CN113186109A

CN113186109A - Saccharomyces cerevisiae expression long-acting recombinant fibronectin and application thereof in cosmetics

Info

Publication number: CN113186109A
Application number: CN202110357340.XA
Authority: CN
Inventors: 赵俊; 刘洁; 夏兵兵; 丁爽; 周炜; 凡玉芳; 李媛媛
Original assignee: Wuhu Yingtefeier Biological Products Industry Research Institute Co ltd
Current assignee: Wuhu Yingtefeier Biological Products Industry Research Institute Co ltd
Priority date: 2021-04-01
Filing date: 2021-04-01
Publication date: 2021-07-30

Abstract

The invention discloses a saccharomyces cerevisiae expression long-acting recombinant fibronectin and application thereof in cosmetics, wherein the nucleotide sequence of the long-acting recombinant fibronectin is shown as Seq ID No.1, and the long-acting recombinant fibronectin comprises a functional fragment of FN and HAS; functional fragments of FN include FNIII1C units; the FNIII1C unit is a functional fragment at the C end of the 1 st type III FN repeating unit in the FN. FNIII1C is a functional fragment of 1 st type III FN repeat unit C terminal in natural human FN, and has antitumor, anti-metastatic and angiogenesis inhibiting effects. The protein can also ensure that FN in organisms is hyperpolymerized, and greatly enhances the cell adhesion promoting and cell migration resisting capabilities of FN. The fusion HAS effectively improves the stability of the recombinant protein. The long-acting recombinant fibronectin can improve the anchorage rate and the confluence rate of cells, shorten the cell confluence time, ensure that the morphological structure of the cells is good, enhance the metabolic rate and obviously improve the protein synthesis speed, and has the effect of promoting cell repair.

Description

Saccharomyces cerevisiae expression long-acting recombinant fibronectin and application thereof in cosmetics

Technical Field

The invention relates to the field of emerging biomedicine, in particular to saccharomyces cerevisiae expression long-acting recombinant fibronectin, a detection method for promoting bovine kidney cell adherence activity detection of the long-acting recombinant fibronectin, and application of the saccharomyces cerevisiae expression long-acting recombinant fibronectin in cosmetics.

Background

Fibronectin (FN) is a high molecular weight glycoprotein, one of the most important components of extracellular matrix, and is widely present in blood, body fluids, and various tissues. In vertebrates, FN is highly conserved and has the same tissue structure. FN exists in a dimeric form, and consists of two polypeptide chains with a molecular weight of about 250kDa, which are bonded via C-terminal disulfide bonds. Each chain comprises a series of repeating units: 12 type I, 2 type II and 7 type III repeat units. These repeat units constitute domains that bind to fibrin, collagen, gelatin, bacteria and cells to perform a variety of biological functions, such as opsonization, phagocytosis, angiogenesis, embryogenesis, tissue structure and remodeling, and also play an important role in many pathological processes, such as polyarthritis and tumors. FN has been used in emerging biomedical fields such as tumor, wound healing, bacteriostasis, tissue engineering materials, etc., and is also beginning to be applied in the fields of beauty and skin care.

Human serum albumin (HAS) is a main protein in Human blood, consists of 585 amino acids, is the most abundant soluble protein in Human circulatory system, and HAS a concentration of 34-54g/L in blood. HSA is synthesized by the liver, and the serum half-life period is long and can reach 19 days. HSA plays an important role in regulating blood osmotic pressure, nourishing, promoting wound healing and the like, and is widely used for clinical treatment of ascites due to cirrhosis, burns, shock and the like. In addition, HSA has the characteristics of no immunogenicity, good human compatibility, wide tissue distribution, no enzyme activity and the like, so that HSA becomes an ideal recombinant protein fusion vector. The molecular weight of the recombinant protein can be increased by constructing a fusion protein technology, so that the half-life period is prolonged, and the stability of the recombinant protein is effectively improved.

Currently FN is obtained mainly by two routes: firstly, extracting from tissue cells or body fluid of organisms; secondly, an expression vector is constructed by using a genetic engineering technology, and the recombinant FN is expressed by using a host. Because natural FN has large molecular weight and low feasibility of full-sequence expression, different functional domains of FN are mainly selected for expression or combined expression so as to obtain recombinant FN with different functions. The FN natural purification process is complex and high in cost, and the product has large molecular weight, so that the popularization and the application of the FN natural purification process are limited. The expression of foreign genes by gene engineering technology has become one of the efficient ways to obtain target proteins, and is mainly divided into prokaryotic expression and eukaryotic expression according to the difference of expression vectors and host bacteria. Although the prokaryotic expression system has low cost, the system has the defects of easy formation of inclusion bodies, low biological activity of the obtained protein and the like, and the target protein with high activity can be obtained by utilizing the eukaryotic expression system to carry out exogenous expression.

Saccharomyces cerevisiae is a well-recognized safe microorganism in the medical and food industries, and biochemical and genetic studies thereof have been well-defined. The saccharomyces cerevisiae secretion expression system is a eukaryotic expression system, can express protein at a high level and secrete the protein into a culture medium, and has the advantages of simple production process, low cost, uniform product and no immunogenicity.

Disclosure of Invention

In order to overcome the defects of complex process and high cost of natural FN purification; the natural FN has large molecular weight and low feasibility of full-sequence expression, so that the popularization and the application of the FN are limited; the invention provides a saccharomyces cerevisiae expression long-acting recombinant fibronectin, a detection method for detecting the bovine kidney cell adherence promoting activity of the long-acting recombinant fibronectin, and application of the saccharomyces cerevisiae expression long-acting recombinant fibronectin in cosmetics.

The invention is realized by adopting the following technical scheme: a saccharomyces cerevisiae expresses long-acting recombinant fibronectin comprising: the nucleotide sequence of the long-acting recombinant fibronectin is shown in Seq ID No.1, and the long-acting recombinant fibronectin comprises a functional fragment of FN, HAS; functional fragments of FN include FNIII1C units; the FNIII1C unit is a functional fragment at the C end of the 1 st type III FN repeating unit in the FN.

As an improvement of the above technical scheme, the method for obtaining the long-acting recombinant fibronectin comprises the following steps:

step one, designing a sequence of a target gene: the gene of interest is the FNIII1C-HAS gene, and the FNIII1C-HAS gene comprises: not I enzyme cutting site, Xba I enzyme cutting site, initiation codon, termination codon, tag sequence and base sequence corresponding to Linker connecting FNIII1C unit and HSA sequence;

step two, constructing a recombinant vector: firstly, designing an amplification primer according to the sequence of a target gene, secondly, amplifying the target gene by PCR, and then constructing a recombinant vector;

step three, construction of engineering bacteria: uniformly mixing the recombinant vector and the saccharomyces cerevisiae INVScl competent cells according to the proportion of 10 mu l to 80 mu l, and then transferring the mixture into a precooled electric shock cup; performing ice bath for 5min, and wiping the outer wall of the electric shock cup;

adjusting the Bio-Rad electric converter to the fungus grade, and placing an electric shock cup on the Bio-Rad electric converter for electric shock; quickly adding 500 mu l of precooled 1M sorbitol solution into the electric shock cup, uniformly mixing, and coating an SC-U solid plate;

carrying out inversion culture at constant temperature of 30 ℃ until monoclonals grow out; selecting transformants, inoculating the transformants into an SC-U liquid culture medium, and culturing at the constant temperature of 30 ℃ and 200 rpm;

carrying out PCR reaction by taking the bacterial liquid as a template, and identifying and screening positive clones; selecting a transformant which is identified without errors to obtain engineering bacteria INVSC1/pYES2/CT-MF alpha-rFNIII 1C-HAS;

step four, induced expression of engineering bacteria: and selecting a single colony of the engineering bacteria, inoculating the single colony to an SC-U selective culture medium, and performing shake culture at 30 ℃ and 220rpm overnight. Measuring the OD thereof_600nmLight absorption value, calculating corresponding volume of bacterial liquid, transferring into SC-U induction culture medium to make initial OD_600nmReaching 0.4, and the induction time is 20 h;

step five, purifying the long-acting recombinant fibronectin: centrifugally collecting culture solution supernatant, and filtering with a filter membrane for sample loading;

self-loading a nickel ion chelating affinity chromatography filler to obtain a nickel ion chelating affinity chromatography column, washing the nickel ion chelating affinity chromatography column with purified water, and balancing the pH value of the nickel ion chelating affinity chromatography column with a PBS (phosphate buffer solution);

detecting conductivity value and 280nm wavelength absorption value on line, starting to sample after both are stable, and setting the flow rate of the sample pumped through the chromatographic column to be 5-6 ml/min; further passing through a column with PBS buffer, and washing away the foreign proteins not bound to the column until OD_280nmStabilizing;

and then passing the solution through a chromatographic column by using PBS buffer solution containing imidazole, eluting and collecting protein corresponding to an elution peak to obtain the long-acting recombinant fibronectin stock solution.

As an improvement of the technical proposal of the previous step, the amplification primer comprises a forward primer and a reverse primer,

the nucleotide sequence of the forward primer is shown as Seq ID NO. 3; the nucleotide sequence of the reverse primer is shown in Seq ID No. 4.

As an improvement of the technical scheme of the previous step, the PCR conditions for amplifying the target gene by PCR comprise:

first, pre-denaturation at 95 ℃ for 5 min;

secondly, denaturation at 95 ℃ for 1min, annealing at 60 ℃ for 1min, and extension at 72 ℃ for 2.5min for 29 cycles; finally extending for 10min at 72 ℃ to obtain a PCR amplification product;

thirdly, separating PCR amplification products, cutting off target bands, wherein the target bands are target gene PCR amplification products;

fourthly, recovering the PCR amplification product of the target gene.

As an improvement of the technical scheme of the previous step, the construction of the recombinant vector comprises the following steps:

step a, extracting pYES2/CT-MF alpha plasmid from DH5 alpha/pYES 2/CT-MF alpha;

b, carrying out double enzyme digestion on the plasmid pYES2/CT-MF alpha and the target gene PCR amplification product by using Not I and Xba I respectively to obtain a double enzyme digested pYES2/CT-MF alpha fragment and a target gene PCR amplification product, and recovering the double enzyme digested pYES2/CT-MF alpha fragment and the target gene PCR amplification product;

c, connecting the recovered pYES2/CT-MF alpha fragment with the PCR amplification product of the target gene by using T4 DNA ligase at 37 ℃ for about 30min to obtain a connection product;

and d, transforming the connecting product into E.coliDH5 alpha competent cells, selecting a positive transformant for culture after Amp resistance screening to obtain a recombinant vector, wherein the recombinant vector is pYES2/CT-MF alpha-rFNIII 1C-HSA plasmid.

Further, the restriction enzyme system of pYES2/CT-MF α plasmid is 50. mu.l, and the restriction enzyme system of pYES2/CT-MF α plasmid is composed of QuickCut Not I: QuickCut Xba I:10 XQuickCut Green Buffer: pYES2/CT-MF α plasmid in the following ratio: 5. mu.l 35. mu.l;

the enzyme digestion system of the target gene PCR amplification product is 50 mu l, and the enzyme digestion system of the target gene PCR amplification product is mixed by QuickCut Not I, QuickCut Xba I, 10 XQuickCut Green Buffer and the target gene PCR amplification product according to the following proportion: 5. mu.l 35. mu.l;

the restriction enzyme digestion conditions of pYES2/CT-MF alpha plasmid and PCR amplification products of target genes comprise: the enzyme was cleaved in a metal bath at 37 ℃ for 3 h.

Furthermore, the ligation system of the pYES2/CT-MF α fragment and the PCR amplification product of the target gene is 10. mu.l, and the ligation system comprises the recovered pYES2/CT-MF α fragment, the recovered PCR amplification product of the target gene, T4 DNA strain, 10 Xstrain buffer, mixed according to the following ratio: mu.l 5. mu.l 1. mu.l.

The invention also provides a detection method for detecting the adherence activity of the bovine kidney cells promoted by the saccharomyces cerevisiae expressing the long-acting recombinant fibronectin, which adopts any saccharomyces cerevisiae expressing the long-acting recombinant fibronectin; the detection method also comprises reagent preparation and cell growth promoting activity determination.

As an improvement of the technical scheme of the previous step, the reagent comprises: complete culture solution, serum-free culture solution, digestive juice and PBS buffer solution; the cell growth promoting activity assay comprises the following steps:

subculturing the bovine kidney cells in a complete cell culture solution, and adding a serum-free culture medium for heavy suspension to obtain a bovine kidney cell suspension;

pre-diluting the long-acting recombinant fibronectin with PBS buffer solution, performing 2-fold gradient dilution in a 96-well plate after the pre-dilution is completed, performing 10 dilutions in total, obtaining 50 mu l of long-acting recombinant fibronectin samples with different dilutions in each well, setting up negative control, and incubating overnight at 4 ℃; negative control was 50 μ l PBS;

after incubation, liquid in the plate is discarded, 100 mu L of 30g/L BSA is added into each hole for blocking, and the plate is placed in an incubator at 37 ℃ for incubation for 1 h; discarding the liquid in the plate, adding bovine kidney cell suspension, the cell seeding density is 1.0 × 10⁵ Inoculating 100 μ l of the seed/ml, and incubating in an incubator for 5 h;

and (3) washing the incubated cell plate with PBS buffer solution, observing the cell adherence condition under a mirror, selecting five points at the edge of the cell plate under the mirror with the volume of 200 times of the cell adherence condition, counting the number of adherent cells to obtain a counting result fitting curve, and judging the adherence activity of the long-acting recombinant fibronectin bovine kidney cells according to the counting result fitting curve.

The invention also provides application of the saccharomyces cerevisiae expressing the long-acting recombinant fibronectin in cosmetics, wherein the saccharomyces cerevisiae expressing the long-acting recombinant fibronectin is adopted.

The invention has the beneficial effects that:

1. the invention utilizes long-acting recombinant fibronectin secreted and expressed by saccharomyces cerevisiae as a recombinant protein (FNIII1C-HAS) formed by fusing a functional fragment (FNIII1C) of natural human FN and HSA. FNIII1C is a functional fragment of 1 st type III FN repeat unit C terminal in natural human FN, and has antitumor, anti-metastatic and angiogenesis inhibiting effects. The protein can also ensure that FN in organisms is hyperpolymerized, and greatly enhances the cell adhesion promoting and cell migration resisting capabilities of FN. The fusion HAS effectively improves the stability of the recombinant protein.

2. In vitro experiments prove that FNIII1C-HAS can promote the adhesion and adhesion of bovine kidney cell (MDBK) cells, can improve the adherence rate and the confluence rate of the cells, shortens the cell confluence time, and enables the morphological structure of the cells to be good, the metabolic rate to be enhanced and the protein synthesis speed to be obviously improved. Cell adhesion and cell adhesion are essential conditions for cell repair and cell growth, so that fibronectin has the effect of promoting cell repair. In addition, mouse model experiments prove that FNIII1C-HAS can effectively promote skin wound repair and remarkably improve the healing rate of the injury.

3. The long-acting recombinant fibronectin obtained by expressing the long-acting recombinant fibronectin by saccharomyces cerevisiae secretion has uniform product and no immunogenicity, so that the production process of the long-acting recombinant fibronectin is simpler and has low cost.

Drawings

FIG. 1 is a flow chart of a method for obtaining long-acting recombinant fibronectin.

FIG. 2 is a schematic representation of FN monomer domains.

FIG. 3 is a map of pYES2/CT-MF α plasmid.

FIG. 4 is a photograph showing the results of agarose gel electrophoresis of the FNIII1C-HAS gene amplified by PCR, in which M is a photograph showing the results of agarose gel electrophoresis of DNA Marker DL2000, 1-2 are photographs showing the results of agarose gel electrophoresis of FNIII1C-HAS gene, and 3 is a photograph showing the results of agarose gel electrophoresis of pure water (negative control).

FIG. 5 is the agarose gel electrophoresis result of PCR amplification product of double restriction target gene and pYES2/CT-MF α plasmid, in which M is the agarose gel electrophoresis result of DNA Marker DL2000, 1-2 is the agarose gel electrophoresis result of FNIII1C-HAS gene, and 3 is the agarose gel electrophoresis result of pYES2/CT-MF α fragment (negative control).

FIG. 6 is a diagram showing the result of agarose gel electrophoresis in which a target gene is identified by PCR, in which M is DNA Marker DL 2000; 1-4 is the PCR result of the bacterial liquid.

FIG. 7 is a diagram showing the results of electrophoresis of the supernatant of INDSC 1/pYES2/CT-MF α -rFNIII1C-HSA induced expression, in which FIG. 1 is a diagram showing the results of electrophoresis of the induced supernatant; m is an electrophoresis result picture of Marker; and 2 is an electrophoresis result picture of the induction supernatant containing the unloaded plasmid saccharomyces cerevisiae strain.

Fig. 8 is a schematic illustration of the calculation of wound healing rate from recorded wound area.

Sequence listing description (sequence listing content provided separately)

Seq ID No.1 shows the nucleotide sequence of long-acting recombinant fibronectin of the examples of the present invention.

Seq ID No.2 shows the amino acid sequence of long-acting recombinant fibronectin of the examples of the present invention.

Seq ID No.3 shows the nucleotide sequence of the forward primer in the examples of the present invention.

Seq ID No.4 shows the nucleotide sequence of the reverse primer in the examples of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Example 1

This example discloses a saccharomyces cerevisiae expressing long-acting recombinant fibronectin. Overcomes the defects of complex process and high cost of natural FN purification; the natural FN has large molecular weight and low feasibility of full-sequence expression, so that the popularization and the application of the FN are limited; the existing prokaryotic expression system has the defects of easy formation of inclusion bodies, low biological activity of the obtained FN protein and the like.

The long-acting recombinant fibronectin is rFNIII 1C-HAS. The nucleotide sequence of the long-acting recombinant fibronectin is shown in Seq ID No.1, and the corresponding amino acid sequence of the nucleotide sequence of the long-acting recombinant fibronectin is shown in Seq ID No. 2. The nucleotide sequence of long-acting recombinant fibronectin includes a functional fragment of FN, HAS; functional fragments of FN include FNIII1C units; the FNIII1C unit is a functional fragment of the C terminal of the 1 st type III FN repeating unit in FN (shown in combination with FIG. 2).

The long-acting recombinant fibronectin in the embodiment is a recombinant protein (FNIII1C-HAS) formed by fusing a functional fragment (FNIII1C) of natural human FN and HSA. FNIII1C is a functional fragment of 1 st type III FN repeat unit C terminal in natural human FN, and has antitumor, anti-metastatic and angiogenesis inhibiting effects. The protein can also ensure that FN in organisms is hyperpolymerized, and greatly enhances the cell adhesion promoting and cell migration resisting capabilities of FN. The fusion HAS effectively improves the stability of the recombinant protein.

The culture medium and reagent preparation for obtaining long-acting recombinant fibronectin specifically comprise:

(1) YPD complete medium:

autoclaving at 121 deg.C for 20min, cooling to below 60 deg.C, and adding sterile 100ml 10% glucose into super clean bench. Agar powder is added into the solid culture medium for 2.0 percent.

(2) SC-U deficient medium:

0.01% of the amino acid mixture I is arginine, leucine, threonine, lysine, tryptophan, cysteine and adenine, and 0.005% of the amino acid mixture II is aspartic acid, serine, histidine, proline, isoleucine, phenylalanine, arginine, tyrosine and methionine. Autoclaving at 121 deg.C for 20min, cooling to below 60 deg.C, and adding sterile 100ml 20% glucose into super clean bench. Agar powder is added into the solid culture medium for 2.0 percent.

(3) SC-U induction medium:

autoclaving at 121 deg.C for 20min, cooling to below 60 deg.C, and adding sterile 100ml 20% galactose into the ultra-clean bench. Agar powder is added into the solid culture medium for 2.0 percent.

(4) PBS buffer:

weighing the above components, dissolving in purified water, adjusting pH to 8.0, and diluting to 1L.

(5) PBS buffer containing 500mM imidazole:

In other embodiments, the components for preparing the culture medium and the reagents, i.e., the constant volume ratio, can be prepared according to the needs of those skilled in the art.

The method for obtaining the long-acting recombinant fibronectin comprises the following steps:

step one, designing a sequence of a target gene: the gene of interest is the FNIII1C-HAS gene, and the FNIII1C-HAS gene comprises: not I enzyme cutting site, Xba I enzyme cutting site, initiation codon, termination codon, tag sequence and base sequence corresponding to Linker connecting FNIII1C unit and HSA sequence.

In this example, based on the properties of pYES2/CT-MF α vector (shown in FIG. 3) and the codon preference of Saccharomyces cerevisiae host, the gene sequence of FNIII1C-HSA was designed as follows:

GCGGCCGCAATGAATGCGCCACAGCCATCCCATATCTCAAAGTACATTCTAAGATGGAGGCCCAAAAACTCCGTTGGGCGTTGGAAAGAAGCCACCATTCCTGGTCACCTGAATTCTTACACCATTAAAGGCCTTAAGCCAGGAGTCGTTTATGAGGGTCAGCTAATTTCCATCCAACAGTATGGGCATCAAGAGGTGACTAGATTCGACTTCACAACAACGTCTACATCCACACCCGCAGAGGCGGCGGCTAAGGAAGCTGCAGCCAAAGCCATGAAGTGGGTTACGTTTATCTCCCTATTATTTCTGTTCTCATCCGCCTACTCCAGAGGTGTTTTCAGGAGAGATGCTCACAAATCTGAGGTTGCTCATAGATTCAAGGATTTGGGTGAAGAAAACTTTAAGGCCTTAGTGTTAATAGCTTTCGCACAATACCTGCAACAGTGTCCTTTTGAAGACCATGTCAAATTAGTTAATGAAGTCACCGAATTTGCTAAGACGTGCGTTGCTGATGAGTCTGCCGAAAATTGTGACAAATCACTGCATACATTGTTCGGTGATAAGCTATGTACCGTTGCAACTCTTAGAGAAACGTACGGAGAGATGGCGGACTGTTGTGCTAAACAAGAACCTGAAAGAAATGAATGTTTTTTGCAACACAAAGATGATAATCCAAACTTGCCAAGATTGGTAAGACCAGAAGTTGACGTTATGTGTACCGCTTTTCATGATAATGAAGAAACATTTTTGAAAAAGTATCTTTATGAAATAGCAAGGAGGCATCCTTACTTCTACGCTCCAGAGTTATTATTTTTTGCAAAAAGATATAAGGCAGCTTTTACTGAATGTTGTCAGGCTGCGGATAAAGCCGCATGTCTGTTACCCAAATTGGATGAATTGAGAGACGAGGGCAAAGCTAGTAGTGCCAAACAAAGATTAAAATGCGCTTCATTACAAAAATTTGGAGAAAGAGCGTTTAAGGCTTGGGCCGTAGCAAGATTGTCTCAGAGATTCCCGAAAGCCGAATTTGCAGAAGTGAGTAAACTGGTCACAGATTTGACGAAAGTTCACACAGAATGTTGTCACGGAGATTTATTGGAATGCGCTGACGATAGGGCTGACTTAGCTAAATACATATGCGAGAATCAAGATTCCATATCATCAAAATTGAAAGAATGTTGTGAGAAACCATTATTAGAAAAATCCCACTGTATAGCTGAAGTTGAGAACGATGAAATGCCCGCGGATTTACCCTCCCTTGCGGCTGACTTCGTTGAGTCAAAGGATGTTTGCAAGAATTACGCGGAGGCCAAGGATGTTTTTCTTGGCATGTTTTTATATGAGTATGCCAGACGTCATCCGGATTATTCTGTAGTTCTACTGTTAAGGCTTGCCAAGACATACGAAACTACCTTAGAAAAATGTTGTGCGGCTGCCGATCCACATGAATGTTACGCAAAAGTTTTTGATGAATTCAAGCCGCTTGTCGAGGAGCCACAAAATTTAATTAAACAAAACTGTGAATTATTTGAACAATTAGGTGAATATAAATTCCAAAACGCATTATTGGTCAGATATACAAAAAAAGTACCTCAGGTTTCCACACCAACTTTAGTGGAAGTGTCACGTAACCTAGGCAAGGTTGGTAGTAAGTGCTGTAAACACCCAGAAGCTAAGAGAATGCCATGCGCTGAAGATTATCTATCAGTCGTACTTAATCAACTGTGTGTCCTACACGAGAAGACTCCTGTCAGTGACAGAGTGACAAAATGTTGCACCGAGAGCTTAGTTAATAGAAGACCGTGTTTTTCAGCGCTGGAAGTTGATGAAACCTATGTTCCAAAGGAGTTCAATGCAGAAACATTCACCTTCCATGCTGATATATGTACTCTTAGTGAAAAAGAAAGGCAGATCAAAAAACAAACTGCCCTGGTCGAATTAGTCAAACATAAACCTAAAGCAACGAAGGAACAGTTGAAGGCCGTAATGGATGATTTCGCAGCTTTCGTTGAAAAATGTTGCAAGGCTGATGACAAAGAGACATGTTTTGCTGAAGAGGGAAAAAAATTGGTGGCAGCTTCTCAAGCCGCTTTAGGGTTACATCACCATCACCATCACTAATCTAGA。

note:GCGGCCGCis Not I enzyme cutting site,TCTAGAxba I restriction site;ATGis a start codon for the gene encoding the polypeptide,TAA is a stop codon;GCAGAGGCGGCGGCTAAGGAAGCTGCAGCCAAAGCCa base sequence corresponding to Linker connecting FNIII1C and HSA sequences;CATCACCATCACCATCACis a 6 × His tag sequence.

The amino acid sequence of the fusion protein FNIII1C-HSA is as follows:

MNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTPAEAAAKEAAAKAMKWVTFISLLFLFSSAYSRGVFRRDAHKSEVAHRFKDLGEENFKALVLIAFAQYLQQCPFEDHVKLVNEVTEFAKTCVADESAENCDKSLHTLFGDKLCTVATLRETYGEMADCCAKQEPERNECFLQHKDDNPNLPRLVRPEVDVMCTAFHDNEETFLKKYLYEIARRHPYFYAPELLFFAKRYKAAFTECCQAADKAACLLPKLDELRDEGKASSAKQRLKCASLQKFGERAFKAWAVARLSQRFPKAEFAEVSKLVTDLTKVHTECCHGDLLECADDRADLAKYICENQDSISSKLKECCEKPLLEKSHCIAEVENDEMPADLPSLAADFVESKDVCKNYAEAKDVFLGMFLYEYARRHPDYSVVLLLRLAKTYETTLEKCCAAADPHECYAKVFDEFKPLVEEPQNLIKQNCELFEQLGEYKFQNALLVRYTKKVPQVSTPTLVEVSRNLGKVGSKCCKHPEAKRMPCAEDYLSVVLNQLCVLHEKTPVSDRVTKCCTESLVNRRPCFSALEVDETYVPKEFNAETFTFHADICTLSEKERQIKKQTALVELVKHKPKATKEQLKAVMDDFAAFVEKCCKADDKETCFAEEGKKLVAASQAALGLHHHHHH。

step two, constructing a recombinant vector: first, amplification primers are designed based on the sequence of the target gene, and in this example, based on the nucleotide sequence of FNIII 1C-HSA. The amplification primer comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as Seq ID NO.3, and the nucleotide sequence of the forward primer is as follows: 5'ATAAGAATGCGGCCGCATGAATGCGCCACAGCCATCCCATA 3'. The nucleotide sequence of the reverse primer is shown in Seq ID No.4, and the nucleotide sequence of the reverse primer is 5'CTAGTCTAGATTAGTGATGGTGATGGTGATGTAACCCTAAAG 3'.

Secondly, amplifying the target gene by PCR, wherein the PCR conditions for amplifying the target gene by PCR comprise: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 1min, annealing at 60 ℃ for 1min, and extension at 72 ℃ for 2.5min for 29 cycles; finally extending for 10min at 72 ℃ to obtain a PCR amplification product; separating PCR amplification products, cutting off target bands, wherein the target bands are target gene PCR amplification products; recovering the target gene PCR amplification product.

In this example, PCR amplification products (described in connection with FIG. 4) were separated by agarose gel electrophoresis, the concentration of which is preferably 1%, the band of interest was rapidly excised under an ultraviolet lamp, and the PCR amplification products of the gene of interest were recovered using a DNA gel recovery kit. In the field of biochemistry, a 1% agarose gel refers to an agarose gel formed by adding 1g of agarose per 100ml of electrophoresis buffer.

Thereafter, the construction of a recombinant vector is carried out, which comprises the following steps:

step a, extracting pYES2/CT-MF alpha plasmid from DH5 alpha/pYES 2/CT-MF alpha.

And b, carrying out double enzyme digestion on the plasmid pYES2/CT-MF alpha and the target gene PCR amplification product by using Not I and Xba I respectively to obtain a double enzyme digested pYES2/CT-MF alpha fragment and a target gene PCR amplification product, and recovering the double enzyme digested pYES2/CT-MF alpha fragment and the target gene PCR amplification product.

Wherein the restriction enzyme system of pYES2/CT-MF alpha plasmid is 50 mul, and the restriction enzyme system of pYES2/CT-MF alpha plasmid is formed by mixing QuickCut Not I, QuickCut Xba I, 10 XQuickCut Green Buffer, pYES2/CT-MF alpha according to the following proportion: 5. mu.l, 35. mu.l.

The enzyme digestion system of the target gene PCR amplification product is 50 mu l, and the enzyme digestion system of the target gene PCR amplification product is mixed by QuickCut Not I, QuickCut Xba I, 10 XQuickCut Green Buffer and the target gene PCR amplification product according to the following proportion: 5. mu.l, 35. mu.l.

The restriction enzyme digestion condition of pYES2/CT-MF alpha plasmid and the PCR amplification product of the target gene is that the restriction enzyme digestion is carried out for 3 hours in a metal bath at 37 ℃. In this example, the restriction enzyme was followed by agarose gel electrophoresis (shown in FIG. 5), the agarose gel concentration was preferably 2%, and the PCR amplification product of the target gene and pYES2/CT-MF α fragment were recovered by gel digestion. In the field of biochemistry, a 2% agarose gel refers to an agarose gel formed by adding 2g of agarose per 100ml of electrophoresis buffer.

And c, connecting the recovered pYES2/CT-MF alpha fragment and the PCR amplification product of the target gene by using T4 DNA ligase at 37 ℃ for about 30min to obtain a connection product. The connecting system of the pYES2/CT-MF alpha fragment and the PCR amplification product of the target gene is 10 mul, and the connecting system comprises the recovered pYES2/CT-MF alpha fragment, the recovered PCR amplification product of the target gene, T4 DNA ligase and 10 Xligase buffer which are mixed according to the following proportion: mu.l 5. mu.l 1. mu.l.

And d, transforming the connecting product into E.coliDH5 alpha competent cells, selecting a positive transformant for culture after Amp resistance screening to obtain a recombinant vector, wherein the recombinant vector is pYES2/CT-MF alpha-rFNIII 1C-HSA plasmid. In this example, whether the gene was successfully introduced into the vector was identified by PCR using bacterial suspension, and as a result, it can be seen that the gene was successfully introduced into the vector with reference to FIG. 6. And then the bacterial liquid is sent to a general biological company for sequencing, and if the sequencing result is correct, the pYES2/CT-MF alpha-rFNIII 1C-HSA vector is successfully constructed.

Step three, constructing engineering bacteria, in the embodiment, pYES2/CT-MF alpha-rFNIII 1C-HSA vector is transformed into saccharomyces cerevisiae INVSC1 competent cells through electricity.

Uniformly mixing a recombinant vector, namely saccharomyces cerevisiae INVScl competent cells according to the proportion of 10 mu l to 80 mu l, and then transferring the mixture into a precooled electric shock cup; performing ice bath for 5min, and wiping the outer wall of the electric shock cup; adjusting the Bio-Rad electric converter to the fungus grade, and placing an electric shock cup on the Bio-Rad electric converter for electric shock; quickly adding 500 mu l of precooled 1M sorbitol solution into the electric shock cup, uniformly mixing, and coating an SC-U solid plate; carrying out inversion culture at constant temperature of 30 ℃ until monoclonals grow out; selecting transformants, inoculating the transformants into an SC-U liquid culture medium, and culturing at the constant temperature of 30 ℃ and 200 rpm; carrying out PCR reaction by taking the bacterial liquid as a template, and identifying and screening positive clones; selecting transformants which are identified to be correct, and obtaining the engineering bacteria INVSC1/pYES2/CT-MF alpha-rFNIII 1C-HAS.

Step four, induced expression of engineering bacteria: and selecting a single colony of the engineering bacteria, inoculating the single colony to an SC-U selective culture medium, and performing shake culture at 30 ℃ and 220rpm overnight. Measuring the OD thereof_600nmLight absorption value, calculating corresponding volume of bacterial liquid, transferring into SC-U induction culture medium to make initial OD_600nm0.4 is reached, and the induction time is 20 h.

In this example, a single colony of INVSC1/pYES2/CT-MF α -rFNIII1C-HSA was picked, inoculated into 20ml of SC-U selection medium, and shake-cultured at 220rpm at 30 ℃ overnight. Measuring the OD thereof_600nmLight absorption value, transferring the calculated bacterial liquid with corresponding volume into 100ml SC-U induction culture medium to ensure that the initial OD_600nm0.4 is reached, and the induction time is 20 h.

As shown in FIG. 7, the specific band of about 77kDa was observed on SDS-PAGE of the supernatant of INDSC 1/pYES2/CT-MF α -rFNIII1C-HSA, while no specific band was observed in the supernatant of Saccharomyces cerevisiae containing pYES2/CT-MF α empty plasmid.

Step five, purifying the long-acting recombinant fibronectin: centrifugally collecting culture solution supernatant, and filtering with a filter membrane for sample loading; self-loading a nickel ion chelating affinity chromatography filler to obtain a nickel ion chelating affinity chromatography column, washing the nickel ion chelating affinity chromatography column with purified water, and balancing the pH value of the nickel ion chelating affinity chromatography column with a PBS (phosphate buffer solution); detecting conductivity value and 280nm wavelength absorption value on line, starting to sample after both are stable, and setting the flow rate of the sample pumped through the chromatographic column to be 5-6 ml/min; further passing through a column with PBS buffer, and washing away the foreign proteins not bound to the column until OD_280nmStabilizing; and then passing the solution through a chromatographic column by using PBS buffer solution containing imidazole, eluting and collecting protein corresponding to an elution peak to obtain the long-acting recombinant fibronectin stock solution.

In this example, the culture supernatant was collected by centrifugation and filtered through a 0.22 μm filter for loading. The column was self-packed using the GE Healthcare company chemical Sepharose TM Fast Flow Nickel ion chelate affinity chromatography packing, and the Ni was washed with 3 column volumes of purified water²⁺Chelating affinity chromatography column, then using PBS to balance 2-3 column volumes. And (3) detecting the conductivity value and the absorption value of 280nm wavelength on line, starting to sample after the conductivity value and the absorption value are both stable, and setting the flow rate of the sample pumped through the chromatographic column to be 5-6 ml/min. Further passing through a chromatography column with PBS, and washing away the foreign proteins not bound to the chromatography column until OD_280nmAnd (4) stabilizing. And then passing through a chromatographic column by using PBS buffer solution containing 500mM imidazole, eluting and collecting protein corresponding to an elution peak to obtain rFNIII1C-HSA protein stock solution.

The saccharomyces cerevisiae secretion expression system is a eukaryotic expression system, can express protein at a high level and secrete the protein into a culture medium, and has the advantages of simple production process, low cost, uniform product and no immunogenicity. The long-acting recombinant fibronectin secreted and expressed by saccharomyces cerevisiae can ensure that FN in organisms is hyperpolarized, greatly enhances the cell adhesion promoting and cell migration resisting capabilities of FN, and has higher stability of recombinant protein.

Example 2

The embodiment discloses a detection method for detecting the adherence activity of bovine kidney cells promoted by long-acting recombinant fibronectin expressed by saccharomyces cerevisiae. To verify the anchorage-promoting activity of the long-acting recombinant fibronectin FNIII1C-HAS bovine kidney cells (MDBK) as in example 1. The detection method comprises reagent preparation and cell growth promoting activity determination.

The reagent comprises: complete culture solution, serum-free culture solution, digestive juice and PBS buffer solution.

In this embodiment, the preparation of each culture and reagent specifically includes:

(1) complete culture solution: 10ml of fetal bovine serum and 1ml of double antibody are measured and added into 90ml of DMEM culture solution.

(2) Serum-free culture solution: 1ml of the double antibody is measured and added into 99ml of 1640 culture solution.

(3) Digestion solution: 0.25% trypsin.

(4) PBS buffer: weighing 8.0g of sodium chloride, 0.20g of potassium chloride, 1.44g of disodium hydrogen phosphate and 0.24g of potassium dihydrogen phosphate, adding water to dissolve, fixing the volume to 1000ml, and sterilizing at 121 ℃ for 15 minutes under high pressure.

The cell growth promoting activity assay comprises the following steps:

and (3) subculturing the bovine kidney cells in a complete cell culture solution, and adding a serum-free culture medium for heavy suspension to obtain a bovine kidney cell suspension. Wherein, the bovine kidney cells grow in a complete cell culture solution in a monolayer and adherent manner, are subjected to 1:2 digestion passage once every 4-5d, and grow and propagate in the complete cell culture solution. When ready for use, resuspension was performed in serum-free medium.

Pre-diluting the long-acting recombinant fibronectin with PBS buffer solution, performing 2-fold gradient dilution in a 96-well plate after the pre-dilution is completed, performing 10 dilutions in total, obtaining 50 mu l of long-acting recombinant fibronectin samples with different dilutions in each well, setting up negative control, and incubating overnight at 4 ℃; the negative control was 50. mu.l PBS.

In this example, long-acting recombinant fibronectin rFNIII1C-HSA was pre-diluted to 0.5. mu.g/ml with PBS, and after completion of the pre-dilution, 2-fold gradient dilutions were performed in a 96-well plate for a total of 10 dilutions, with 50. mu.l of rFNIII1C-HSA sample at different dilutions per well, and a negative control (no rFNIII1C-HSA, 50. mu.l PBS was added) was set as a control and incubated overnight at 4 ℃.

After incubation, liquid in the plate is discarded, 100 mu L of 30g/L BSA is added into each hole for blocking, and the plate is placed in an incubator at 37 ℃ for incubation for 1 h; discarding the liquid in the plate, adding bovine kidney cell suspension, the cell seeding density is 1.0 × 10⁵Each well was inoculated with 100. mu.l of each, and incubated in an incubator for 5 hours.

And (3) washing the incubated cell plate with PBS buffer solution, observing the cell adherence condition under a mirror, selecting five points at the edge of the cell plate under the mirror with the volume of 200 times of the cell adherence condition, counting the number of adherent cells to obtain a counting result fitting curve, and judging the adherence activity of the long-acting recombinant fibronectin bovine kidney cells according to the counting result fitting curve. Where the incubated cell plates were washed 3 times with PBS buffer, in other embodiments the number of washes can be set according to the experience of the person skilled in the art.

rFNIII1C-HAS adhesion promoting effect on MDBK cell adherence (half effective concentration ED)₅₀) Determination of, ED₅₀The assay was about 3.33. + -. 0.67. mu.g/ml. The structure proves that FNIII1C-HAS can promote the adhesion and adhesion of bovine kidney cell (MDBK) cells, can improve the adherence rate and the confluence rate of the cells, shortens the cell confluence time, and enables the morphological structure of the cells to be good, the metabolic rate to be enhanced and the protein synthesis speed to be obviously improved. Cell adhesion and cell adhesion are essential conditions for cell repair and cell growth, so that fibronectin has the effect of promoting cell repair.

Example 3

This example provides experiments on the use of rFNIII1C-HAS for skin lesion repair to verify the effectiveness of rFNIII1C-HAS in example 1 for skin lesion repair. Mouse model experiments prove that FNIII1C-HAS can effectively promote skin wound repair and remarkably improve the healing rate of the injury. The implementation comprises the following steps:

(1) test grouping

The experimental rats of 4-5 weeks old are divided into 2 groups, 10 rats in each group weigh about 250g and are marked with ear numbers.

(2) Test treatment

A hole (diameter 0.5cm) is punched on the back by a puncher, and a PBS smearing control group and an rFNIII1C-HAS (1mg/ml) smearing experimental group are respectively arranged and smeared for 3 times every day until the wound is healed. The rats of 2 groups were kept in a warm and dry environment, and photographs were taken daily and observed to record wound healing.

(3) Results of the experiment

Referring to FIG. 8, it can be observed that the wounds of the experimental mice in the back trauma group were changed by the experimental group coated with rFNIII1C-HAS and the control group coated with PBS: starting from 0d, the mice in the experimental group have weak inflammatory reaction caused by dorsal wound, compared with the control group, and starting from 4d, the mice in the experimental group have a greater wound healing rate on the back than the control group, and the phenomenon continues until the experiment is finished. And measuring the perimeter of the edge of the wound during observation and photographing, calculating the area size, and calculating the wound healing rate according to the recorded wound area, wherein the healing rate of the experimental group is 89.2% +/-4%, the healing rate of the control group is 49.3% +/-6%, the experimental group is higher than the control group, and the statistical significance is realized (p is less than 0.05).

Example 4

This example provides the use of saccharomyces cerevisiae expressing long-acting recombinant fibronectin in cosmetics using saccharomyces cerevisiae expressing long-acting recombinant fibronectin as described in example 1. The long-acting recombinant fibronectin has the effect of promoting cell repair. And as described in example 2, the long-acting recombinant fibronectin of example 1 has a pro-cell repair effect. In addition, it is clear from this that, as described in example 3, the long-acting recombinant fibronectin in example 1 is effective in promoting the repair of skin wounds and significantly improving the rate of healing of the wounds. Therefore, the long-acting recombinant fibronectin described in example 1 has a wide application prospect in cosmetics.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> research institute of biological product industry, Inc. of Utafel, Utaki

<120> saccharomyces cerevisiae expression long-acting recombinant fibronectin and application thereof in cosmetics

<141> 2021-04-01

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2109

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

atgaatgcgc cacagccatc ccatatctca aagtacattc taagatggag gcccaaaaac 60

tccgttgggc gttggaaaga agccaccatt cctggtcacc tgaattctta caccattaaa 120

ggccttaagc caggagtcgt ttatgagggt cagctaattt ccatccaaca gtatgggcat 180

caagaggtga ctagattcga cttcacaaca acgtctacat ccacacccgc agaggcggcg 240

gctaaggaag ctgcagccaa agccatgaag tgggttacgt ttatctccct attatttctg 300

ttctcatccg cctactccag aggtgttttc aggagagatg ctcacaaatc tgaggttgct 360

catagattca aggatttggg tgaagaaaac tttaaggcct tagtgttaat agctttcgca 420

caatacctgc aacagtgtcc ttttgaagac catgtcaaat tagttaatga agtcaccgaa 480

tttgctaaga cgtgcgttgc tgatgagtct gccgaaaatt gtgacaaatc actgcataca 540

ttgttcggtg ataagctatg taccgttgca actcttagag aaacgtacgg agagatggcg 600

gactgttgtg ctaaacaaga acctgaaaga aatgaatgtt ttttgcaaca caaagatgat 660

aatccaaact tgccaagatt ggtaagacca gaagttgacg ttatgtgtac cgcttttcat 720

gataatgaag aaacattttt gaaaaagtat ctttatgaaa tagcaaggag gcatccttac 780

ttctacgctc cagagttatt attttttgca aaaagatata aggcagcttt tactgaatgt 840

tgtcaggctg cggataaagc cgcatgtctg ttacccaaat tggatgaatt gagagacgag 900

ggcaaagcta gtagtgccaa acaaagatta aaatgcgctt cattacaaaa atttggagaa 960

agagcgttta aggcttgggc cgtagcaaga ttgtctcaga gattcccgaa agccgaattt 1020

gcagaagtga gtaaactggt cacagatttg acgaaagttc acacagaatg ttgtcacgga 1080

gatttattgg aatgcgctga cgatagggct gacttagcta aatacatatg cgagaatcaa 1140

gattccatat catcaaaatt gaaagaatgt tgtgagaaac cattattaga aaaatcccac 1200

tgtatagctg aagttgagaa cgatgaaatg cccgcggatt taccctccct tgcggctgac 1260

ttcgttgagt caaaggatgt ttgcaagaat tacgcggagg ccaaggatgt ttttcttggc 1320

atgtttttat atgagtatgc cagacgtcat ccggattatt ctgtagttct actgttaagg 1380

cttgccaaga catacgaaac taccttagaa aaatgttgtg cggctgccga tccacatgaa 1440

tgttacgcaa aagtttttga tgaattcaag ccgcttgtcg aggagccaca aaatttaatt 1500

aaacaaaact gtgaattatt tgaacaatta ggtgaatata aattccaaaa cgcattattg 1560

gtcagatata caaaaaaagt acctcaggtt tccacaccaa ctttagtgga agtgtcacgt 1620

aacctaggca aggttggtag taagtgctgt aaacacccag aagctaagag aatgccatgc 1680

gctgaagatt atctatcagt cgtacttaat caactgtgtg tcctacacga gaagactcct 1740

gtcagtgaca gagtgacaaa atgttgcacc gagagcttag ttaatagaag accgtgtttt 1800

tcagcgctgg aagttgatga aacctatgtt ccaaaggagt tcaatgcaga aacattcacc 1860

ttccatgctg atatatgtac tcttagtgaa aaagaaaggc agatcaaaaa acaaactgcc 1920

ctggtcgaat tagtcaaaca taaacctaaa gcaacgaagg aacagttgaa ggccgtaatg 1980

gatgatttcg cagctttcgt tgaaaaatgt tgcaaggctg atgacaaaga gacatgtttt 2040

gctgaagagg gaaaaaaatt ggtggcagct tctcaagccg ctttagggtt acatcaccat 2100

caccatcac 2109

<210> 4

<211> 703

<212> PRT

<213> fusion protein (Saccharomyces cerevisiae)

<400> 4

Met Asn Ala Pro Gln Pro Ser His Ile Ser Lys Tyr Ile Leu Arg Trp

1 5 10 15

Arg Pro Lys Asn Ser Val Gly Arg Trp Lys Glu Ala Thr Ile Pro Gly

20 25 30

His Leu Asn Ser Tyr Thr Ile Lys Gly Leu Lys Pro Gly Val Val Tyr

35 40 45

Glu Gly Gln Leu Ile Ser Ile Gln Gln Tyr Gly His Gln Glu Val Thr

50 55 60

Arg Phe Asp Phe Thr Thr Thr Ser Thr Ser Thr Pro Ala Glu Ala Ala

65 70 75 80

Ala Lys Glu Ala Ala Ala Lys Ala Met Lys Trp Val Thr Phe Ile Ser

85 90 95

Leu Leu Phe Leu Phe Ser Ser Ala Tyr Ser Arg Gly Val Phe Arg Arg

100 105 110

Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu

115 120 125

Glu Asn Phe Lys Ala Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln

130 135 140

Gln Cys Pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val Thr Glu

145 150 155 160

Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys

165 170 175

Ser Leu His Thr Leu Phe Gly Asp Lys Leu Cys Thr Val Ala Thr Leu

180 185 190

Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys Cys Ala Lys Gln Glu Pro

195 200 205

Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asp Asp Asn Pro Asn Leu

210 215 220

Pro Arg Leu Val Arg Pro Glu Val Asp Val Met Cys Thr Ala Phe His

225 230 235 240

Asp Asn Glu Glu Thr Phe Leu Lys Lys Tyr Leu Tyr Glu Ile Ala Arg

245 250 255

Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg

260 265 270

Tyr Lys Ala Ala Phe Thr Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala

275 280 285

Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser

290 295 300

Ser Ala Lys Gln Arg Leu Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu

305 310 315 320

Arg Ala Phe Lys Ala Trp Ala Val Ala Arg Leu Ser Gln Arg Phe Pro

325 330 335

Lys Ala Glu Phe Ala Glu Val Ser Lys Leu Val Thr Asp Leu Thr Lys

340 345 350

Val His Thr Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp

355 360 365

Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser

370 375 380

Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser His

385 390 395 400

Cys Ile Ala Glu Val Glu Asn Asp Glu Met Pro Ala Asp Leu Pro Ser

405 410 415

Leu Ala Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala

420 425 430

Glu Ala Lys Asp Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg

435 440 445

Arg His Pro Asp Tyr Ser Val Val Leu Leu Leu Arg Leu Ala Lys Thr

450 455 460

Tyr Glu Thr Thr Leu Glu Lys Cys Cys Ala Ala Ala Asp Pro His Glu

465 470 475 480

Cys Tyr Ala Lys Val Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro

485 490 495

Gln Asn Leu Ile Lys Gln Asn Cys Glu Leu Phe Glu Gln Leu Gly Glu

500 505 510

Tyr Lys Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro

515 520 525

Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu Gly Lys

530 535 540

Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys Arg Met Pro Cys

545 550 555 560

Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Gln Leu Cys Val Leu His

565 570 575

Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys Cys Cys Thr Glu Ser

580 585 590

Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Glu Val Asp Glu Thr

595 600 605

Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe His Ala Asp

610 615 620

Ile Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile Lys Lys Gln Thr Ala

625 630 635 640

Leu Val Glu Leu Val Lys His Lys Pro Lys Ala Thr Lys Glu Gln Leu

645 650 655

Lys Ala Val Met Asp Asp Phe Ala Ala Phe Val Glu Lys Cys Cys Lys

660 665 670

Ala Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu Gly Lys Lys Leu Val

675 680 685

Ala Ala Ser Gln Ala Ala Leu Gly Leu His His His His His His

690 695 700

<210> 3

<211> 41

<212> DNA

<213> Saccharomyces cerevisiae

<400> 3

ataagaatgc ggccgcatga atgcgccaca gccatcccat a 41

<210> 4

<211> 42

<212> DNA

<213> Saccharomyces cerevisiae

<400> 4

ctagtctaga ttagtgatgg tgatggtgat gtaaccctaa ag 42

Claims

1. A saccharomyces cerevisiae expresses long-acting recombinant fibronectin, which is characterized in that: the nucleotide sequence of the long-acting recombinant fibronectin is shown in Seq ID No. 1;

the long-acting recombinant fibronectin comprises a functional fragment of FN, HAS; the functional fragment of FN comprises a FNIII1C unit; the FNIII1C unit is a functional fragment at the C end of the 1 st type III FN repeating unit in the FN.

2. The saccharomyces cerevisiae expressing long-acting recombinant fibronectin of claim 1 obtained by a method comprising the steps of:

step one, designing a sequence of a target gene: the target gene is FNIII1C-HAS gene, and the FNIII1C-HAS gene comprises: a Not I enzyme cutting site, an Xba I enzyme cutting site, an initiation codon, a termination codon, a tag sequence and a base sequence corresponding to a Linker connecting the FNIII1C unit and the HSA sequence;

step three, construction of engineering bacteria: uniformly mixing the recombinant vector and the saccharomyces cerevisiae INVScl competent cells according to the proportion of 10 mu l to 80 mu l, and then transferring the mixture into a precooled electric shock cup; carrying out ice bath for 5min, and wiping the outer wall of the electric shock cup;

adjusting a Bio-Rad electric converter to a fungus grade, and placing the electric shock cup on the Bio-Rad electric converter for electric shock; quickly adding 500 mu l of precooled 1M sorbitol solution into the electric shock cup, uniformly mixing, and coating an SC-U solid plate;

3. The Saccharomyces cerevisiae expressing long-acting recombinant fibronectin of claim 2,

the amplification primers comprise forward primers, and the nucleotide sequences of the forward primers are shown in Seq ID No. 3;

the amplification primers also comprise a reverse primer, and the nucleotide sequence of the reverse primer is shown in Seq ID No. 4.

4. The saccharomyces cerevisiae expressing long-acting recombinant fibronectin of claim 2 wherein the PCR conditions for PCR amplification of the gene of interest comprise:

first, pre-denaturation at 95 ℃ for 5 min;

thirdly, separating PCR amplification products, and cutting off a target strip, wherein the target strip is a target gene PCR amplification product;

fourthly, recovering the PCR amplification product of the target gene.

5. The saccharomyces cerevisiae expressing long-acting recombinant fibronectin of claim 2, wherein the construction of the recombinant vector comprises the steps of:

step a, extracting pYES2/CT-MF alpha plasmid from DH5 alpha/pYES 2/CT-MF alpha;

c, connecting the recovered pYES2/CT-MF alpha fragment and the PCR amplification product of the target gene by using T4 DNA ligase at 37 ℃ for about 30min to obtain a connection product;

6. The Saccharomyces cerevisiae expressing long-acting recombinant fibronectin of claim 5,

the restriction enzyme system of the pYES2/CT-MF alpha plasmid is 50 mu l, and the restriction enzyme system of the pYES2/CT-MF alpha plasmid is prepared by mixing QuickCut Not I, QuickCut Xba I, 10 XQuickCut Green Buffer, pYES2/CT-MF alpha according to the following proportions: 5. mu.l 35. mu.l;

the restriction enzyme digestion conditions of the pYES2/CT-MF alpha plasmid and the PCR amplification product of the target gene comprise: the enzyme was cleaved in a metal bath at 37 ℃ for 3 h.

7. The Saccharomyces cerevisiae expressing long-acting recombinant fibronectin as claimed in claim 5, wherein the ligation system of pYES2/CT-MF α fragment and PCR amplification product of the target gene is 10 μ l, and the ligation system is performed by mixing the recovered pYES2/CT-MF α fragment, PCR amplification product of the target gene, T4 DNA strain: 10 Xstrain buffer, in the following ratio: mu.l 5. mu.l 1. mu.l.

8. A method for detecting the bovine kidney cell adherence promoting activity of long-acting recombinant fibronectin expressed by saccharomyces cerevisiae, wherein the method for detecting the bovine kidney cell adherence promoting activity of the long-acting recombinant fibronectin expressed by the saccharomyces cerevisiae according to any one of claims 1 to 7; the detection method also comprises reagent preparation and cell growth promoting activity determination.

9. The Saccharomyces cerevisiae expressing long-acting recombinant fibronectin of claim 8,

the reagent comprises: complete culture solution, serum-free culture solution, digestive juice and PBS buffer solution;

the cell growth promoting activity assay comprises the steps of:

pre-diluting the long-acting recombinant fibronectin with PBS buffer solution, performing 2-fold gradient dilution in a 96-well plate after the pre-dilution is completed, performing 10 dilutions in total, obtaining 50 mu l of long-acting recombinant fibronectin samples with different dilutions in each well, setting up negative control, and incubating overnight at 4 ℃; the negative control was 50 μ Ι pbs;

after the incubation is finished, the liquid in the plate is discarded, 100 mu L of 30g/L BSA is added into each hole for blocking, and the plate is placed in an incubator at 37 ℃ for incubation for 1 h; discarding the liquid in the plate, adding bovine kidney cell suspension, the cell seeding density is 1.0 × 10⁵Inoculating 100 μ l of the seed/ml, and incubating in an incubator for 5 h;

10. Use of a saccharomyces cerevisiae expressing long-acting recombinant fibronectin in cosmetics, characterized in that it uses a saccharomyces cerevisiae expressing long-acting recombinant fibronectin according to any one of claims 1 to 7.