CN103131676A - Silkworm recombinant baculovirus showing recombinant human tumor necrosis factor receptor-Fc fusion protein gene, and preparing method and application thereof - Google Patents

Abstract

The invention relates to silkworm recombinant baculovirus showing recombinant human tumor necrosis factor receptor-Fc fusion protein gene, and a preparing method and application thereof, and belongs to the technical field of biological medicine. The recombinant human tumor necrosis factor receptor-Fc fusion protein (rhTHFR-Fc) gene is built on a silkworm recombinant baculovirus showing system to obtain recombinant baculovirus, therefore purpose protein is showed in a high-efficiency mode, and the purpose fusion protein rhTNFR-Fc is purified. By means of the silkworm recombinant baculovirus showing system, the purpose fusion protein rhTNFR-Fc can be showed in a high-efficiency mode and purified, and 0.17-mg purpose fusion protein can be purified in each ml of silkworm hemolymph.

Description

Express silkworm with recombinant baculovirus of recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene and its preparation method and application

Technical field

The present invention relates to silkworm with recombinant baculovirus of a kind of recombinant human tumor necrosis factor's of expression acceptor-Fc antigen-4 fusion protein gene and its preparation method and application, belong to the biological medicine technology field.

Background technology

Recombinant human II type Tumor Necrosis Factor Receptors-Fc fusion rotein (rhTNFR-Fc) is a kind of protein drug that can be used for treating as autoimmune disorders such as rheumatoid arthritiss.

Tumour necrosis factor (Tumor necrosis factor, TNF) be a kind of multi-functional cytokine, closely related with various diseases and pathologic reaction, play a crucial role in the autoimmune disorders such as inflammatory reaction, endotoxin shock, cachexy and rheumatoid arthritis, its overexpression is one of pathomechanism of various autoimmune disease.To studies show that of TNF acceptor (TNFR), II type Tumor Necrosis Factor Receptors is widely distributed, and is stronger with the avidity of tumour necrosis factor.This soluble receptors can in and TNF, in vivo the activity of TNF played down regulation.

Use the receptor immunoglobulin integration technology, the cell outskirt of acceptor and the Fc fragment gene of human normal immunoglobulin are merged, go out corresponding recombinant human II type Tumor Necrosis Factor Receptors (p75)-Fc fusion rotein (rhTNFR-Fc) at vivoexpression.The characteristics such as it has the Half-life in vivo of immunoglobulin (Ig) long, tissue penetration is strong, the TNF in body is combined specifically, thereby suppresses the inflammatory reaction in joint.

Etanercept (Enbrel ^TM) be the commercial TNFR-Fc fusion rotein that has gone on the market, be also anti-TNF one of the most effective medicine.Be also the highest product of sales volume in present biotech drug, the imitation products of domestic existing Etanercept is as general in the benefit match of listing, by the production of Chinese hamster ovary cell (CHO) expression system.But when being used for rheumatoid arthritis RA treatment, need 0.75～1.5 g albumen everyone per course for the treatment of, and this dosage is quite large.And the cultivation fee of mammalian cell costliness is used and lower expression level, is important " bottleneck " of Enbrel and other similar biotechnology drug manufacture and application.

The silkworm baculovirus expression vector system is a kind of widely used eukaryotic expression system, and we utilize its lower production cost and the advantage such as efficient, express and purification of Recombinant human tumor necrosis factor receptor-Fc fusion rotein.Utilize the silkworm baculovirus expression vector system to express so far more than 60 and plant pharmaceutical protein, wherein GM-CSF etc. more than ten plants and has realized industrialization, but the antibody class pharmaceutical protein was not yet expressed.And also do not express the also correlative study of purification of Recombinant human tumor necrosis factor receptor-Fc fusion rotein with the silkworm baculovirus expression vector system at present.

Summary of the invention

In view of this, the object of the present invention is to provide the silkworm with recombinant baculovirus of a kind of recombinant human tumor necrosis factor's of expression acceptor-Fc antigen-4 fusion protein gene, by building a kind of silkworm with recombinant baculovirus, utilize Bac to Bac system to carry out high efficient expression with recombinant human tumor necrosis factor's acceptor-Fc fusion rotein (rhTNFR-Fc) is gene constructed in the rhabdovirus expression vector system, and be purified into purpose fusion rotein rhTNFR-Fc.

For achieving the above object, the invention provides the silkworm with recombinant baculovirus of a kind of recombinant human tumor necrosis factor's of expression acceptor-Fc antigen-4 fusion protein gene, this virus contains recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene.

Preferably, the nucleotide sequence of wherein said recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene is as shown in SEQ ID NO:1.

The present invention also provides the preparation method of above-mentioned silkworm with recombinant baculovirus, comprises the following steps:

(1) recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene is synthetic;

(2) the recombinant human tumor necrosis factor's acceptor that step (1) is synthesized-Fc antigen-4 fusion protein gene is connected on transfer vector, and the transformed competence colibacillus cell, builds recombinant transfer vector;

(3) recombinant transfer vector that step (2) is built transforms intestinal bacteria DH10Bac competent cell, obtains recombinant baculovirus DNA;

(4) the recombinant baculovirus DNA transfection bombyx mori cell that step (3) is obtained obtains silkworm with recombinant baculovirus.

Preferably, wherein said step (1) specifically comprises:

Adopt pUC57- RhTNFR-FcRecombinant vectors is template, carries out pcr amplification take SEQ ID NO:3 and SEQ ID NO:4 as primer, obtains recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene RhTNFR-Fc

Preferably, wherein said step (2) specifically comprises:

Recombinant human tumor necrosis factor's acceptor that pcr amplification is obtained-Fc antigen-4 fusion protein gene is used EcoThe R I and XhoReclaim after the I double digestion, by being connected on the transfer vector pFastBac1 of same processing with the T4 ligase enzyme, recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene is positioned under the control of polyhedrosis gene promotor, then be transformed into Trans10In chemoreception attitude cell, screening positive clone obtains recombinant transfer vector pFastBac1- RhTNFR-Fc

Preferably, wherein said step (3) specifically comprises:

The recombinant transfer vector pFastBac1-that step (2) is obtained RhTNFR-FcTransform intestinal bacteria DH10Bac competent cell, containing picking hickie after on the LB culture plate of kantlex, gentamicin, tsiklomitsin, X-gal and IPTG, lucifuge is cultivated 40-48 h, cultivate bacterium liquid dilution 10 after 16-20 h ⁶Again coated plate is done screening, after picking hickie to LB liquid nutrient medium shakes bacterium cultivation 16-20 h, with Virahol extracting recombinant baculovirus DNA, and is PCR with the M13 universal primer and identifies.

Preferably, wherein said step (4) specifically comprises:

Get step (3) and identify that successful recombinant baculovirus DNA is by liposome mediated-method transfection Bombyx noriN cell, obtain zero after morbidity for viral suspension 0-4 ℃ preservation, extract viral genome and carry out the PCR evaluation with the M13 universal primer, obtain silkworm with recombinant baculovirus vBm- RhTNFR-Fc

The fusion rotein that the present invention also provides above-mentioned silkworm with recombinant baculovirus to express, its aminoacid sequence is as shown in SEQ ID NO:2.

The present invention also provides the preparation method of above-mentioned fusion rotein, comprises the following steps:

(1) above-mentioned infecting silkworm with recombinant baculovirus Bombyx noriN cell is carried out virus amplification, and do the evaluation of expression product in cell;

(2) F4 that amplification in step (1) is obtained with stab inoculation inoculation silkworm five-age larva, collects morbidity silkworm blood for virus;

(3) be purified into above-mentioned fusion rotein from the silkworm blood that step (2) is collected.

The present invention has following beneficial effect:

1, silkworm is the china natural resources characteristic, and many ground, the whole nation all can be raised on a large scale, therefore compare with the Mammals substratum of costliness, and cost is relatively cheap, can alleviate the middle and low income patient economy burden;

2, can high efficient expression by baculovirus expression vector system and be purified into fusion rotein rhTNFR-Fc, average every mL silkworm hemolymph can be purified into the purpose fusion rotein of 0.17 mg.

Description of drawings

Fig. 1 is RhTNFR-FcThe electrophoretic analysis figure of gene amplification; M:10 kb DNA molecular amount standard; The 1:PCR product;

Fig. 2 is recombinant transfer vector pFastBac1- RhTNFR-FcThe structure schematic diagram;

Fig. 3 is recombinant transfer vector pFastBac1- RhTNFR-FcEvaluation figure; M:10 kb DNA molecular amount standard; 1:PCR identifies; 2: recombinant plasmid EcoThe R I and XhoThe I double digestion is identified;

Fig. 4 is recombinant transfer vector pFastBac1- RhTNFR-FcSequencing result figure;

Fig. 5 is recombinant baculovirus Bacmid- RhTNFR-FcIdentify figure; M:10 kb DNA molecular amount standard; 1,3,5: with M 13 upstream primers and RhTNFR-FcDownstream primer is the primer pair pcr amplification product; 2,4,6: with RhTNFR-FcUpstream primer and M 13 downstream primers are the primer pair pcr amplification product;

Fig. 6 is silkworm with recombinant baculovirus vBm- RhTNFR-FcPCR identify figure; M:10 kb DNA molecular amount standard; 1: take M 13 upstream primers and M 13 downstream primers as the primer pair pcr amplification product; 2: with M 13 upstream primers and RhTNFR-FcDownstream primer is the primer pair pcr amplification product; 3: with RhTNFR-FcUpstream primer and M 13 downstream primers are the primer pair pcr amplification product;

Fig. 7 A is antigen-4 fusion protein gene RhTNFR-FcAt the SDS-PAGE of BmN cells figure; M: dye in advance the molecular weight of albumen standard; 1: inoculation recombinant virus vBm -( RhTNFR-Fc) the BmN cell;

Fig. 7 B is antigen-4 fusion protein gene RhTNFR-FcScheme at the Western of BmN cells Blotting; M: dye in advance the molecular weight of albumen standard; 1: inoculation recombinant virus vBm -( RhTNFR-Fc) the BmN cell;

Fig. 8 is antigen-4 fusion protein gene RhTNFR-FcIdentified by immunofluorescence figure at the BmN cells; A:DAPI dyeing, laser confocal microscope UV excites, 100 times of visuals field; B: mouse-anti human IgG Fc primary antibodie, iF555 sheep anti-mouse igg (FITC mark) two is anti-, and laser confocal microscope 543nm excites, 100 times of visuals field; C: mouse-anti human IgG Fc primary antibodie, iF555 sheep anti-mouse igg (FITC mark) two is anti-, DAPI dyeing, stack laser confocal microscope, 100 times of visuals field; D: laser confocal microscope light field, 100 times of visuals field;

Fig. 9 A is antigen-4 fusion protein gene RhTNFR-FcThe SDS-PAGE evaluation figure that expresses in silkworm hemolymph; M: dye in advance the molecular weight of albumen standard; 1: normal silkworm five-age larva hemolymph supernatant; 2: morbidity silkworm five-age larva hemolymph supernatant; 3: normal silkworm five-age larva hemolymph precipitation; 4: morbidity silkworm five-age larva hemolymph precipitation; Arrow is depicted as the purpose band;

Fig. 9 B is antigen-4 fusion protein gene RhTNFR-FcThe Western Blotting evaluation figure that expresses in silkworm hemolymph; M: dye in advance the molecular weight of albumen standard; 1: normal silkworm five-age larva hemolymph supernatant; 2: morbidity silkworm five-age larva hemolymph supernatant; 3: normal silkworm five-age larva hemolymph precipitation; 4: morbidity silkworm five-age larva hemolymph precipitation; Arrow is depicted as the purpose band;

Figure 10 is that the silkworm hemolymph is through the separating resulting figure of Superdex 200 posts;

Figure 11 A is that the silkworm hemolymph separates the SDS-PAGE analysis chart at each peak through Superdex 200 chromatography columns; M: dye in advance the molecular weight of albumen standard; 1: stoste; 2-6: be followed successively by 1 ^#Peak, 2 ^#Peak, 3 ^#Peak, 4 ^#Peak, 5 ^#The peak;

Figure 11 B is that the silkworm hemolymph separates the Western Blotting analysis chart at each peak through Superdex 200 chromatography columns; M: dye in advance the molecular weight of albumen standard; 1: stoste; 2-6: be followed successively by 1 ^#Peak, 2 ^#Peak, 3 ^#Peak, 4 ^#Peak, 5 ^#The peak;

Figure 12 A is the SDS-PAGE analysis chart after affinitive layer purification; M: dye in advance the molecular weight of albumen standard; 1:1 ^#The absorption peak protein sample; 2:1 ^#After absorption peak protein sample purifying; 3:2 ^#The absorption peak protein sample; 4:2 ^#After absorption peak protein sample purifying;

Figure 12 B is the Western Blotting analysis chart after affinitive layer purification; M: dye in advance the molecular weight of albumen standard; 1:1 ^#The absorption peak protein sample; 2:1 ^#After absorption peak protein sample purifying; 3:2 ^#The absorption peak protein sample; 4:2 ^#After absorption peak protein sample purifying;

Figure 13 is the rhTNFR-Fc protein SDS-PAGE analysis chart that also concentrates after purifying in different batches silkworm hemolymph; M: the non-molecular weight of albumen standard of dying in advance; 1: benefit match general (contrast); 2-4: the albumen after the different batches purifying also concentrates;

Figure 14 is rhTNFR-Fc fusion rotein one-level mass spectrum figure as a result;

Figure 15 A is rhTNFR-Fc fusion rotein second order ms one of figure as a result;

Figure 15 B be rhTNFR-Fc fusion rotein second order ms as a result figure two;

Figure 16 is rhTNFR-Fc protein signal peptide analysis chart.

Embodiment

Be noted that following illustrating is all exemplary, be intended to the invention provides further invention.Except as otherwise noted, all Science and Technology terms used herein have the identical meanings of usually understanding with the technical field of the invention personnel.

Describe particular content of the present invention in detail below in conjunction with embodiment.

Embodiment 1: goal gene RhTNFR-FcAcquisition

According to recombinant plasmid pUC57- RhTNFR-FcIn RhTNFR-FcThe ORF frame of gene (Tianjin professor Cai Shenghe of stone bridge biotechnology limited liability company provide) (is 1473 bp, 489 amino-acid residues of encoding) design upstream primer SEQ ID NO:3 and the downstream primer SEQ ID NO:4 of this gene, upstream primer is introduced EcoR I restriction enzyme site, downstream primer is introduced XhoThe I restriction enzyme site carries out pcr amplification, obtains antigen-4 fusion protein gene RhTNFR-Fc(seeing Fig. 1), its nucleotide sequence is as shown in SEQ ID NO:1.Specific procedure and reaction system are as follows:

Response procedures:

Reaction system:

The PCR product is used EcoR I, XhoAfter I (all available from Invitrogen company) carried out double digestion, rubber tapping was reclaimed for future use.

Embodiment 2: recombinant transfer vector pFastBac1- RhTNFR-FcStructure

To embodiment 1 gained RhTNFR-FcAntigen-4 fusion protein gene PCR reclaims fragment and uses EcoRThe I enzyme and XhoI enzyme (Fermentas company) carries out double digestion, and agarose gel electrophoresis reclaims enzyme and cuts rear fragment; Use simultaneously EcoR I enzyme and XhoThe I enzyme carries out to pFastBac1 (Invitrogen company) that enzyme is cut and reclaims enzyme with agarose gel electrophoresis and cut rear fragment; Then use on the transfer vector pFastBac1 after T4 ligase enzyme (Fermentas company) is connected to the antigen-4 fusion protein gene that reclaims enzyme and cuts, transform Trans10Chemoreception attitude cell (Beijing Quanshijin Biotechnology Co., Ltd), screening positive clone obtains recombinant transfer vector pFastBac1- RhTNFR-Fc(seeing Fig. 2, Fig. 3) carries out gene sequencing (Fig. 4) to it, melts as can be known albumen by sequencing result and closes gene and successfully be cloned on transfer vector pFastBac1.

Embodiment 3: silkworm with recombinant baculovirus vBm- RhTNFR-FcObtain and identify

With the recombinant transfer plasmid pFastBac1-that obtains in embodiment 2 ( RhTNFR-Fc) conversion intestinal bacteria DH10Bac competent cells (available from Invitrogen company), carry out blue hickie screening on the LB solid culture plate (available from Invitrogen company) that contains kantlex, gentamicin, tsiklomitsin, X-gal and IPTG (sec.-propyl-β-D-sulfo-galactopyranoside) available from Bio Basic Inc company, picking list bacterium colony hickie after lucifuge cultivation 48 h, bacterium liquid dilution 10 after cultivation 16 h ⁶Again coated plate is done screening, after picking hickie to LB substratum shakes bacterium cultivation 16 h, with Virahol extracting recombinant baculovirus (Bacmid-in super clean bench RhTNFR-Fc) genome, identify whether swivel base success (Fig. 5) with the M13 universal primer PCR.

M13 upstream primer: 5 '-GTTTTCCCAGTCACGAC-3 '

M13 downstream primer: 5 '-CAGGAAACAGCTATGAC-3 '

Successful restructuring Bacmid-will be identified RhTNFR-FcMethod with reference to the Invitrogen lipofectamine Cellfectin of company II Reagent specification sheets, through liposome mediated-method transfection silkworm BmN cell (preserve in this laboratory), until this Bombyx noriN cell morbidity (microscopically observation) rear collection first-generation silkworm with recombinant baculovirus suspension and in 4 ℃ of preservations, extract viral genome with Viral DNA Kit (200) (available from OMEGA company), then carry out PCR with the M13 universal primer and identify.Gained is identified successful silkworm with recombinant baculovirus called after vBm- RhTNFR-Fc(seeing Fig. 6).

Embodiment 4: antigen-4 fusion protein gene RhTNFR-FcExpression in Bombyx noriN cell and evaluation

With the silkworm with recombinant baculovirus vBm-that obtains in embodiment 3 RhTNFR-FcIn silkworm BmN cell with the dosage transfection logarithmic phase of MOI=10 pfu/cell, cultivate 3～4 d for 27 ℃ in containing the Sf-900 II SFM substratum (available from Invitrogen company) of 10% foetal calf serum, after falling ill, 4 ℃, 500 rpm are centrifugal, and 10 min collect culture supernatant and precipitation.Cell precipitation is resuspended with the PBS washing of pH 7.4, mix with 2 * SDS sample-loading buffer, 60 ℃ of heating 30 min, carry out the SDS-PAGE protein electrophoresis, analyze with the anti-Western Blotting that carries out of the mouse-anti sheep IgG (H+L) two of goat anti-human igg-Fc primary antibodie, horseradish enzyme labelling, result shows antigen-4 fusion protein gene RhTNFR-FcSuccessful expression in Bombyx noriN cell (seeing Fig. 7 A, Fig. 7 B).

Adopt simultaneously mouse-anti human IgG Fc primary antibodie, the anti-immunofluorescence experiment that carries out of iF555 sheep anti-mouse igg (FITC mark) two.With LEIVA TCS SP51 laser confocal microscope, get respectively light field, UV exciting light, 543 nm exciting lights, UV exciting light and 543 nm exciting lights stacks (equal 100 times of visuals field) observation and take pictures.Result has also been verified antigen-4 fusion protein gene RhTNFR-FcSuccessful expression in Bombyx noriN cell (Fig. 8).

Embodiment 5: antigen-4 fusion protein gene RhTNFR-FcExpression in the silkworm five-age larva and evaluation

With the silkworm with recombinant baculovirus vBm-after embodiment 4 amplifications RhTNFR-FcF4 generation the silkworm five-age larva (three of Xiuqian City, Jiangsu tree seed station) after belly joint second from the bottom place percutaneous puncture-inoculation molting, typical virus infection symptom appearred in most of larva in the 5th day, cut the larva abdominal foot and collect the silkworm hemolymph, add 0.5% (w/v) antioxidant 8-hydroxy-quinoline ,-80 ℃ save backup.

Get 10 centrifugal 10 min of mL silkworm hemolymph 12,000 rpm.Get respectively cleer and peaceful precipitation, add 2 * loading buffer, 60 ℃ of metal bath 30 min make protein sample, carry out SDS-PAGE and Western Blotting evaluation with normal silkworm hemolymph as negative control.Result shows, antigen-4 fusion protein gene RhTNFR-FcObtained successful expression (seeing Fig. 9 A, Fig. 9 B) in the silkworm larva hemolymph.

Embodiment 6: the purifying of rhTNFR-Fc fusion rotein in silkworm five-age larva hemolymph

Pre-treatment: the silkworm hemolymph that takes out in embodiment 5 is placed in thawing on ice, until completely dissolved, adds the PBS solution (pH7.4) of precooling by the volume ratio of 1:1; In 4 ℃, 15,000 g, centrifugal 30 min, 9 layers of hospital gauze filter removes lipid material, leaves and takes filtrate, again in 4 ℃, 15,000 g, centrifugal 30 min, 9 layers of hospital gauze filter, three times repeatedly; After the dilution of the PBS solution (pH7.4) of filtrate precooling, carry out ultrafiltration to remove partial pigment, the collection effluent liquid with the film bag of 0.1 μ m; With effluent liquid transfer to hold back in 10 kDa super filter tubes concentrated.

The gel permeation chromatography purifying: as moving phase, rinse AKTAexplorer protein purification system and loading ring with PBS, after 30 min, OD ₂₈₀The detection baseline switches to Superdex after washing and putting down ^TM200 chromatography column positions, with the flow velocity balance pillar of 1.5 mL/min, alarm pressure is 0.5 Mpa; Draw the 2 pretreated concentrated solutions of mL with 2.5 ml syringes, after removing bubble, manual loading, setting program brings into operation, and flow velocity is adjusted into 1 mL/min; Be plugged collection tube, automatically collect peak (seeing Figure 10) by pipe; Albumen to 5 corresponding collection tubes of peak point on Figure 10 prepares the albumen sample with 2 * loading buffer, carries out SDS-PAGE detection and Western Blotting and analyzes (seeing Figure 11 A, Figure 11 B).

RProtein A affinitive layer purification: get appropriate Protein A filler, the void column of packing into is with balance liquid (the PBS solution of pH 7.4) the balance chromatography column of 10 times of column volumes; According to the peak figure (seeing Figure 10) after the gel permeation chromatography purifying and Western Blotting (seeing Figure 11 B) analytical results, with 1 ^#With 2 ^#And near a few pipe samples merge respectively, after adjusting pH and ionic concn, slowly add chromatography column; Incubated at room 10 min, loading is 3 times repeatedly; The foreign protein of the washings with 10 times more than column volume (the PBS solution of pH 7.4) washing non-specific binding detects without albumen to effluent liquid; Add the glycine (pH3.0) of 2 times of column volumes, collect elutriant, triplicate after standing 5 minutes; After collecting elutriant, use immediately Tris damping fluid (pH8.0) neutralization of 2/5 washings volume, use Millipore albumen evaporating pipe to switch to the PBS damping fluid; Add 0.02% NaN ₃, after carrying out the BCA protein quantification ,-80 ℃ of preservations; Get respectively before 25 μ L purifying and purifying after albumen and 2 * loading buffer mix, 60 ℃ are boiled half an hour, with the preparation protein sample, carry out that SDS-PAGE detects and Western Blotting analysis (seeing Figure 12 A, Figure 12 B).

Embodiment 7: the mass spectroscopy of rhTNFR-Fc fusion rotein after purifying

The target protein sample that purifying in three crowdes of embodiment 6 is obtained, after concentrating with the super filter tube of 10 kDa, compare with benefit match general (Shanghai CP Guojian Pharmaceutical Co.,Ltd.), mix with 2 * loading buffer respectively, 60 ℃ are boiled half an hour, with the preparation protein sample, carry out SDS-PAGE and identify (seeing Figure 13).Learn after the BCA protein quantification, we obtain fusion rotein 60 mg by purifying from 350 mL morbidity silkworm hemolymphs, and the average content that calculates fusion rotein in the silkworm hemolymph is 0.17 mg/mL.Discovery always has a band between 35 kDa on pvdf membrane and 45 kDa, rear Mass Spectrometric Identification result is the Fc section of the IgG of degraded.

Cut off the purpose band with clean blade from SDS-PAGE glue, deionized water cleans twice gently, put into clean EP pipe, carry out mark, deliver to biotech company of institute of Taida of Nankai University and carry out MALDI-TOF-MS analysis (seeing Figure 14, Figure 15 A and Figure 15 B), be standard of perfection according to protein score C.I.% greater than 95%, the score value of the Fc section of two known fusion rotein fragment TNFR 75 and IgG is respectively 99.994% and 100%, the albumen that can substantially determine purifying is the purpose fusion rotein, and its aminoacid sequence is as shown in SEQ ID NO:2.

The bioinformatic analysis result shows (seeing Figure 16), has the signal peptide that 22 amino-acid residues form.After removing signal peptide, gene fragment 1407 bp, 467 amino-acid residues of encoding, predicted molecular weight is 51.238 kDa.The fusion rotein dimer that fusion rotein rhTNFR-Fc is made of the extracellular region of people's 75 kDa TNF α receptor proteins and human IgG1's Fc section, by 934 Amino acid profiles, every peptide chain contains 467 amino acid, article 2, polypeptide chain forms disulfide linkage by cysteine residues and the dimer such as becomes, and relative molecular weight is 150 kDa.The fusion rotein rhTNFR-Fc that expresses in baculovirus expression vector system shows on SDS PAGE glue and pvdf membrane, and monomer is slightly larger than predicted molecular weight 51.238 kDa all at 55kDa, and gel permeation chromatography peak figure shows, 1 ^#With 2 ^#Peak albumen size is about 148 about kDa, and these results show, the fusion rotein rhTNFR-Fc that expresses in baculovirus expression vector system exists mainly with dimeric forms, and may have the posttranslational modification such as glycosylation.

The above is only embodiments of the invention, should be understood that; for the those of ordinary skill in present technique; under the prerequisite that does not break away from core technology feature of the present invention, can also do some improvements and modifications, these retouchings and improvement also should belong to scope of patent protection of the present invention.

SEQUENCE LISTING

＜110〉Tianjin Yaoyu Biotechnology Co., Ltd.

＜120〉silkworm with recombinant baculovirus of expression recombinant human tumor necrosis factor acceptor-Fc antigen-4 fusion protein gene and preparation method thereof

<130> 122503-I-CP-TJYU

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1473

<212> DNA

＜213〉recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene

<400> 1

atggcctccaggctgaccctgctgaccctcctgctgctgctgctggctggggatagagcctcctcattgcccgcccaggtggcatttacaccctacgccccggagcccgggagcacatgccggctcagagaatactatgaccagacagctcagatgtgctgcagcaaatgctcgccgggccaacatgcaaaagtcttctgtaccaagacctcggacaccgtgtgtgactcctgtgaggacagcacatacacccagctctggaactgggttcccgagtgcttgagctgtggctcccgctgtagctctgaccaggtggaaactcaagcctgcactcgggaacagaaccgcatctgcacctgcaggcccggctggtactgcgcgctgagcaagcaggaggggtgccggctgtgcgcgccgctgcgcaagtgccgcccgggcttcggcgtggccagaccaggaactgaaacatcagacgtggtgtgcaagccctgtgccccggggacgttctccaacacgacttcatccacggatatttgcaggccccaccagatctgtaacgtggtggccatccctgggaatgcaagcatggatgcagtctgcacgtccacgtcccccacccggagtatggccccaggggcagtacacttaccccagccagtgtccacacgatcccaacacacgcagccaactccagaacccagcactgctccaagcacctccttcctgctcccaatgggccccagccccccagctgaagggagcactggcgacgaacctaagtcctgcgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcacgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatgatga

<210> 2

<211> 489

<212> PRT

＜213〉recombinant human tumor necrosis factor's acceptor-Fc fusion rotein

<400> 2

Met Ala Ser Arg Leu Thr Leu Leu Thr Leu Leu Leu Leu Leu Leu

1 5 10 15

Ala Gly Asp Arg Ala Ser Ser Leu Pro Ala Gln Val Ala Phe Thr

20 25 30

Pro Tyr Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr

35 40 45

Tyr Asp Gln Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly

50 55 60

Gln His Ala Lys Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys

65 70 75

Asp Ser Cys Glu Asp Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val

80 85 90

Pro Glu Cys Leu Ser Cys Gly Ser Arg Cys Ser Ser Asp Gln Val

95 100 105

Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg Ile Cys Thr Cys

110 115 120

Arg Pro Gly Trp Tyr Cys Ala Leu Ser Lys Gln Glu Gly Cys Arg

125 130 135

Leu Cys Ala Pro Leu Arg Lys Cys Arg Pro Gly Phe Gly Val Ala

140 145 150

Arg Pro Gly Thr Glu Thr Ser Asp Val Val Cys Lys Pro Cys Ala

155 160 165

Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp Ile Cys Arg

170 175 180

Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly Asn Ala Ser

185 190 195

Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser Met Ala

200 205 210

Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser Gln

215 220 225

His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser

230 235 240

Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr

245 250 255

Gly Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro

260 265 270

Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe

275 280 285

Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu

290 295 300

Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val

305 310 315

Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys

320 325 330

Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val

335 340 345

Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu

350 355 360

Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

365 370 375

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

380 385 390

Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val

395 400 405

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala

410 415 420

Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

425 430 435

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

440 445 450

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe

455 460 465

Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln

470 475 480

Lys Ser Leu Ser Leu Ser Pro Gly Lys ter ter

485 489

<210> 3

<211> 26

<212> DNA

＜213〉primer

<400> 3

TGCGAATTCATGGCCTCCAGGCTGAC

26

<210> 4

<211> 21

<212> DNA

＜213〉primer

<400> 4

ACGCTCGAGTCATCATTTACC

21

Claims (9)

1. a silkworm with recombinant baculovirus of expressing recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene, is characterized in that, this virus contains recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene.

2. silkworm with recombinant baculovirus as claimed in claim 1, is characterized in that, the nucleotide sequence of described recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene is as shown in SEQ ID NO:1.

3. the preparation method of claim 1 or 2 a described silkworm with recombinant baculovirus, is characterized in that, the method comprises the following steps:

(1) recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene is synthetic;

(2) the recombinant human tumor necrosis factor's acceptor that step (1) is synthesized-Fc antigen-4 fusion protein gene is connected on transfer vector, and the transformed competence colibacillus cell, builds recombinant transfer vector;

(3) recombinant transfer vector that step (2) is built transforms intestinal bacteria DH10Bac competent cell, obtains recombinant baculovirus DNA;

(4) the recombinant baculovirus DNA transfection bombyx mori cell that step (3) is obtained obtains silkworm with recombinant baculovirus.

4. method as claimed in claim 3, is characterized in that, described step (1) specifically comprises:

Adopt pUC57- RhTNFR-FcRecombinant vectors is template, carries out pcr amplification take SEQ ID NO:3 and SEQ ID NO:4 as primer, obtains recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene RhTNFR-Fc

5. method as claimed in claim 3, is characterized in that, described step (2) specifically comprises:

Recombinant human tumor necrosis factor's acceptor that pcr amplification is obtained-Fc antigen-4 fusion protein gene is used EcoThe R I and XhoReclaim after the I double digestion, by being connected on the transfer vector pFastBac1 of same processing with the T4 ligase enzyme, recombinant human tumor necrosis factor's acceptor-Fc antigen-4 fusion protein gene is positioned under the control of polyhedrosis gene promotor, then be transformed into Trans10In chemoreception attitude cell, screening positive clone obtains recombinant transfer vector pFastBac1- RhTNFR-Fc

6. method as claimed in claim 3, is characterized in that, described step (3) specifically comprises:

The recombinant transfer vector pFastBac1-that step (2) is obtained RhTNFR-FcTransform intestinal bacteria DH10Bac competent cell, containing picking hickie after on the LB culture plate of kantlex, gentamicin, tsiklomitsin, X-gal and IPTG, lucifuge is cultivated 40-48 h, cultivate bacterium liquid dilution 10 after 16-20 h ⁶Again coated plate is done screening, after picking hickie to LB liquid nutrient medium shakes bacterium cultivation 16-20 h, with Virahol extracting recombinant baculovirus DNA, and is PCR with the M13 universal primer and identifies.

7. method as claimed in claim 3, is characterized in that, described step (4) specifically comprises:

Get step (3) and identify that successful recombinant baculovirus DNA is by liposome mediated-method transfection Bombyx noriN cell, obtain zero after morbidity for viral suspension 0-4 ℃ preservation, extract viral genome and carry out the PCR evaluation with the M13 universal primer, obtain silkworm with recombinant baculovirus vBm- RhTNFR-Fc

8. the described silkworm with recombinant baculovirus of a claim 1 fusion rotein of expressing, its aminoacid sequence is as shown in SEQ ID NO:2.

9. the preparation method of the described fusion rotein of claim 8, is characterized in that, the method comprises the following steps:

(1) the arbitrary described infecting silkworm with recombinant baculovirus Bombyx noriN cell of claim 1-2 is carried out virus amplification, and do the evaluation of expression product in cell;

(2) F4 that amplification in step (1) is obtained with stab inoculation inoculation silkworm five-age larva, collects morbidity silkworm blood for virus;

(3) be purified into the described fusion rotein of claim 8 from the silkworm blood that step (2) is collected.

Images