CN113045638B - Saccharomyces cerevisiae expression long-acting recombinant human fibroin and application thereof - Google Patents

Abstract

The invention discloses a saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein and application thereof, wherein the nucleotide sequence of the long-acting recombinant human silk polyprotein is shown as Seq ID No.1, and the amino acid sequence corresponding to the nucleotide sequence of the long-acting recombinant human silk polyprotein is shown as Seq ID No. 2. The amino acid sequence of the long-acting recombinant human filaggrin comprises an amino acid sequence of the filaggrin and an amino acid sequence of human serum albumin, and the amino acid sequence of the filaggrin comprises an amino acid sequence corresponding to a monomer structure at the C end of a repeating unit of a nucleotide sequence of the filaggrin. The long-acting recombinant human silk polyprotein provided by the invention can promote aggregation of keratin intermediate filaments and formation of disulfide bonds between the intermediate filaments, prevent loss of epidermal water and invasion of external allergic substances, and reduce sensitivity of ultraviolet-induced epidermal cell apoptosis. The fusion HAS effectively improves the stability of the recombinant protein.

Description

Saccharomyces cerevisiae expression long-acting recombinant human fibroin and application thereof

Technical Field

The invention relates to the field of emerging biomedicine, in particular to a saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein, a saccharomyces cerevisiae signal peptide recombinant plasmid, a saccharomyces cerevisiae secretion expression vector, a saccharomyces cerevisiae auxotrophic strain and application of the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein in moisturizing cosmetics.

Background

Filaggrin (FLG), also known as intermediate filaggrin, has a relative molecular mass of about 35000 and is mainly present in the stratum corneum and stratum lucidum. Its precursor profilaggrin is a highly phosphorylated, histidine-rich, water-insoluble and inactive polypeptide with a relative molecular mass of about 435000. The coding gene FLG of the filaggrin is positioned in an epidermal differentiation complex, the initial end of the molecule is an N-terminal region, the N-terminal region is provided with a calcium binding structure and a nuclear positioning element, 10-12 almost identical FLG monomer structures are arranged behind the N-terminal region, the repeated structure has a keratin binding property, and the tail end of the repeated structure is a C-terminal (shown in a combined figure 2). Filaggrin and degradation products and derivatives thereof are natural moisturizing factors of the skin, play a key role in maintaining the normal pH value of the skin, regulating the activity of protease, the permeability of an epidermal barrier and the defense function of the skin to microorganisms, and are very important for maintaining the hydration of the horny layer.

Human serum albumin (HAS) is a main protein in Human blood, consists of 585 amino acids, is a soluble protein with the highest content in a Human circulatory system, and HAS the concentration of 34-54 g/L in blood. HSA is synthesized by the liver, and the serum half-life period is long and can reach 19 days. HSA plays an important role in regulating blood osmotic pressure, nourishing, promoting wound healing and the like, and is widely used for clinical treatment of ascites due to cirrhosis, burns, shock and the like. In addition, HSA has the characteristics of no immunogenicity, good human compatibility, wide tissue distribution, no enzyme activity and the like, so that HSA becomes an ideal recombinant protein fusion vector. The molecular weight of the recombinant protein can be increased by constructing a fusion protein technology, so that the half-life period is prolonged, and the stability of the recombinant protein is effectively improved.

At present, FLG gene engineering expression mainly selects FLG monomer structural domains for expression or combined expression so as to obtain recombinant FLG with different functions. According to different expression vectors and host bacteria, the expression method is mainly divided into prokaryotic expression and eukaryotic expression. Although the prokaryotic expression system has low cost, the system has the defects of easy formation of inclusion bodies, low biological activity of the obtained protein and the like, and the target protein with high activity can be obtained by utilizing the eukaryotic expression system to carry out exogenous expression.

In the prior art, the expression product of the human filaggrin expressed by escherichia coli can be purified and utilized, the production cost is higher, and the prokaryotic expression system has the defects of easy formation of inclusion bodies, lower biological activity of the obtained recombinant human filaggrin and the like. The human filaggrin expressed by pichia pastoris contains harmful methanol components in the expressed supernatant, and the cost for removing methanol is higher, so the popularization and the use are difficult.

Disclosure of Invention

Aiming at overcoming the defects of complex process, high cost and limited popularization and application of the natural purified human fibroin; the invention provides a saccharomyces cerevisiae expression long-acting recombinant human filaggrin, a saccharomyces cerevisiae signal peptide recombinant plasmid, a saccharomyces cerevisiae secretion expression vector, a saccharomyces cerevisiae auxotrophic strain and application of the saccharomyces cerevisiae expression long-acting recombinant human filaggrin in moisturizing cosmetics.

The invention is realized by adopting the following technical scheme: a long-acting recombinant human silk poly-protein expressed by saccharomyces cerevisiae has the nucleotide sequence shown in Seq ID No. 1.

As an improvement of the technical scheme in the previous step, the amino acid sequence corresponding to the nucleotide sequence of the long-acting recombinant human silk fibroin is shown as Seq ID No. 2.

Furthermore, the amino acid sequence of the long-acting recombinant human filaggrin comprises the amino acid sequence of the filaggrin and the amino acid sequence of human serum albumin; the amino acid sequence of the silk fibroin comprises an amino acid sequence corresponding to a monomer structure at the C terminal of the repeating unit of the silk fibroin nucleotide sequence.

The invention also provides a saccharomyces cerevisiae signal peptide recombinant plasmid which adopts any one of the genes of the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein.

As an improvement of the technical scheme in the previous step, the construction of the saccharomyces cerevisiae signal peptide recombinant plasmid comprises the following operation steps:

firstly, designing a synthetic primer according to a sequence of a saccharomyces cerevisiae Mf alpha gene, wherein the synthetic primer comprises a forward primer Mf alpha-F and a reverse primer Mf alpha-R;

secondly, amplifying a signal peptide Mf alpha gene in the yeast through RT-PCR to obtain an RT-PCR amplification product, and then recovering the RT-PCR amplification product through glue to obtain a glue recovery product;

then, carrying out double enzyme digestion on the gel recovery product and the empty plasmid pYES2/CT, and then carrying out gel recovery to obtain a secretion signal peptide fragment Mf alpha and a vector fragment pYES 2/CT;

then, the secretion signal peptide fragment Mf α and the vector fragment pYES2/CT were ligated.

Further, forward primer Mf α -F is shown in Seq ID No.3, and reverse primer Mf α -R is shown in Seq ID No. 4.

The invention also provides a saccharomyces cerevisiae secretion expression vector which contains the gene of the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein.

The invention also provides a saccharomyces cerevisiae auxotrophic strain, which contains the gene of the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein.

As an improvement of the technical scheme in the previous step, the preparation and transformation of the saccharomyces cerevisiae auxotrophic strain comprise the following steps:

the method comprises the following steps: preparing a common solution and a culture medium for a saccharomyces cerevisiae expression system;

step two: the recombinant plasmid containing the long-acting recombinant human filaggrin gene expressed by the saccharomyces cerevisiae is used for transforming the saccharomyces cerevisiae.

The invention also provides application of the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein in moisturizing cosmetics, wherein the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein is adopted.

The invention has the beneficial effects that:

1. the invention utilizes the long-acting recombinant human silk polyprotein (hFLG-HSA protein) expressed by saccharomyces cerevisiae as a recombinant protein formed by fusing a monomer structure at the C end of a natural human FLG repeating unit and HSA, and the recombinant human silk polyprotein can promote the aggregation of keratin intermediate filaments and the formation of disulfide bonds between the intermediate filaments, prevent the loss of epidermal water and the invasion of external allergic substances and reduce the sensitivity of epidermal cell apoptosis induced by ultraviolet rays. The fusion HAS effectively improves the stability of the recombinant protein.

2. The long-acting recombinant protein prepared by the invention performs fusion expression on the human filaggrin and the human serum albumin, has better uniformity and stability and better recovery rate, and can obviously reduce the production cost. And the saccharomyces cerevisiae secretion expression system is used for carrying out exogenous expression on the human filaggrin, the high-level expression protein can be secreted into a culture medium, and the product has the advantages of simple production process, low cost, uniform product and no immunogenicity.

Drawings

FIG. 1 is a flow chart of a method for obtaining long-acting recombinant human filaggrin.

FIG. 2 is a schematic representation of the filaggrin domain.

FIG. 3 is a graph showing the results of determination of moisture content of epidermis using long-acting recombinant human silk fibroin.

FIG. 4 is a schematic diagram showing the results of SDS-PAGE identification of purified recombinant human silk fibroin, which is divided into three groups, group M, group 1 and group 2. Wherein, the group M is the SDS-PAGE identification result of Markers, the group 1 is the SDS-PAGE identification result of a saccharomyces cerevisiae signal peptide recombinant plasmid (pYES2/CT-MF alpha vector) as a contrast, and the group 2 is the SDS-PAGE identification result of the purified hFLG-HSA protein.

FIG. 5 is a schematic diagram showing the results of Westernblot identifying the purified recombinant hFLG-HSA protein, which is divided into two groups, group M and group 1. Group M is the Westernblot identification result of Markers, and group 1 is the Westernblot identification result of the purified hFLG-HSA protein.

Sequence listing description (sequence listing content provided separately)

Seq ID No.1 shows the nucleotide sequence of the long-acting recombinant human silk fibroin expressed by saccharomyces cerevisiae in the embodiment of the invention.

Seq ID No.2 shows the amino acid sequence of the long-acting recombinant human filaggrin expressed by the saccharomyces cerevisiae in the embodiment of the invention.

Seq ID No.3 shows the nucleotide sequence of the forward primer Mf α -F in the examples of the present invention.

Seq ID No.4 shows the nucleotide sequence of the reverse primer Mf α -R in the examples of the present invention.

Seq ID No.5 shows the nucleotide sequence of the reverse primer hFLG-HSA-R in the examples of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Example 1

The embodiment discloses a saccharomyces cerevisiae expression long-acting recombinant human fibroin. The long-acting recombinant human filaggrin is a recombinant protein formed by fusing a monomer structure at the C end of a natural human FLG repeating unit and HSA, and the recombinant protein can prevent the loss of epidermal water. The recombinant protein is obtained by fusing the hFLG truncated protein with the HSA protein, so that the stability of the recombinant protein is effectively improved, the production process is simple, the cost is low, the product is uniform, and the immunogenicity is avoided.

The nucleotide sequence of the long-acting recombinant human filaggrin is shown as Seq ID No.1, and the amino acid sequence corresponding to the nucleotide sequence of the long-acting recombinant human filaggrin is shown as Seq ID No. 2.

The amino acid sequence of the long-acting recombinant human filaggrin comprises the amino acid sequence of the filaggrin and the amino acid sequence of human serum albumin; the amino acid sequence of the silk fibroin comprises an amino acid sequence corresponding to a monomer structure at the C terminal of the repeating unit of the silk fibroin nucleotide sequence.

In this example, the long-acting recombinant human filaggrin was obtained by artificial optimization of human filaggrin and human serum albumin. According to the amino acid sequences of the filaggrin and the human serum albumin and the preference of the saccharomyces cerevisiae to codons, a saccharomyces cerevisiae preferred hFLG-HSA gene (namely the gene of the long-acting recombinant human filaggrin) is artificially designed, and the nucleotide sequence of the gene is as follows:

note:GGATCCis a BamHI enzyme cutting site,TCTAGAxba I restriction site;ATGis a start codon for the gene encoding the polypeptide,

is a stop codon;GCAGAGGCGGCGGCTAAGGAAGCTGCAGCCAAAGCCa base sequence corresponding to a Linker connecting FLG and HSA sequences;CATCACCATCACCATCACis a 6 × His tagAnd (4) sequencing.

The nucleotide sequence of the saccharomyces cerevisiae preference type hFLG-HSA gene corresponds to an amino acid sequence as follows:

MDSSRHSQSGQGESAGSRRSRRQGSSVSQDSDSEAYPEDSERRSESASRNHHGSSREQSRDGSRHPGSAEAAAKEAAAKAMKWVTFISLLFLFSSAYSRGVFRRDAHKSEVAHRFKDLGEENFKALVLIAFAQYLQQCPFEDHVKLVNEVTEFAKTCVADESAENCDKSLHTLFGDKLCTVATLRETYGEMADCCAKQEPERNECFLQHKDDNPNLPRLVRPEVDVMCTAFHDNEETFLKKYLYEIARRHPYFYAPELLFFAKRYKAAFTECCQAADKAACLLPKLDELRDEGKASSAKQRLKCASLQKFGERAFKAWAVARLSQRFPKAEFAEVSKLVTDLTKVHTECCHGDLLECADDRADLAKYICENQDSISSKLKECCEKPLLEKSHCIAEVENDEMPADLPSLAADFVESKDVCKNYAEAKDVFLGMFLYEYARRHPDYSVVLLLRLAKTYETTLEKCCAAADPHECYAKVFDEFKPLVEEPQNLIKQNCELFEQLGEYKFQNALLVRYTKKVPQVSTPTLVEVSRNLGKVGSKCCKHPEAKRMPCAEDYLSVVLNQLCVLHEKTPVSDRVTKCCTESLVNRRPCFSALEVDETYVPKEFNAETFTFHADICTLSEKERQIKKQTALVELVKHKPKATKEQLKAVMDDFAAFVEKCCKADDKETCFAEEGKKLVAASQAALGLHHHHHH。

the two sequences are inserted between a BamHI enzyme cutting site and an XbaI enzyme cutting site of pMD19-T Simple Vector in sequence of hFLG-HSA, the 5 'end of the sequence is connected with the BamHI enzyme cutting site, and the 3' end of the sequence is connected with the XbaI enzyme cutting site, so that the plasmid pMD19-T-hFLG-HSA is obtained, and the synthesis of pMD19-T-hFLG-HSA is carried out by the general biological system (Anhui) Limited company.

The recombinant human filaggrin can promote aggregation of keratin intermediate filaments and formation of disulfide bonds between the intermediate filaments, prevent loss of epidermal water and invasion of external allergic substances, and reduce sensitivity of ultraviolet-induced epidermal cell apoptosis. The fusion HAS effectively improves the stability of the recombinant protein.

Example 2

The embodiment discloses a saccharomyces cerevisiae signal peptide recombinant plasmid. The saccharomyces cerevisiae signal peptide recombinant plasmid adopts the saccharomyces cerevisiae expressed long-acting recombinant human fibroin gene described in the embodiment 1.

The construction of the saccharomyces cerevisiae signal peptide recombinant plasmid comprises the following operation steps:

firstly, a synthetic primer is designed according to the sequence of a saccharomyces cerevisiae Mf alpha gene, and the synthetic primer comprises a forward primer Mf alpha-F and a reverse primer Mf alpha-R. In this example, forward primer Mf α -F is shown in Seq ID No.3, and reverse primer Mf α -R is shown in Seq ID No. 4.

Secondly, a signal peptide Mf alpha gene in the yeast is amplified through RT-PCR to obtain an RT-PCR amplification product, and then the RT-PCR amplification product is recovered by glue to obtain a glue recovery product.

Then carrying out double enzyme digestion on the gel recovery product and the empty plasmid pYES2/CT, and then carrying out gel recovery to obtain a secretion signal peptide fragment Mf alpha and a vector fragment pYES 2/CT. Then, the secretion signal peptide fragment Mf alpha and the vector fragment pYES2/CT were ligated.

In the embodiment, the construction of the saccharomyces cerevisiae signal peptide recombinant plasmid pYES2/CT-Mf alpha specifically comprises the following operation steps:

a forward primer Mf alpha-F and a reverse primer Mf alpha-R are designed and synthesized according to the sequence (Z73543) of the saccharomyces cerevisiae Mf alpha gene.

Forward primer Mf α -F: GG (GG)GGTACCAAAAAAATGAGATTTCCTTCT (among them)GGTACCThe restriction enzyme site Kpn I),

reverse primer Mf α -R: CG (CG)GGATCCTCTTTTATCCAAAGAAACACCT (among them)GGATCCBamH I) as a cleavage site, a primer was synthesized by general biosystems (Anhui) Ltd. Amplifying a signal peptide Mf alpha gene in INVSC1 yeast by RT-PCR, wherein a reaction system of RT-PCR amplification reaction is 2 XPCR Master Mix: Mf alpha-F: Mf alpha-R: Saccharomyces cerevisiae template: ddH₂Mixing the Total Volume according to the following proportion: 12.5. mu.l, 1. mu.l, 2. mu.l, 8.5. mu.l, 25. mu.l. The reaction system is specifically as follows:

RT-PCR reaction procedure: 5rain is pre-denatured at 94 ℃; at 94 ℃ for 50s, at 60 ℃ for 30s, at 72 ℃ for 30s, for 35 cycles; extension at 72 ℃ for 5 min. RT-PCR amplification products were detected by 2.0% agarose gel electrophoresis and gel recovery was performed according to the Qiagen gel recovery kit instructions.

Taking the recovered product of the gel and an empty plasmid pYES2/CT to perform double enzyme digestion respectively by using QuickCut Kpn I and QuickCut BamH I, wherein an enzyme digestion reaction system uses QuickCut Kpn I, QuickCut BamH I, 10 XQuickCut Green Buffer, pYES2/CT (or PCR product), ddH₂Mixing the Total Volume according to the following proportion: 2.0. mu.l, 5. mu.l, 15. mu.l, 26. mu.l, 50. mu.l. In this embodiment, the enzyme digestion reaction system specifically includes:

the reaction is carried out for 3h at 37 ℃ by metal bath digestion, the digestion products are respectively detected by 2 percent agarose gel electrophoresis, 255bp of secretion signal peptide fragments Mf alpha and 5.8Kb of vector fragments pYES2/CT are respectively recovered by gel cutting, and then T4DNA ligase is used for connection. The connection reaction system is as follows:

the reaction conditions are 16 ℃ and 14h, the recombinant plasmid is transformed into escherichia coli (DH5 alpha) by a conventional method (calcium chloride method), a positive clone is selected on an LB plate culture medium containing kanamycin, and is identified by bacterial liquid PCR and double enzyme digestion (QuickCut Kpn I and QuickCut BamH I), so that a positive clone pYES2/CT-Mf alpha is obtained, and a secretion signal peptide fragment of the positive clone is inserted between a Kpn I enzyme digestion site and a BamH I enzyme digestion site of the plasmid pYES 2/CT.

Example 3

The embodiment provides a saccharomyces cerevisiae secretion expression vector, which contains the gene of the saccharomyces cerevisiae expression long-acting recombinant human filaggrin described in the embodiment 1. The construction of the saccharomyces cerevisiae secretion expression vector pYES2/CT-Mf alpha-hFLG-HSA specifically comprises the following steps:

performing double enzyme digestion on the plasmid pYES2/CT-Mf alpha and the plasmid pMD19-T-hFLG-HSA by using endonuclease BamH I and endonuclease Xba I respectively, wherein the enzyme digestion reaction system is as follows:

performing metal bath enzyme digestion reaction at 37 ℃ for 3h, detecting the enzyme digestion product by 2% agarose gel electrophoresis, respectively cutting gel, recovering the hFLG-HSA gene fragment and pYES2/CT-Mf alpha vector, and then connecting by using T4DNA ligase. The connection reaction system is as follows:

the reaction was carried out at 16 ℃ for 14 hours, the recombinant plasmid was transformed into E.coli (DH 5. alpha.) by the conventional method (calcium chloride method), the positive clone was selected on LB plate medium containing kanamycin, and PCR was carried out on the resulting clone using bacterial liquid (forward primer: Mf. alpha. -F; reverse primer: hFLG-HSA-R: GC)TCTAGATTAGTGATGGTGATGGTGATGTAACCCTAA) and double enzyme digestion (BamHI and Xba I), selecting positive clone pYES2/CT-Mf alpha-hFLG-HSA and sending the positive clone to general biological system (Anhui) limited company for sequencing.

In the embodiment, the saccharomyces cerevisiae secretion expression system is used for carrying out exogenous expression on the human filaggrin, the high-level expression protein can be secreted into the culture medium, and the product has the advantages of simple production process, low cost, uniform product and no immunogenicity.

Example 4

This example provides a saccharomyces cerevisiae auxotrophic strain containing the gene for expression of long-acting recombinant human silk fibroin by saccharomyces cerevisiae as described in example 1. In the embodiment, the saccharomyces cerevisiae auxotrophic strain is used for carrying out exogenous expression on the human filaggrin, the high-level expression protein can be secreted into a culture medium, and the product has the advantages of simple production process, low cost, uniform product and no immunogenicity.

The saccharomyces cerevisiae auxotrophic strain in the embodiment is an engineering strain of the artificial hFLG-HSA fusion protein, and the preparation and transformation of the saccharomyces cerevisiae auxotrophic strain comprise the following steps:

the method comprises the following steps: the preparation of a common solution and a culture medium for a saccharomyces cerevisiae expression system specifically comprises the preparation of a YPD culture medium, an SC-U culture medium and an SC-U induction culture medium. Wherein, the preparation of the YPD culture medium, the SC-U culture medium and the SC-U induction culture medium respectively comprises the following operations:

YPD medium: dissolving peptone 20g, yeast extract 10g, and glucose 20g (20 g agar powder is added when preparing solid culture medium) in 800ml water, metering to 1L, and autoclaving for 20 min.

SC-U medium: 6.70g of yeast nitrogen-free extract, 0.15g of compound amino acid (if SC-U selective plate culture medium is prepared, 20g of agar powder is additionally added), 900ml of deionized water is added, autoclaving is carried out for 20min, 100ml of filtered and sterilized 20% glucose solution is added when the temperature is cooled to 50 ℃, and the mixture is uniformly mixed and stored at 4 ℃ for later use.

SC-U induction medium: 6.70g of yeast nitrogen-free extract, 0.15g of compound amino acid, 800ml of deionized water, autoclaving for 20min, cooling to 50 ℃, adding 100ml of filter-sterilized 20% glucose solution and 100ml of filter-sterilized 20% raffinose solution, mixing uniformly, and storing at 4 ℃ for later use.

Step two: the method comprises the following steps of transforming saccharomyces cerevisiae with recombinant plasmid (pYES2/CT-Mf alpha-hFLG-HSA) containing saccharomyces cerevisiae expression long-acting recombinant human filaggrin gene:

the first step is as follows: the plasmid pYES2/CT-Mf alpha-hFLG-HSA and pYES2/CT-Mf alpha are respectively transformed into Saccharomyces cerevisiae INVSC1 competent cells by adopting an electric transformation method. Mu.l of pYES2/CT-MF α -hFLG-HSA plasmid was added to 80. mu.l of Saccharomyces cerevisiae INVScl competent cells, well mixed by aspiration, and then transferred to a pre-cooled cuvette. Ice-bath for 5min, and wiping the outer wall of the electric shock cup.

The second step is that: the Bio-Rad electric converter was adjusted to the fungi range, PIC option, and the cuvette was placed on the Bio-Rad electric converter for electric shock. Add 500. mu.l of pre-chilled 1M sorbitol solution quickly to the cuvette, mix well and coat the SC-U plate. And (4) carrying out inverted culture at the constant temperature of 30 ℃ until a monoclonal antibody grows out.

The third step: grown in SC-U selection medium (containing ampicillin), were Saccharomyces cerevisiae transformants containing pYES2/CT-Mf α -hFLG-HSA and pYES2/CT-Mf α plasmids, and clones positive for INVSC1/pYES2/CT-Mf α -hFLG-HSA were screened by PCR (forward primer: Mf α -F as shown in Seq ID No. 3; reverse primer: hFLG-HSA-R as shown in Seq ID No. 5).

The rhFLG-HSA gene in the engineering bacteria prepared by the invention has the preference characteristic of saccharomyces cerevisiae, contains saccharomyces cerevisiae signal peptide, can make the rhFLG-HSA secrete and express, greatly improves the yield of an expression product, and has simple acquisition process and lower cost compared with an escherichia coli expression system and other beneficial bacteria secretion and expression systems.

Example 5

In order to verify that the INVSC1/pYES2/CT-Mf alpha-hFLG-HSA positive clone provided in example 4 can induce the production of long-acting recombinant human filaggrin, the present example provides shake flask culture, inducible expression and assay of a Saccharomyces cerevisiae auxotrophic strain, namely shake flask culture, inducible expression and assay of Saccharomyces cerevisiae engineering bacteria containing an artificial hFLG-HSA eukaryotic expression vector pYES2/CT-Mf alpha-hFLG-HSA, which specifically comprises the following operation steps:

the positive clones, INVSC1(pYES 2/CT-Mf. alpha. -hFLG-HSA) and INVSC1(pYES2/CT), were picked up in 30ml of liquid SC-U selection medium (containing 2% raffinose and ampicillin), incubated in the positive channel at 30 ℃ overnight, and OD was measured_{600 nm}Light absorption value, inoculating appropriate amount of culture solution into 100ml SC-U induction culture medium (containing 2% raffinose and ampicillin), and culturing overnight to make OD_{600 nm}Centrifuging at 4 ℃ for 5min at 1500g for 0.4, collecting thalli, suspending the thalli by using 1-2 ml of SC-U induction culture medium (containing 2% of raffinose and ampicillin), inoculating 100ml of SC-U induction culture medium (containing 2% of raffinose and ampicillin) again, placing the culture medium at 30 ℃ for shaking culture for 96h, centrifuging at 4 ℃ for 5min at 1500g, collecting thalli and supernatant, and filtering the supernatant subjected to induced expression by a 0.22 mu m filter membrane.

The column was self-packed using the GE Healthcare company chemical Sepharose TM Fast Flow Nickel ion chelate affinity chromatography packing, and the Ni was washed with 3 column volumes of purified water²⁺Chelating affinity chromatography column, then balancing 2-3 column volumes with Binding Buffer (pH8.0 PBS). Detecting the conductivity value and the absorption value of 280nm wavelength on line, starting to sample after the conductivity value and the absorption value of 280nm wavelength are both stable, setting the flow rate of the sample pumped through the chromatographic column to be 5-6 ml/min, washing off the foreign protein which is not combined with the chromatographic column until OD_{280 nm}And (4) stabilizing. Eluting with gradient imidazole concentration eluent (pH8.0PBS containing 100-300 mM imidazole), collecting protein corresponding to elution peak, and performing SDS-PAGE electrophoresis on the protein sample in the purification process to analyze purification effect.

The supernatant protein liquid obtained by induced expression and purification has obvious specific bands at about 76.6kDa after SDS-PAGE electrophoresis, while the induced expression supernatant of the saccharomyces cerevisiae strain containing pYES2/CT plasmid which is induced similarly has no specific bands (see figure 4), and the induced expression supernatant of the saccharomyces cerevisiae strain containing pYES2/CT-Mf alpha-hFLG-HSA plasmid identified by Westernblot using rabbit anti-FLG monoclonal antibody can have specific bands at about 76.6kDa (see figure 5), so that the saccharomyces cerevisiae engineering bacteria containing the eukaryotic expression vector pYES2/CT-Mf alpha-hFLG-HSA of the human filaggrin can generate recombinant human filaggrin and albumin fusion protein at about 76.6KD after raffinose induction.

Example 6

The embodiment provides application of saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein in moisturizing cosmetics, wherein the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein is contained in the saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein in the embodiment 1. To verify the skin moisturizing effect of the long-acting recombinant human silk fibroin provided in example 1, i.e., the skin moisturizing effect of the artificial hFLG-HSA fusion protein, the present example was verified by the following tests:

1. test grouping

Selecting 30 tested persons with the age of 20-40 years, randomly dividing the tested persons into 3 groups (5 persons for each group of men and women), a low-dose group (0.1mg/ml fusion protein supernatant), a high-dose group (0.5mg/ml fusion protein supernatant) and a control group (PBS pH7.4); the subject's skin was healthy with no history of skin allergy.

2. Test treatment

The test environment temperature is 25 deg.C, Relative Humidity (RH) is 61%, the part to be tested is exposed 10min before measurement, and the subject is allowed to stand still in the environment. The test areas were numbered by drawing out a 3.5cm × 3.5cm square on each of the left and right forearms, the left arm being the test area for applying the fusion protein supernatant, and the symmetrical area of the right arm being the test area for using the blank control product. Firstly, washing a tested part by using alkaline soap, and drying the washed part in the air. Prior to coating of the fusion protein, the stratum corneum moisture content of the tested sites was measured using a Comeometer CM 825 tester. More than 0.2ml of each group of fusion protein and PBS solution are applied to the tested part and evenly applied on the skin for 2 min. The moisture content of the stratum corneum (measured in a.u. units) was measured at 10min, 40min, 60min, 120min and 180min using a Comeometer CM 825 tester, i.e. 10 points were selected from the test area for measurement, and the average was recorded as the measurement at each time point.

3. Test results

As shown in FIG. 2, the moisture content of the epidermis of the skin is improved to different degrees after the low-dose fusion protein and the high-dose fusion protein are used, and particularly, the moisture content of the epidermis of a test group containing 0.5mg/ml fusion protein reaches the highest value at 40min, which is about 1.6 times of the moisture content of the epidermis of a control group, so that the hFLG-HSA fusion protein can obviously improve the moisture content of the skin after being used, and has a certain moisturizing effect on the skin.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> research institute of biological product industry, Inc. of Utafel, Utaki

Anhui Puruoting Biological Technology Co., Ltd.

<120> saccharomyces cerevisiae expression long-acting recombinant human silk polyprotein and application thereof

<141> 2021-04-01

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2088

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

atggattctt cccgtcatag ccaatctggt caaggtgaat ccgccggttc tcgtagatcc 60

agaagacaag gttcttcagt ttctcaagac tctgactctg aagcttaccc agaagattca 120

gaaagaagat ctgaatccgc cagtagaaac caccacggtt cctccagaga acaatccaga 180

gatggttcca gacacccagg tagcgcagag gcggcggcta aggaagctgc agccaaagcc 240

atgaagtggg ttacgtttat ctccctatta tttctgttct catccgccta ctccagaggt 300

gttttcagga gagatgctca caaatctgag gttgctcata gattcaagga tttgggtgaa 360

gaaaacttta aggccttagt gttaatagct ttcgcacaat acctgcaaca gtgtcctttt 420

gaagaccatg tcaaattagt taatgaagtc accgaatttg ctaagacgtg cgttgctgat 480

gagtctgccg aaaattgtga caaatcactg catacattgt tcggtgataa gctatgtacc 540

gttgcaactc ttagagaaac gtacggagag atggcggact gttgtgctaa acaagaacct 600

gaaagaaatg aatgtttttt gcaacacaaa gatgataatc caaacttgcc aagattggta 660

agaccagaag ttgacgttat gtgtaccgct tttcatgata atgaagaaac atttttgaaa 720

aagtatcttt atgaaatagc aaggaggcat ccttacttct acgctccaga gttattattt 780

tttgcaaaaa gatataaggc agcttttact gaatgttgtc aggctgcgga taaagccgca 840

tgtctgttac ccaaattgga tgaattgaga gacgagggca aagctagtag tgccaaacaa 900

agattaaaat gcgcttcatt acaaaaattt ggagaaagag cgtttaaggc ttgggccgta 960

gcaagattgt ctcagagatt cccgaaagcc gaatttgcag aagtgagtaa actggtcaca 1020

gatttgacga aagttcacac agaatgttgt cacggagatt tattggaatg cgctgacgat 1080

agggctgact tagctaaata catatgcgag aatcaagatt ccatatcatc aaaattgaaa 1140

gaatgttgtg agaaaccatt attagaaaaa tcccactgta tagctgaagt tgagaacgat 1200

gaaatgcccg cggatttacc ctcccttgcg gctgacttcg ttgagtcaaa ggatgtttgc 1260

aagaattacg cggaggccaa ggatgttttt cttggcatgt ttttatatga gtatgccaga 1320

cgtcatccgg attattctgt agttctactg ttaaggcttg ccaagacata cgaaactacc 1380

ttagaaaaat gttgtgcggc tgccgatcca catgaatgtt acgcaaaagt ttttgatgaa 1440

ttcaagccgc ttgtcgagga gccacaaaat ttaattaaac aaaactgtga attatttgaa 1500

caattaggtg aatataaatt ccaaaacgca ttattggtca gatatacaaa aaaagtacct 1560

caggtttcca caccaacttt agtggaagtg tcacgtaacc taggcaaggt tggtagtaag 1620

tgctgtaaac acccagaagc taagagaatg ccatgcgctg aagattatct atcagtcgta 1680

cttaatcaac tgtgtgtcct acacgagaag actcctgtca gtgacagagt gacaaaatgt 1740

tgcaccgaga gcttagttaa tagaagaccg tgtttttcag cgctggaagt tgatgaaacc 1800

tatgttccaa aggagttcaa tgcagaaaca ttcaccttcc atgctgatat atgtactctt 1860

agtgaaaaag aaaggcagat caaaaaacaa actgccctgg tcgaattagt caaacataaa 1920

cctaaagcaa cgaaggaaca gttgaaggcc gtaatggatg atttcgcagc tttcgttgaa 1980

aaatgttgca aggctgatga caaagagaca tgttttgctg aagagggaaa aaaattggtg 2040

gcagcttctc aagccgcttt agggttacat caccatcacc atcactaa 2088

<210> 2

<211> 695

<212> PRT

<213> Saccharomyces cerevisiae

<400> 2

Met Asp Ser Ser Arg His Ser Gln Ser Gly Gln Gly Glu Ser Ala Gly

1 5 10 15

Ser Arg Arg Ser Arg Arg Gln Gly Ser Ser Val Ser Gln Asp Ser Asp

20 25 30

Ser Glu Ala Tyr Pro Glu Asp Ser Glu Arg Arg Ser Glu Ser Ala Ser

35 40 45

Arg Asn His His Gly Ser Ser Arg Glu Gln Ser Arg Asp Gly Ser Arg

50 55 60

His Pro Gly Ser Ala Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Ala

65 70 75 80

Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala

85 90 95

Tyr Ser Arg Gly Val Phe Arg Arg Asp Ala His Lys Ser Glu Val Ala

100 105 110

His Arg Phe Lys Asp Leu Gly Glu Glu Asn Phe Lys Ala Leu Val Leu

115 120 125

Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val

130 135 140

Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr Cys Val Ala Asp

145 150 155 160

Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe Gly Asp

165 170 175

Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala

180 185 190

Asp Cys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Gln

195 200 205

His Lys Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val

210 215 220

Asp Val Met Cys Thr Ala Phe His Asp Asn Glu Glu Thr Phe Leu Lys

225 230 235 240

Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro

245 250 255

Glu Leu Leu Phe Phe Ala Lys Arg Tyr Lys Ala Ala Phe Thr Glu Cys

260 265 270

Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu Leu Pro Lys Leu Asp Glu

275 280 285

Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln Arg Leu Lys Cys

290 295 300

Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ala Val

305 310 315 320

Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser

325 330 335

Lys Leu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys His Gly

340 345 350

Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile

355 360 365

Cys Glu Asn Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys Cys Glu

370 375 380

Lys Pro Leu Leu Glu Lys Ser His Cys Ile Ala Glu Val Glu Asn Asp

385 390 395 400

Glu Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Phe Val Glu Ser

405 410 415

Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Phe Leu Gly

420 425 430

Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val

435 440 445

Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu Lys Cys

450 455 460

Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe Asp Glu

465 470 475 480

Phe Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys

485 490 495

Glu Leu Phe Glu Gln Leu Gly Glu Tyr Lys Phe Gln Asn Ala Leu Leu

500 505 510

Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val

515 520 525

Glu Val Ser Arg Asn Leu Gly Lys Val Gly Ser Lys Cys Cys Lys His

530 535 540

Pro Glu Ala Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser Val Val

545 550 555 560

Leu Asn Gln Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Asp Arg

565 570 575

Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe

580 585 590

Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Asn Ala

595 600 605

Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu

610 615 620

Arg Gln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Val Lys His Lys

625 630 635 640

Pro Lys Ala Thr Lys Glu Gln Leu Lys Ala Val Met Asp Asp Phe Ala

645 650 655

Ala Phe Val Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr Cys Phe

660 665 670

Ala Glu Glu Gly Lys Lys Leu Val Ala Ala Ser Gln Ala Ala Leu Gly

675 680 685

Leu His His His His His His

690 695

<210> 3

<211> 29

<212> DNA

<213> Saccharomyces cerevisiae

<400> 3

ggggtaccaa aaaaatgaga tttccttct 29

<210> 4

<211> 30

<212> DNA

<213> Saccharomyces cerevisiae

<400> 4

cgggatcctc ttttatccaa agaaacacct 30

<210> 5

<211> 38

<212> DNA

<213> Saccharomyces cerevisiae

<400> 5

gctctagatt agtgatggtg atggtgatgt aaccctaa 38

Claims (10)

1. A long-acting recombinant human silk polyprotein expressed by saccharomyces cerevisiae is characterized in that: the nucleotide sequence of the long-acting recombinant human silk polyprotein is shown in SEQ ID NO. 1.

2. The long-acting recombinant human silk poly-protein expressed by saccharomyces cerevisiae according to claim 1, wherein the amino acid sequence corresponding to the nucleotide sequence of the long-acting recombinant human silk poly-protein is shown as SEQ ID No. 2.

3. The long-acting recombinant human filaggrin expressed by saccharomyces cerevisiae of claim 2, wherein the amino acid sequence of the long-acting recombinant human filaggrin comprises the amino acid sequence of filaggrin and the amino acid sequence of human serum albumin; the amino acid sequence of the silk fibroin comprises an amino acid sequence corresponding to a monomer structure at the C terminal of the repeating unit of the silk fibroin nucleotide sequence.

4. A recombinant plasmid of Saccharomyces cerevisiae signal peptide, which is characterized in that it adopts the gene of long-acting recombinant human silk fibroin expressed by Saccharomyces cerevisiae according to any one of claims 1-2.

5. The recombinant plasmid of Saccharomyces cerevisiae signal peptide as claimed in claim 4, wherein the construction of the recombinant plasmid of Saccharomyces cerevisiae signal peptide comprises the following steps:

designing a synthetic primer according to a sequence of a saccharomyces cerevisiae Mf alpha gene, wherein the synthetic primer comprises a forward primer Mf alpha-F and a reverse primer Mf alpha-R;

amplifying a signal peptide Mf alpha gene in yeast by RT-PCR to obtain an RT-PCR amplification product, and then carrying out gel recovery on the RT-PCR amplification product to obtain a gel recovery product;

performing double enzyme digestion on the gel recovery product and the empty plasmid pYES2/CT, and then performing gel recovery to obtain a secretion signal peptide fragment Mf alpha and a vector fragment pYES 2/CT;

the secretion signal peptide fragment Mf alpha and the vector fragment pYES2/CT were ligated.

6. The recombinant plasmid of Saccharomyces cerevisiae signal peptide as claimed in claim 4, wherein the forward primer Mf α -F is represented by Seq ID No.3, and the reverse primer Mf α -R is represented by Seq ID No. 4.

7. A saccharomyces cerevisiae secretion expression vector comprising a gene of the long-acting recombinant human silk fibroin expressed by the saccharomyces cerevisiae according to any one of claims 1-2.

8. A Saccharomyces cerevisiae auxotrophic strain comprising a gene for the long-acting recombinant human silk fibroin expressed by the Saccharomyces cerevisiae according to any one of claims 1-2.

9. The saccharomyces cerevisiae auxotrophic strain of claim 8, wherein the preparation and transformation of the saccharomyces cerevisiae auxotrophic strain comprises the steps of:

the method comprises the following steps: preparing a common solution and a culture medium for a saccharomyces cerevisiae expression system;

step two: the recombinant plasmid containing the long-acting recombinant human filaggrin gene expressed by the saccharomyces cerevisiae is used for transforming the saccharomyces cerevisiae.

10. The use of long-acting recombinant human silk fibroin expressed by saccharomyces cerevisiae in moisturizing cosmetics is characterized in that the long-acting recombinant human silk fibroin expressed by saccharomyces cerevisiae according to any one of claims 1-2 is adopted.

Images