CN103436552A - Production method and application of human-derived annexin A2 - Google Patents

Abstract

The invention relates to the field of genetic engineering, and particularly relates to a production and purification method and an application of human-derived annexin A2. The production method comprises the steps of obtaining and amplification of annexin A2 cDNA (complementary deoxyribonucleic acid), screening and expansion of a strain for expressing the annexin A2, and purification and storage of the annexin A2. The human-derived annexin A2 is applied to the medical fields in the form of biological agents in the end. The invention also relates to the application of the annexin A2 in the preparation of human annexin A2 protein biological agents. The optimal temperature, time and IPTG (isopropyl-beta-d-thiogalactoside) concentration for inducing the expression of the annexin A2 are also put forward in the production method. The optimal concentration of imidazole for purifying the annexin A2 is also put forward so as to achieve the purposes of large-scale purification and production and application in medical fields.

Description

Production method and the application thereof of a kind of people source annexin A2

Technical field

The present invention relates to the genetically engineered field, refer in particular to a kind of people source annexin A2(ANX2L4) production purification process and application thereof, specifically be illustrated as acquisition and the amplification of ANX2L4 (annexin A2) cDNA, express the screening enlarging of the bacterial classification of annexin A2, and purifying, the preservation of annexin A2 albumen, finally with the form of biotechnological formulation, serve medical field.

Background technology

Annexin A2, have another name called P36, ANX2, LIP2, LPC2, CAL1H, LPC2D, ANX2L4, PAP-IV.Its gene is positioned at 15q21-q22, and molecular weight of albumen is 36kD, expressed in abundance in human endothelial cells, Monocytes/Macrophages, medullary cell and some tumour cell.Research shows, annexin A2 albumen has Ca ²⁺dependency is in conjunction with the key property of phosphatide, cytoskeletal protein, thereby is classified in the A subfamily of annexins superfamily protein.Although found how the annexins family member is playing a role aspect the adjusting of Growth of Cells and signal transduction, and the concrete biological function of annexin A2 albumen is not clear.Experiment showed, the genesis significant correlation of annexin A2 and mankind's numerous disease, especially its mechanism of action in cardiovascular, neoplastic disease becomes current study hotspot.In our early-stage Study, we find that the annexin A2 of endothelial cell surface can be used as the co-receptor of Profibrinolysin and tissue plasminogen activator (t-PA), is bringing into play the effect of regulating plasmin activity.Annexin A2 on the endotheliocyte immobilized artificial membrane exists the Lys-PLG(PLG precursor) and the binding site of t-PA, LP(a) and homocysteine can be distinguished the combination of antagonism Lys-PLG and t-PA and annexin A2 competitively.On annexin A2 knock out mice, find, the plasmin level that endothelial cell surface t-PA relies on obviously descends, so that can not remove the rear formed arterial thrombus of damage fully.The annexin A2 of purifying can increase approximately 60 times of the activation efficiencies of Profibrinolysin.For the further effect of research annexin A2 albumen in other diseases, obtain the current top priority of becoming of this albumen.

Summary of the invention

In order to overcome the above problems, the invention provides the production method of a kind of people source annexin A2.

The production method of a kind of people source annexin A2, comprise the steps:

1) extract total RNA that test kit extracts Human Brain Microvascular Endothelial (HBMEC), the DEPC water dissolution of the RNA of extraction without RNAase with Trizol RNA; Cell total rna by extracting, carry out reverse transcription with downstream primer 5 '-CAGGACCTTATCTCGCGTCC-3 ', and the cDNA that reverse transcription obtains carries out pcr amplification;

2) nucleotide sequence is inserted in prokaryotic expression carrier pET-21b (+), build recombinant vectors, and recombinant vectors is transformed in host bacteria E.coli.BL21 (DE3), do Plasmid Transformation and process, and the extracting plasmid;

3) Plasmid Transformation is in host bacteria E.coli.DH5 α, containing the LB of AMP50 μ g/mL, cultivates based on after cultivating 3h under 37 ℃, and screening positive clone adds the IPTG that final concentration is 0.75-1.25mmol/L and induce 3-6h under 25-37 ℃, obtains annexin A2.

Further, in step 1), the cell total rna of extraction, carry out reverse transcription with downstream primer 5 '-CAGGACCTTATCTCGCGTCC-3 ', reverse transcription system: downstream primer 1 μ L, AMV ThermoScript II 0.5 μ L, 5 times of Buffer2 μ L, DNTP1 μ L, RNA enzyme inhibitors 0.5 μ L, RNA and hydration meter 5 μ L, reaction conditions: 42 ℃, 45min; 92 ℃, 5min; Ice-water bath 5min; The cDNA that reverse transcription obtains carries out pcr amplification, amplification reaction system: 2 times of Taq plus10 μ L, template cDNA5 μ L, upstream primer 1 μ L, downstream primer 1 μ L, water 3 μ L, reaction conditions: 94 ℃ of denaturation 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃ of 10min, pcr amplification primer: 5 '-AATGGGTCGGGATCCGTCTA G-3 ', 5 '-CAGGACCTTATCTCGCGTCC-3 '.

Further, in step 3), the final concentration of IPTG is 1mmol/L.

Further, in step 3), add IPTG and induce under 37 ℃.

Further, in step 3), IPTG induces 6h.

Further, in step 3), the IPTG that the interpolation final concentration is 1mmol/L induces 6h under 37 ℃, obtains people source annexin A2.

Further, also comprising purification step 4) working concentration is 100-1000mmol/l the imidazoles gradient elution carries out purifying, with the nickel affinity column, purifies and obtain people source annexin A2 albumen.

Further, described imidazole concentration is 800mmol/l.

The present invention has also described the application of ANX2L4 in preparation people annexin A2 protein biology preparation.

Below the present invention is further illustrated:

The production method of ANX2L4 comprises following concrete steps:

1.Annexin the structure of A2 expression vector

1.1 the extraction of cell total rna

Get Human Brain Microvascular Endothelial (HBMEC) cell, extract test kit with Trizol RNA and extract cell total rna, working method is extracted the test kit specification sheets with reference to Trizol RNA.The DEPC water dissolution of RNA without RNAase of extracting.

1.2RT-PCR amplification annexin A2 gene cDNA

Get the cell total rna of extraction, with downstream primer (5 '-CAGGACCTTATCTCGCGTCC-3 '), carry out reverse transcription.Reverse transcription system: downstream primer 1 μ L, AMV ThermoScript II 0.5 μ L, 5 times of Buffer2 μ L, DNTP1 μ L, RNA enzyme inhibitors 0.5 μ L, RNA and hydration meter 5 μ L.Reaction conditions: 42 ℃, 45min; 92 ℃, 5min; Ice-water bath 5min.The cDNA that reverse transcription obtains carries out pcr amplification.Amplification reaction system: 2 times of Taq plus10 μ L, template cDNA5 μ L, upstream primer 1 μ L, downstream primer 1 μ L, water 3 μ L.Reaction conditions: 94 ℃ of denaturation 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃ of 10min.Pcr amplification primer: 5 '-AATGGGTCGGGATCCGTCTA G-3 ', 5 '-CAGGACCTTATCTCGCGTCC-3 '.

1.3Annexin the clone of A2 gene and evaluation

The RT-PCR amplified production is connected with the pGEM-T carrier, and the connection product is pGM-T-ANXA2.And Transformed E .coli.BL21 (DE3) competent cell.After microbial culture, extract plasmid DNA and carry out the double digestion evaluation with Bam HI and XhoI, and will identify that correct plasmid carries out sequencing analysis.

1.4 the structure of fusion expression vector and DNA sequence analysis thereof

Expression vector title: Pet21b, structure as shown in Figure 1.

Restriction enzyme site is BamHI, and XhoI, have amicillin resistance, and N-terminal merges the His label.

The plasmid DNA sequencing result shows, the sequence of the upper anneixn A2 of gene order and GeneBank meets fully, and frameshit does not occur reading frame, and fusion expression vector successfully constructs.Size is about 37kDa.(shown in Fig. 2)

Sequencing:

GGAGGGGTAAATTTTCCCCTCTAAGAATAATTTTGTTTAACTTTAAGAAGGAGATAT?ACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGG GATCCGTCTACTGTTCAC?GAAATCCTGTGCAAGCTCAGCTTGGAGGGTGATCACTCTACACCCCCAAGTGCATATGG?GTCTGTCAAAGCCTATACTAACTTTGATGCTGAGCGGGATGCTTTGAACATTGAAACAG?CCATCAAGACCAAAGGTGTGGATGAGGTCACCATTGTCAACATTTTGACCAACCGCAG?CAATGCACAGAGACAGGATATTGCCTTCGCCTACCAGAGAAGGACCAAAAAGGAACTT?GCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATT?GAAGACACCTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCATGAAGGGGCTGGGA?ACCGACGAGGACTCTCTCATTGAGATCATCTGCTCCAGAACCAACCAGGAGCTGCAGG?AAATTAACAGAGTCTACAAGGAAATGTACAAGACTGATCTGGAGAAGGACATTATTTC?GGACACATCTGGTGACTTCCGCAAGCTGATGGTTGCCCTGGCAAAGGGTAGAAGAGCA?GAGGATGGCTCTGTCATTGATTATGAACTGATTGACCAAGATGCTCGGGATCTCTATGAC?GCTGGAGTGAAGAGGAAAGGAACTGATGTTCCCAAGTGGATCAGCATCATGACCGAG?CGGAGCGTGCCCCACCTCCAGAAAGTATTTGATAGGTACAAGAGTTACAGCCCTTATGA?CATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAAC?CTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATG?AAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAA?GTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTA?TTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGT?GGAGATGAC CTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCC?CGAAAAGGAAAAAAAAAAG

2.Annexin the expression of A2 recombinant protein in intestinal bacteria

2.1 the conversion of plasmid

(1) 100 μ l competence bacterium E.coli DE3 are placed on ice and melt, add 10 μ l plasmids, gentleness mixes, and places 30min on ice.

(2), by centrifuge tube heat-shocked 90s in 42 ℃ of water-baths, then fast transfer is on ice, cooling 3min.

(3) add 900 μ l LB substratum in centrifuge tube, cultivate 45min with the concussion of 200rpm speed in 37 ℃, make bacteria resuscitation.

(4) mix the centrifuge tube content, drawing 100 μ l bacterium liquid evenly coats on LB/ penbritin solid medium, place 10min under room temperature, after bacterium liquid is completely absorbed, flat-plate inverted is placed in to 37 ℃ of constant incubator incubated overnight 12～16h to single bacterium colony formation.

2.2 the extraction of plasmid

With UNIQ-10Column Plasmid Mini-Preps Kit, UNlQ-10 pillar plasmid is extraction agent box (giving birth to the biological (Shanghai) Co., Ltd. of work) extracting plasmid in a small amount, and extraction steps is with reference to this test kit specification sheets.

2.3Annexin the expression of A2 recombinant protein

Select the mono-clonal bacterium colony on LB/ penbritin solid medium, be seeded in aseptic LB/ penbritin liquid nutrient medium, this substratum is placed in to 37 ℃ of concussion instrument, with 250rpm speed concussion overnight incubation.Next day, the ratio by bacterium liquid with 1:50 is inoculated in LB/ penbritin liquid nutrient medium, is placed in 37 ℃ of concussion instrument, with 200rpm speed, shakes to OD ₆₀₀value is 0.3～0.4, cultivates 3h.Add IPTG to induce, after bacterial expression, centrifugal 5min under 4 ℃, 12000rpm condition, abandoning supernatant ,-80 ℃ of preservations.

2.4 the optimization of expression condition

2.4.1 inducing temperature and the time impact on expression of recombinant proteins

After adding the IPTG of same concentrations, investigate and to be respectively at inducing temperature and time: the abduction delivering of annexin A2 recombinant protein under 37 ℃ (3h), 30 ℃ (3h), 28 ℃ (3h), 25 ℃ (3h), 37 ℃ (4h), 30 ℃ (4h), 28 ℃ (4h), 25 ℃ (4h), 37 ℃ (5h), 30 ℃ (5h), 28 ℃ (5h), 25 ℃ (5h), 37 ℃ (6h), 30 ℃ (6h), 28 ℃ (6h), 25 ℃ of conditions such as (6h).

By the centrifugal rear collection thalline of bacterium liquid, be stored in-80 ℃.

By bugbuster(novagen company) after the cracking bacterium, 12000rpm, 4 ℃ of centrifugal 10min, collect supernatant.Carry out after treatment the 12%SDS-PAGE analysis, result is presented at 37 ℃, during 6h the expression of annexin A2 recombinant protein the highest, account for total protein 40% left and right.(Fig. 3, Fig. 4)

2.4.2IPTG the impact of concentration on expression of recombinant proteins

Be 37 ℃, induction time while being 6h at inducing temperature, add successively IPTG:0.75mmol/l, 1mmol/l, 1.25mmol/l, observe the abduction delivering of annexin A2 recombinant protein.Get the centrifugal rear collection thalline of bacterium liquid, by bugbuster(novagen company) after the cracking bacterium, 12000rpm, 4 ℃ of centrifugal 10min, collect supernatant.Carry out after treatment the 12%SDS-PAGE analysis, when result is presented at IPTG concentration and is 1mmol/l, annexin A2 expression of recombinant proteins is the highest.(Fig. 5)

3.Annexin the purifying of A2

1) because annxin A2 recombinant protein merges, the His label is arranged, therefore the suitable nickel affinity column purifying of selecting.Because imidazole concentration is the important factor that affects the recombinant protein rate of recovery and purity, thus chosen imidazole concentration (100,300,500,800,1000mmol/l) on the impact of purifying.

2) fill the affine resin of nickel in aseptic resin column, standing, make its free subsidence, form the post bed.

3) Xiang Zhuzhong adds the level pad of 10 times of column volumes, standing, and it is flowed down naturally with 16～18s/d flow velocity.

4) when balance liquid floods the post bed, add protein sample according to the resin maximum binding capacity, standing 30min, make itself and the abundant combination of resin.Collect flowing liquid with 22～25s/d flow velocity afterwards.

5) when protein sample floods the post bed, 10 times of volume lavation buffer solutions are added, it is flowed down naturally, with the washing foreign protein, with 22～25s/d flow velocity, collect flowing liquid.

6) when washing damping fluid and flood the post bed, the elution buffer of 10 times of volumes is added to (containing the different concns imidazoles), with the wash-out target recombinant protein, with 22～25s/d flow velocity, collect flowing liquid.

7) the SDS-PAGE analysis will be carried out after collected sample preparation.

8) result shows, when imidazole concentration is 800mmol/l, purity of protein and concentration are the highest.(Fig. 6)

4. the renaturation of recombinant protein, freeze-drying and quantitative

The urea soln that albumen after purifying reduces by gradient is slowly dialysed, and finally uses 0.01 * PBS dialysis, and the protein soln after dialysis is through being lyophilized into powdery.The bovine serum albumin (BSA) of take is standard, adopts the content of BIO-RAD company quantification of protein reagent (protein assay) colorimetric estimation protein.

Carry out western bolt evaluation (Fig. 7) by annexin A2 antibody

The present invention proposes optimum temps, time and the IPTG concentration of inducing ANX2L4 to express.Also comprise the best imidazole concentration that proposes the purifying ANX2L4, to reach the purpose of large scale purification production for medical field.

The accompanying drawing explanation

Fig. 1: the structure of Pet21b carrier.

Fig. 2: target recombinant protein after order-checking is identified in GeneBank with people source annexin A2 overlap ratio, visible plasmid DNA sequencing result shows, the sequence of the upper anneixn A2 of gene order and GeneBank meets fully, and frameshit does not occur reading frame, and fusion expression vector successfully constructs.Size is about 37kDa.

Fig. 3: under differing temps (25 ℃, 28 ℃, 30 ℃, 37 ℃) under, IPTG is 1mmol/l, the expression of the target recombinant protein of inducing in 4 hours.Visible in the time of 37 ℃, the expression amount of target recombinant protein is the highest.

Fig. 4: under different induction times (3h, 4h, 5h, 6h), IPTG is 1mmol/l, the expression of 37 ℃ of target recombinant protein of inducing.Visible when 6h, the expression amount of target recombinant protein is the highest.

Fig. 5: the expression of the target recombinant protein that (0.75mmol/l, 1mmol/l, 1.25mmol/l) induces under different inductor IPTG concentration.Visible when IPTG concentration is 1mmol/l, the expression amount of target recombinant protein is the highest.

Fig. 6: the purity of target recombinant protein under different imidazole concentration wash-outs.Visible when imidazole concentration is 800mmol/l, purity and the concentration of target recombinant protein are the highest.

Fig. 7: by annexin A2 antibody, carry out western bolt evaluation.The visual target recombinant protein is anneixn A2.

Specific implementation method

Further set forth the present invention below in conjunction with specific embodiment, should be understood that following examples only are not used in and limit the scope of the invention for the present invention is described.

In the following example, method therefor if no special instructions, is ordinary method.Needed material or reagent in following examples, be if no special instructions market and buy.The approach that obtains of the various biomaterials that are described in embodiment be only the approach that obtains of a kind of experiment to reach concrete disclosed purpose, should not become the restriction to biological material source of the present invention.

Described percentage concentration is mass/volume (W/V) percentage concentration or volume/volume (V/V) percentage concentration unless otherwise noted.

Embodiment 1: the solvable people Annexin A2 albumen of preparation restructuring

(1) clone of Annexin A2 gene, the structure of expression vector and evaluation

Design pair of primers according to the gene order of people annexin A2 in GenBank in the both sides in its open reading frame sequence district, and introduce the BamHI restriction enzyme site at 5 ' end, 3 ' end is introduced the XhoI restriction enzyme site.

Upstream primer is: 5 '-AATGGGTCGGGATCCGTCTA G-3 '

Downstream primer is:, 5 '-CAGGACCTTATCTCGCGTCC-3 '.

Human Brain Microvascular Endothelial (HBMEC) is bought the Cell Systems company in the U.S., adds Endothelial Cell Growth Medium-2(Lonza in EBM-2 substratum (Lonza, Baltimore, MD), Baltimore, MD) cultivated.The HBMEC that gets cultivation extracts total RNA, through RT-PCR amplification people annexin A2 gene.Use restriction enzyme BamHI and XhoI(Thermo company) PCR product and plasmid vector PET21b (+) are carried out to enzyme cut, with the T4 ligase enzyme, enzyme being cut to product is connected with carrier, transform DE3 intestinal bacteria competence bacterium, choose positive bacterium colony PCR and carry out preliminary evaluation.(2) optimize the abduction delivering condition of annexin A2 albumen in intestinal bacteria

Confirm base and the correct positive plasmid of open reading frame through DNA sequencing, transform and express Host Strains E.coli DH5 α.Optimize annexin A2 protein expression condition: mono-clonal bacterium colony, IPTG induced concentration (Sigma company), IPTG induction time and the IPTG inducing temperature of choosing high expression level annexin A2 albumen are optimized.Select 10 mono-clonal colony inoculations in the LB substratum of 7ml, 37 ℃ of standing over night.Get next day bacterium liquid 100 μ l join new 7ml containing AMP+(50 μ g/mL) the LB substratum in after at 37 ℃, on the shaking table of 200rpm, shake about 3 hours, surveying bacterium OD value is 0.6～0.8 o'clock, and staying 1ml as the contrast before inducing, remaining bacterium liquid adds final concentration 0.l～4mmol/l IPTG again to shake 1～5h on 18～37 ℃ of shaking tables.4 ℃, the centrifugal l0min of 8000rpm collects thalline, with PBS, cleans after thalline one time centrifugal again.Carry out ultrasonic degradation after PBS suspension thalline with l ml in ice bath, ultrasonic l5s l5s at intermittence totally 5 times, visible bacterium liquid becomes limpid.By cracked bacterium at 4 ℃, the centrifugal 30min of 13000rpm, by induce front and induce after precipitation and supernatant carry out respectively Xylene Brilliant Cyanine G after the 12%SDS-PAGE electrophoresis (giving birth to the work biology) staining analysis target protein expression.Parameters optimization is: 37 ℃ of culture temperature, incubation time 3h; 37 ℃ of inducing temperatures, induction time 6h; Inductor IPTG final concentration is 1mmol/L.

(3) a large amount of preparations of fusion rotein

According to the optimal conditions enlarged culturing of cultivating in a small amount.-20 ℃ of frozen restructuring LYRM2-E.coli DH5 α engineering bacterias are utilized to ferment tank, after having fermented, the centrifugal collection thalline of 8000rpm10min, and with the PBS of 0.01mol/L by the thalline washed twice, add appropriate PBS ultrasonic degradation, centrifugal collection supernatant.0.45 μ m filter filters fermentation cellular lysate supernatant, Ni-SeproaseFF affinity column (Novagen company) upper prop carries out wash-out with containing 800mmol/l imidazoles elutriant after containing 100mmol/l imidazoles (giving birth to the work biology) damping fluid, washing pillar. and after wash-out, the SDS-PAGE electrophoresis is identified recombinant protein.By semi-permeable membranes dialysis recombinant protein stoste, the PEG of molecular weight 20,000 concentrates recombinant protein.With BCA determination of protein concentration kit measurement protein concentration (Thermo company).

(4) Western Blot identifies recombinant protein antigen

Detected by annexin A2 antibody (Abcam company), band occurred at the 38kDa place as seen, conformed to expection.

Claims (10)

1. the production method of a people source annexin A2, is characterized in that: comprise the steps:

1) extract total RNA that test kit extracts Human Brain Microvascular Endothelial (HBMEC), the DEPC water dissolution of total RNA of extraction without RNAase with Trizol RNA; Cell total rna by extracting, carry out reverse transcription with downstream primer 5 '-CAGGACCTTATCTCGCGTCC-3 ', and the cDNA that reverse transcription obtains carries out pcr amplification;

2) nucleotide sequence is inserted in prokaryotic expression carrier pET-21b (+), build recombinant vectors, and recombinant vectors is transformed in host bacteria E.coli.BL21 (DE3), do Plasmid Transformation and process, and the extracting plasmid;

3) Plasmid Transformation is in host bacteria E.coli.DH5 α, containing the LB of AMP50 μ g/mL, cultivates based on after cultivating 3h under 37 ℃, and screening positive clone adds the IPTG that final concentration is 0.75-1.25mmol/L and induce 3-6h under 25-37 ℃, obtains annexin A2.

2. the production method of people according to claim 1 source annexin A2, it is characterized in that: in step 1), the cell total rna of extraction, carry out reverse transcription with downstream primer 5 '-CAGGACCTTATCTCGCGTCC-3 ', reverse transcription system: downstream primer 1 μ L, AMV ThermoScript II 0.5 μ L, 5 times of Buffer2 μ L, DNTP1 μ L, RNA enzyme inhibitors 0.5 μ L, RNA and hydration meter 5 μ L, reaction conditions: 42 ℃, 45min; 92 ℃, 5min; Ice-water bath 5min; The cDNA that reverse transcription obtains carries out pcr amplification, amplification reaction system: 2 times of Taq plus10 μ L, template cDNA5 μ L, upstream primer 1 μ L, downstream primer 1 μ L, water 3 μ L, reaction conditions: 94 ℃ of denaturation 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃ of 10min, pcr amplification primer: 5 '-AATGGGTCGGGATCCGTCTA G-3 ', 5 '-CAGGACCTTATCTCGCGTCC-3 '.

3. the production method of people according to claim 1 source annexin A2, it is characterized in that: in step 3), the final concentration of IPTG is 1mmol/L.

4. the production method of people according to claim 1 source annexin A2 albumen, is characterized in that: in step 3), add IPTG and induce under 37 ℃.

5. according to the production method of the described arbitrary people of claim 1-3 source annexin A2 albumen, it is characterized in that: in step 3), IPTG induces 6h.

6. the production method of people according to claim 1 source annexin A2 albumen is characterized in that: in step 3), the IPTG that to add final concentration be 1mmol/L induces 6h under 37 ℃, obtains people source annexin A2.

7. according to the production method of the described people of claim 1 or 6 source annexin A2, it is characterized in that: also comprise purification step 4) working concentration is 100-1000mmol/l the imidazoles gradient elution carries out purifying, with the nickel affinity column, purifies and obtain people source annexin A2 albumen.

8. the production method of people according to claim 7 source annexin A2 albumen, it is characterized in that: described imidazole concentration is 800mmol/l.

9. the application of people as described as claim 1 or 6 source annexin A2 albumen in preparation people annexin A2 protein biology preparation.

10. the application of annexin A2 albumen in people as claimed in claim 8 source in preparation people annexin A2 protein biology preparation.

Images