule contacts with each other, finally undergo phase transition gathering agglomerating, this phase transformation has typical reversibility, and can by adding salt to accelerate startup in solution.During using ELP as fusion tag and target protein amalgamation and expression, fusion rotein has this phase change characteristics equally.When the integral protein carrying ELP occurs to assemble, other foreign proteins are not assembled, and therefore can be separated with the foreign protein not occurring to assemble by aggregate fusion rotein high for density by high speed centrifugation, thus reach purifying object.
ELP-Intein system makes full use of the self aggregation of ELP and the Self cleavage feature of Intein and a kind of very unique protein purification system built." ELP-Intein-target protein " triplet of the solubility given expression to is assembled through phase transformation and carries out purifying, Intein is induced Self cleavage to occur to discharge target protein again, again through once phase-change process, the ELP label aggregate of subsidiary Intein is removed and obtains the target protein of purifying.ELP system is used to greatly reduce protein purification cost, for plant-scale application provides possibility.
We isolate in breast milk the polypeptide moiety being less than 10KDa by ultra-filtration technique, carry out identification and analysis further by tandem mass spectrum technology to its concrete composition.Found that these polypeptide mainly from the fragment that people's beta-casein (Homo sapiens beta casein, gene No. Bank: NM_001891) Fracture gets off, to be naturally present in breast milk.The report do not studied further these segments and function thereof in prior art, for this reason, we have screened some polypeptide and have carried out deep research.
Summary of the invention
The object of the invention is to provide a kind of anti Bacillus pyocyaneu Flugge polypeptide for above-mentioned technical problem.
Another object of the present invention is to provide the preparation method of above-mentioned anti Bacillus pyocyaneu Flugge polypeptide.
A further object of the invention is to provide the application of above-mentioned anti Bacillus pyocyaneu Flugge polypeptide.
The object of the invention is to be realized by following technical proposal:
A kind of anti Bacillus pyocyaneu Flugge polypeptide, its aminoacid sequence is as shown in SEQ ID NO:1.
Express the gene of above-mentioned anti Bacillus pyocyaneu Flugge polypeptide, its nucleotide sequence is as shown in SEQ ID NO:2.
The amplimer of described polypeptide, wherein the nucleotide sequence of upstream primer is as shown in SEQ ID NO:3, and the nucleotide sequence of downstream primer is as shown in SEQ ID NO:4.
The preparation method of described anti Bacillus pyocyaneu Flugge polypeptide, the method comprises the following steps:
A. the expression vector pET-EI-GFP of polypeptide described in claim 1 is built;
The abduction delivering of b.pET-EI-GFP fusion rotein;
The purifying of c.pET-EI-GFP fusion rotein;
The surface trimming of d.pET-EI-GFP fusion rotein;
E. the purifying of recombinant polypeptide, collection.
Described preparation method, the method comprises the following steps:
A. the expression vector pET-EI-GFP of polypeptide described in claim 1 is built:
This polypeptide-nucleic acid sequence of synthetic, utilize above-mentioned upstream and downstream primer (SEQ ID NO:3, SEQ ID NO:4) this polypeptide-nucleic acid fragment of being amplified containing BsrG I and Hind III digestion site by round pcr carries out glue recovery, is loaded into pET-EI-GFP carrier after reclaiming product double digestion;
The abduction delivering of b.pET-EI-GFP fusion rotein:
1) the correct expression vector that checks order proceeds to competent cell BLR (DE3), and the LB nutrient solution be inoculated in containing penbritin is cultivated;
2) collect thalline, add IPTG after resuspended and induce pET-EI-GFP expressing fusion protein;
The purifying of c.pET-EI-GFP fusion rotein:
After bacterium liquid precipitate PBS damping fluid after abduction delivering is resuspended, ultrasonication, centrifugal, get supernatant liquor heating and carry out phase transformation gathering, centrifugal, abandon supernatant liquor, the PBS damping fluid of precipitation precooling is resuspended, centrifugal, get supernatant liquor again to heat and carry out next round phase transformation gathering, centrifugal, abandon supernatant liquor, precipitation cutting damping fluid is resuspended;
D. the surface trimming of fusion rotein:
After cutting damping fluid mixes with albumen, start surface trimming process, the target protein of release recombinant polypeptide;
E. the purifying of recombinant polypeptide, collection:
Cutting process terminates, and again carries out phase transformation gathering, the ELP-Intein label under cutting and do not cut fusion rotein completely and will change precipitation into, and the target protein losing label then keeps solvable state to be present in supernatant; Abandon precipitation, carry out vacuum lyophilization by after supernatant liquor dialysed overnight.
Described preparation method, the 0.585g/L EDTA and 8.368g/L Bis-Tri that consists of wherein cutting damping fluid is dissolved in PBS damping fluid, adjust ph to 6.5, autoclaving, 4 DEG C of preservations.
Described anti Bacillus pyocyaneu Flugge polypeptide is preparing the application in anti Bacillus pyocyaneu Flugge medicine.
Beneficial effect of the present invention:
Polypeptide provided by the invention has the effect of good anti Bacillus pyocyaneu Flugge, can be used for the medicine preparing anti Bacillus pyocyaneu Flugge.
This polypeptide can be prepared by gene recombination technology, and preparation method is simple, and cost is low, is easy to commercial application.
The present invention has abandoned traditional affinity chromatography column purification, adopt ELP-Intein system purification process, fusion rotein and other foreign proteins are then separated by the distinctive reversible transformation characteristic of ELP by this system, and fusion rotein can cut away the label protein that carries voluntarily thus discharge target protein antibacterial peptide, and the antibacterial peptide obtained by this method shows anti-microbial activity equally.The method reduce in column purification process, the loss of albumen, greatly reduce purified polypeptide cost.
Accompanying drawing explanation
Fig. 1 is the purifying that 12%SDS-PAGE identifies fusion rotein.
M: albumen Marker; 1: bacterium lysate before induction; 2: lysate supernatant after induction; 3: soluble upper after first round phase transformation; 4: first round phase transformation rear fusion protein precipitates; Take turns phase transformation rear fusion protein precipitation at 5: the second.
Fig. 2 is purifying and the cutting process that 15%SDS-PAGE identifies fusion rotein.
M: albumen Marker; 1: bacterium lysate before induction; 2: lysate supernatant after induction; 3: two take turns phase transformation after the fusion rotein that obtains; Albumen after 4:28 DEG C of cutting 2h; Albumen after 5:28 DEG C of cutting 4h; Albumen after 6:28 DEG C of cutting 8h.
Fig. 3 is the recombinant polypeptide Tricine/SDS-PAGE electrophoresis after cutting after purifying.
1: albumen Marker; 2: the recombinant polypeptide after cutting.
Fig. 4 is the anti-microbial activity of chemosynthesis to Pseudomonas aeruginosa.
Fig. 5 is that chemosynthesis and the anti-microbial activity of recombinant polypeptide to Pseudomonas aeruginosa compare.
Fig. 6 is that recombinant polypeptide and the anti-microbial activity of cynnematin to Pseudomonas aeruginosa compare.
Embodiment
The invention will be further elaborated by the following examples.
Embodiment 1
1. this polypeptide has following sequence signature:
Aminoacid sequence:
LLLNQELLLNPTHQIYPVTQPLAP(SEQ ID NO：1)
Nucleotide sequence:
CTGCTCAACCAAGAACTTCTACTTAACCCCACCCACCAGATCTACCCTGTGACTCAGCCACTTGCCCCAGTT(SEQ ID NO：2)
There is iso-electric point (pI): 5.24, molecular weight (Mw): 2726.21.
2. after this polypeptide of chemosynthesis, find that this peptide has very strong anti Bacillus pyocyaneu Flugge activity (see Fig. 4).
3. the foundation of recombination and preparation
3.1 vector constructions:
This polypeptide-nucleic acid sequence of synthetic, utilizes primer below by round pcr:
This polypeptide-nucleic acid fragment amplified containing above-mentioned restriction enzyme site carries out glue recovery, reclaim product double digestion, enzyme cuts pET-EI-GFP carrier (Lifesensors, USA simultaneously, in this plasmid, itself is containing ELP and Intein gene), be then placed in 16 DEG C of thermostat water baths and spend the night connection.
3.2 connect product conversion enters to clone bacterium
(1) get the competent cell DH5 α that 100 μ l prepare and be connected product mixing with 10 μ l, after ice bath 30min, 42 DEG C of heat shock 90s, then ice bath 5min is on ice placed in immediately, add the LB liquid nutrient medium of 600 μ l through 37 DEG C of preheatings, 37 DEG C of shaking culture 1.5h, centrifugal concentrating to 100 μ about l coats (containing 50 μ g/ml Amp) on solid LB flat board, is inverted cultivation 12 ~ 16h for 37 DEG C;
(2) the random several mono-clonal of picking is in the test tube of the 3ml LB nutrient solution containing 50 μ g/ml Amp, and 37 DEG C of 220rpm shaking culture are muddy to bacterium liquid, draws bacterium liquid carry out bacterium colony PCR as template with liquid-transfering gun;
(3) object band person there is is to carry out plasmid extraction bacterium colony PCR primer agarose gel electrophoresis result, double digestion qualification is carried out with BsrG I and Hind III, result be positive by its bacterium liquid and 80% glycerine mix after (final glycerol concentration is 10%) preserves three parts in-20 DEG C, a copy of it send order-checking company to carry out order-checking and does finally to identify.
3.3 are transformed into expression bacterium
(1) the expression vector mixing that 100 μ l competent cells BLR (DE3) and 0.5 μ l check order correct is got, after ice bath 30min, 42 DEG C of heat shock 90s, then ice bath 5min is on ice placed in immediately, add the LB liquid nutrient medium of 600 μ l through 37 DEG C of preheatings, 37 DEG C of shaking culture 1.5h, centrifugal concentrating to 200 μ about l applying solid LB flat board (containing 50 μ g/mlAmp), is inverted cultivation 5 ~ 6h for 37 DEG C;
(2) next day random picking mono-clonal, for the sake of assurance, be bacterium colony PCR, get positive bacteria liquid and 80% glycerine mix after (final glycerol concentration is 10%)-20 DEG C preserve three parts.
The abduction delivering of 3.4 fusion roteins
(1) switching glycerine frozen bacterium 100 μ l (containing Amp (penbritin) 50 μ g/ml) in 10ml LB liquid nutrient medium, 37 DEG C, 220rpm shaking culture is spent the night;
(2) next day by this 10ml overnight culture with 2,000g, 4 DEG C of centrifugal 15min are to remove beta lactamase, after washing bacterium with the PBS damping fluid of 4 DEG C of precoolings is resuspended, recentrifuge once, then use the fresh TB substratum of 10ml resuspended, joined by this 10ml bacterium liquid (containing 100 μ g/ml Amp) in 1L TB substratum, 37 DEG C of 220rpm shaking culture are to OD
600to about 0.6 (about 3h);
(3) take out 1ml culture, the centrifugal 1min of 1,2000g room temperature, abandons supernatant, precipitate frozen in-20 DEG C as electroresis appraisal sample.In residue culture, add IPTG to final concentration is 0.5mM, 20 DEG C of 100rpm shaking culture 24h, the expression of induced fusion albumen;
(4) take out 1ml culture, the centrifugal 1min of 1,2000g room temperature, abandons supernatant, precipitates frozenly to do in-20 DEG C as electroresis appraisal sample.Residue culture is with 3,000g, and 4 DEG C of centrifugal 10min, abandon supernatant, precipitate frozen in-20 DEG C of refrigerators.
The purifying of 3.5 fusion roteins
(1) by thoroughly resuspended for the PBS damping fluid of the frozen bacterium block precipitation 15m1pH 8.5 in refrigerator;
(2) in ice bath, ultrasonic disruption is carried out to re-suspension liquid, be set to: power 400W, work 4s, interval 8s.During ultrasonication, whizzer is opened and is preheated to 35 DEG C;
(3) ultrasonication is complete, and broken liquid is with 16,000g, and 4 DEG C of centrifugal 20min, stay supernatant, abandon precipitation, and stays 40 μ l supernatants as electroresis appraisal sample;
(4) be sub-packed in by supernatant liquor in clean EP pipe, often pipe adds concentration be the NaCl solution of 3M is 1.5M to final concentration, spins upside down mixing gently, is placed in 30 DEG C of thermostat water baths and hatches 10min and make fusion rotein undergo phase transition reaction;
(5) hatch complete, immediately each pipe is put into preheated whizzer, 16,000g, 35 DEG C of centrifugal 10min;
(6) centrifugal end, take out rapidly EP pipe, it is abandoned by the supernatant liquor firmly thrown away in each pipe, because fusion rotein undergoes phase transition gathering, namely precipitates after centrifugal, and foreign protein does not undergo phase transition therefore to appoint and is retained in supernatant.Precipitation containing the fusion rotein PBS damping fluid of the pH 8.5 of 4 DEG C of precoolings gently resuspended (as far as possible reducing the generation of bubble) makes fusion rotein generation reversible transformation become solvable state again by precipitated form.Stay 10 μ l re-suspension liquid as electroresis appraisal sample.Resuspended period, open an other whizzer and be chilled to 4 DEG C in advance;
(7) resuspended complete, put by each EP pipe with the good whizzer of precooling with 16,000g, 4 DEG C of centrifugal 10min remove insoluble impurity residual in protein liquids;
(8) centrifugal end, collect supernatant in new clean EP pipe, repeating step 4-7 carries out another and takes turns phase transformation to improve the purity of fusion rotein, when repetition the 6th step, with the cutting damping fluid of pH 6.5, (0.585g/L EDTA and 8.368g/LBis-Tri is dissolved in PBS damping fluid, adjust ph to 6.5, autoclaving, 4 DEG C of preservations) replace PBS.The supernatant finally collected is got 10 μ l as electroresis appraisal sample.
The results are shown in Figure 1.
The surface trimming of 3.6 fusion roteins
Cutting is after damping fluid mixes with albumen, beginning surface trimming process (fusion rotein self can surface trimming, do not need people for adding proteolytic enzyme).
The results are shown in Figure 2.
The purifying of 3.7 antibacterial peptides
Cutting process terminates, and adds the NaCl solution that final concentration is 1.5M, 30 DEG C of water-bath 10min, induced phase transition in each EP pipe.ELP-Intein label under cutting and do not cut fusion rotein completely and will change precipitation into, the antibacterial peptide losing label then keeps solvable state to be present in supernatant.Abandoning precipitation, treating that subsequent experimental uses by carrying out vacuum lyophilization after supernatant dialysed overnight in order to latter-20 DEG C.
The results are shown in Figure 3.
The Activity determination of 4 recombinant antibacterial peptides
Agarose cavity diffusion method is adopted to measure recombinant antibacterial peptide to the bacteriostatic activity of Pseudomonas aeruginosa (Pseudomonas aeruginosa) with property.Inoculation Pseudomonas aeruginosa is in LB liquid medium, and 37 DEG C of 220rpm are cultured to logarithmic phase, and the inoculum size by 1% is inoculated into (55-60 DEG C) in the LB agarose media of thawing, are laid on aseptic disposable plate after mixing by 15ml/ ware.After solidifying, aseptically punch, add sample (being respectively chemical synthesising peptide, recombinant peptide, cynnematin) to be measured and empty plasmid bacterium liquid control sample is placed on 37 DEG C of incubator 8h, observe bacteriostatic activity.
The results are shown in Figure 5.Result shows, and the polypeptide of chemosynthesis and restructuring all has obvious inhibition zone, illustrates that the polypeptide of chemosynthesis and restructuring all has good antibacterial effect.
Our cynnematin compares, and found that the polypeptide of restructuring has good anti-microbial activity (Fig. 6).
Claims (7)
1. an anti Bacillus pyocyaneu Flugge polypeptide, its aminoacid sequence is as shown in SEQ ID NO:1.
2. express the gene of anti Bacillus pyocyaneu Flugge polypeptide described in claim 1, its nucleotide sequence is as shown in SEQ ID NO:2.
3. the amplimer of polypeptide described in claim 1, it is characterized in that the nucleotide sequence of upstream primer is as shown in SEQ ID NO:3, the nucleotide sequence of downstream primer is as shown in SEQ ID NO:4.
4. the preparation method of anti Bacillus pyocyaneu Flugge polypeptide described in claim 1, is characterized in that the method comprises the following steps:
A. the expression vector pET-EI-GFP of polypeptide described in claim 1 is built;
The abduction delivering of b.pET-EI-GFP fusion rotein;
The purifying of c.pET-EI-GFP fusion rotein;
The surface trimming of d.pET-EI-GFP fusion rotein;
E. the purifying of recombinant polypeptide, collection.
5. preparation method according to claim 4, is characterized in that the method comprises the following steps:
A. the expression vector pET-EI-GFP of polypeptide described in claim 1 is built:
This polypeptide-nucleic acid sequence of synthetic, this polypeptide-nucleic acid fragment utilizing the upstream and downstream primer described in claim 3 to be amplified containing BsrG I and Hind III digestion site by round pcr carries out glue recovery, is loaded into pET-EI-GFP carrier after reclaiming product double digestion;
The abduction delivering of b.pET-EI-GFP fusion rotein:
1) the correct expression vector that checks order proceeds to competent cell BLR (DE3), and the LB nutrient solution be inoculated in containing penbritin is cultivated;
2) collect thalline, add IPTG after resuspended and induce pET-EI-GFP expressing fusion protein;
The purifying of c.pET-EI-GFP fusion rotein:
After bacterium liquid precipitate PBS damping fluid after abduction delivering is resuspended, ultrasonication, centrifugal, get supernatant liquor heating and carry out phase transformation gathering, centrifugal, abandon supernatant liquor, the PBS damping fluid of precipitation precooling is resuspended, centrifugal, get supernatant liquor again to heat and carry out next round phase transformation gathering, centrifugal, abandon supernatant liquor, precipitation cutting damping fluid is resuspended;
D. the surface trimming of fusion rotein:
After cutting damping fluid mixes with albumen, start surface trimming process, the target protein of release recombinant polypeptide;
E. the purifying of recombinant polypeptide, collection:
Cutting process terminates, and again carries out phase transformation gathering, the ELP-Intein label under cutting and do not cut fusion rotein completely and will change precipitation into, and the target protein losing label then keeps solvable state to be present in supernatant; Abandon precipitation, carry out vacuum lyophilization by after supernatant liquor dialysed overnight.
6. preparation method according to claim 5, is characterized in that the 0.585g/L EDTA and 8.368g/L Bis-Tri that consists of cutting damping fluid is dissolved in PBS damping fluid, adjust ph to 6.5, autoclaving, 4 DEG C of preservations.
7. anti Bacillus pyocyaneu Flugge polypeptide according to claim 1 is preparing the application in anti Bacillus pyocyaneu Flugge medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410823050.XA CN104558142B (en) | 2014-12-25 | 2014-12-25 | A kind of anti Bacillus pyocyaneu Flugge polypeptide and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410823050.XA CN104558142B (en) | 2014-12-25 | 2014-12-25 | A kind of anti Bacillus pyocyaneu Flugge polypeptide and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104558142A true CN104558142A (en) | 2015-04-29 |
| CN104558142B CN104558142B (en) | 2017-11-17 |
Family
ID=53075296
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410823050.XA Expired - Fee Related CN104558142B (en) | 2014-12-25 | 2014-12-25 | A kind of anti Bacillus pyocyaneu Flugge polypeptide and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104558142B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373234A (en) * | 2011-08-17 | 2012-03-14 | 华东理工大学 | Method for purifying recombinant proteins with intein-mediated elastin like proteins |
-
2014
- 2014-12-25 CN CN201410823050.XA patent/CN104558142B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373234A (en) * | 2011-08-17 | 2012-03-14 | 华东理工大学 | Method for purifying recombinant proteins with intein-mediated elastin like proteins |
Non-Patent Citations (2)
| Title |
|---|
| JUN WAN 等: "Peptidome analysis of human skim milk in term and preterm milk", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| 石磊 等: "利用类弹性蛋白可逆相变和内含肽自切割功能高效制备TmSm抗肿瘤蛋白", 《中国生物工程杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104558142B (en) | 2017-11-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102482332B (en) | For obtaining the method and system of botulic neurotoxin | |
| CN102373234A (en) | Method for purifying recombinant proteins with intein-mediated elastin like proteins | |
| CN101698682B (en) | Double-functional fusion protein based on antibacterial peptide, preparation method and applicaitoin thereof | |
| CN103319586B (en) | Antimicrobial peptide MP1102 of anti-drug resistance staphylococcus aureus and preparation method and application thereof | |
| CN104387474B (en) | A kind of tumor vessel infraction agent polypeptide, gene, expression vector and its application | |
| CN102731658B (en) | Tat PTD-Endostatin recombination protein, preparation method and application thereof | |
| CN104558120B (en) | A kind of immunoloregulation polypeptide and its preparation method and application | |
| CN101864372A (en) | Preparation method of antibacterial peptide gene engineering strain | |
| CN107226846A (en) | Novel transparent matter acid binding peptide and Transdermal absorption and subcutaneous Targeting delivery preparation | |
| CN107034202A (en) | A kind of N glycosyl transferases AaNGT and its application | |
| CN104558142A (en) | Anti-pseudomonas aeruginosa polypeptide as well as preparation method and application thereof | |
| CN110468143A (en) | The preparation method and application of antibacterial peptide NZX | |
| CN102702335A (en) | Recombinant transcription activator like effector, transcription activator like effector nuclease, as well as coding gene and application thereof | |
| CN102180973B (en) | Target multifunctional anti-embolism fusion protein as well as preparation method and application thereof | |
| CN105713908A (en) | Recombinant bombyx mori gloverin and preparation method and application thereof | |
| CN102993309A (en) | Human auxin fusion protein TAT-hGH as well as preparation method and application thereof | |
| CN101948865B (en) | Dual-promoter inducible secretable shuttle plasmid and construction method thereof | |
| CN101648995B (en) | Human recombination Reg4 protein and coding gene thereof as well as preparation method thereof | |
| CN109942715A (en) | A kind of recombination fusion protein of targeting therapy on tumor and its preparation method and application | |
| CN103993030A (en) | Method of shearing fusion protein by escherichia coli intracellular protease | |
| CN103145852A (en) | Recombining human pleiotrophin fusion protein and method for preparing same | |
| CN103468769A (en) | Selenium-containing recombinant human albumin preparation method | |
| CN109608535A (en) | A kind of the chicken alpha interferon peptide chain and its recombinant expression engineered strain of optimization | |
| CN100579987C (en) | Liver target fusion protein with siRNA guiding effect | |
| CN103436552A (en) | Production method and application of human-derived annexin A2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171117 Termination date: 20211225 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |