CN100579987C - Liver target fusion protein with siRNA guiding effect - Google Patents

Abstract

The present invention discloses one kind of liver targeting fusion protein with siRNA inducing capacity. The fusion protein consists of two parts, and has the 1st to the 274th amino acids of human tissue form plasminogen excitator in mature form in the N-end and the 1st to the 51st amino acids of human protamine in the C-end. The fusion protein has no liver affiliation basically irrelated htPA protease structure field part so as to avoid hemolysis risk and PAI inhibiting link. The relevant extracorporeal experiment shows that the htPA-hPRM1 fusion protein can target small interference RNA into liver cell.

Description

Fusion rotein a kind of novel liver target, that have the siRNA guiding effect

Technical field

The present invention relates to a kind of fusion rotein, relate in particular to fusion rotein a kind of liver target, that have siRNA (siRNA) guiding effect.

Background technology

(RNA interference RNAi) is the regulatory mechanism of a kind of inhibition of gene expression of existence in nematode, fruit bat, higher plant, the mammalian body in the RNA interference.When with certain gene order corresponding double chain RNA (double strand RN, when dsRNA) appearing in these biomass cellss, this dsRNA can be cut into the small molecules double-stranded RNA by intracellular Dicer enzyme, some albumen form reticent mixture (the RNA-inducedSilencing Complex of RNA inductive in these microRNAs and the cell, RISC), the messenger RNA(mRNA) of RISC and corresponding gene (messager RNA, mRNA) combination, cut off this mRNA, thereby cause downward modulation, the inhibition and even reticent fully of corresponding genetic expression.

1998, the effect that it is found that the double-stranded RNA inhibition of gene expression than strand sense-rna much better (Fire A, et al.Nature, 1998,391:806), disclose RNAi mechanism first.(the Elbashir SM of experiment subsequently, et al.Nature, 2001,411:494.) show double-stranded RNA (the small interfering RNA of 21～23nt length, siRNA) can suppress the genetic expression in the mammalian cell and not cause ifn response, for the gate has been opened in the practical application of RNAi.

In the period of since RNAi was found from its 1998 short 8, be widely applied to the every field that biomedical research uses (GrunwellerA, et al.Curr Med Chem, 2005,12:3143.).Based on the siRNA medicine of RNAi preparation, in hepatitis B, bird flu, AMD, treating AIDS research, demonstrate good effect.

The bottleneck of siRNA medicament research and development is the leading-in technique of siRNA at present.SiRNA itself is difficult to pass cytolemma.In vivo, siRNA is easy to by blood plasma and tissue juice dilution, degrades.Therefore, the settled preparation that need import is protected siRNA, carries its arrival target region and is helped siRNA to pass target cell membrane.The siRNA medicinal application also is like this in the liver disease field.

At present, importing research field at liver target siRNA mainly adopts following method to come siRNA is imported liver cell in the body.

1.HD method

Hydrokinetics (hydrodynamic) injection imports liver to siRNA by the tail vein.The siRNA that this method imports is distributed in the organs such as liver,kidney,spleen, lung and pancreas more, and organ specificity is not strong; The more important thing is that this method can cause the right side of mice heart failure, can not be applied to human body.(Zender L，et al.Proc Natl Acad Sci USA，2003，100：7797；Song E，et al.Nat Biotechnol，2005，23：709.)

2. cholesterol method

(Soutschek J such as Soutschek, et al.Nature, 2004,432:173.) cholesterol is coupled at an end of a chain of siRNA of chemically modified, carry out conventional intravenous injection then, find that special siRNA can suppress the expression of specific gene in the liver cell specifically.Yet the used dosage of this method is very high, reaches 50mg/kg body weight/pin, and such dosage is also far from practical application;

3.AAV method

Uprichard (Uprichard SL, et al.Proc Natl Acad Sci USA, 2005,102:773.) etc. use the good adeno-associated virus of liver target (AAV) carrier, special shRNA is imported liver, discovery can suppress duplicating of HBV well, and suppresses effect sustainable at least 26 days.Yet, Grimm etc. studies show that: use AAV that shRNA is imported in the mouse body, can cause mouse liver injury and even death, reason is: transcribing of shRNA is uncontrollable, some the required RNAi approach of body normal activities that caused a large amount of shRNA saturation jammings.Before controlled shRNA transcripting promoter occurs, AAV import the shRNA mode do not have actual application value (Grimm D, et al.Nature, 2006,441:537.).

4.SNALP method

(Morrissey DV such as Morrissey, et al.Nat Biotechnol, 2005,23:1002.) use a kind of special liposome SNALP as importing preparation parcel siRNA, this imports preparation and is mixed by positively charged ion lipid and fusion lipid, mixture is wrapped in the diffusible PEG of one deck outward again and makes, and whole polymkeric substance diameter is probably about 120nm.Conventional intravenous injection, 3mg/kg/ days, inject 3 days continuously after, discovery can effectively suppress HBV duplicates in that mouse is intravital, and drug effect continues about six weeks, very encouraging.Yet clinical trial shows that said preparation can cause very serious anaemia.

5. monoclonal antibody method

(Song E such as Song, et al.Nat Biotechnol, 2005,23:709.) adopt fusion rotein at the formation of the proteic monoclonal antibody fragment of the env of HIV and hPRM1 as the importing preparation, the siRNA that successfully will suppress HIV imports in the proteic cell type of expression HIV env of all tests; And use this strategy and suppressed growth of tumor (dosage: 2.5mg/kg/ pin, 0,1,3 days each intravenous injection one pins after the transplantation tumor) specifically.But the monoclonal antibody that is adopted much is the mouse source sequence now, for people's genus foreign protein, has certain immunogenicity, and obtains at the people source monoclonal antibody of a certain particular target is still difficult at present.

Summary of the invention

The objective of the invention is to research and develop fusion rotein a kind of liver target, that have the siRNA guiding effect.

Warm albumen of the present invention is made of two portions: the albumen n end part, by human histiotype plasminogen activator (human tissue plasminogen activator, htPA) mature form 1-the 274th amino acids formation; The PROTEIN C end parts, (humanprotamine 1, and hPRM1) 2-the 51st amino acids constitutes by people's protamine I.Human histiotype plasminogen activator (htPA) mature form amino acid complete sequence sees ncbi database (http://www.ncbi.nih.gov for details, Accession:NP_000921,36-the 562nd amino acids sequence), people's protamine I (hPRM1) amino acid complete sequence see for details ncbi database (http://www.ncbi.nih.gov, Accession:NP_002752).The aminoacid sequence of formed fusion rotein is as described in the SEQ ID NO:1.

Fusion rotein C end hPRM1 part is rich in basic aminoacids, is with more positive charge, can with electronegative biomacromolecule combination such as nucleic acid.In this fusion rotein, play absorption, combination, delivery siRNA.

People's sense of organization plasminogen activator part of fusion rotein N end has good liver preferendum, can guide fusion rotein-siRNA mixture target liver.Human histiotype plasminogen activator (htPA) is naturally occurring a kind of albumen in the human body, is one of component of fibrinolytic system.Human histiotype plasminogen activator (htPA) transformation period in human body is very short, this is mainly caused by two aspect reasons: human plasminogen activator inhibition I (human plasminogen activatorinhibitor I, PAI) combine with htPA quick suppress and when blood flow during through liver hepatic parenchymal cells to the quick removing of htPA.PAI works by combining with 299-the 302nd amino acids in the htPA proteolytic enzyme structural domain, and PAI is to deleting the basic unrestraint effect of the amino acid whose htPA mutant of this section.Hepatic parenchymal cells is brought into play keying action in removing in the htPA body, have to studies show that 80% of the intravital htPA of input is just removed totally by liver within half an hour from blood.Hepatic parenchymal cells is removed htPA and is mainly undertaken by dual mode: utilize the mannose receptor of cell surface and the htPA molecule on glycosyl combination on the 117th, the 184th amino acids, catch htPA; (low density lipoprotein receptor-related protein LRP) combines with the finger-type structural domain of htPA and catches htPA LDH receptor related protein by cell surface.(Narita M, et al.J Clin Invest, 1995,96:1164; Biessen EA, et al.Circulation, 1997,95:46; Lansink M, et al.Blood, 1999,94:1330.) have and studies show that having removed the 117th, the 184th htPA mutant transformation period of going up glycosylation site prolongs greatly; The effect that the finger-type structural domain has same prolong half-life is fallen in removal or sudden change.(Larsen GR，et al.Blood，1989，73：1842；Bassel-Duby R，et al.J Biol Chem，1992，267：9668.)

This shows, last 1-the 274th amino acids of htPA part htPA with play a crucial role during liver cell combines, so 1-the 274th amino acids that this fusion rotein is got htPA guides fusion rotein-siRNA mixture target liver as targeting moiety.HtPA is totally 5 structural domains: finger-type structural domain, skins somatomedin structural domain, K1 structural domain, K2 structural domain and proteolytic enzyme structural domain.Structural domain all is discrete (Novokhatny V, etal.J Biol Chem, 1995,270:8680 on 26S Proteasome Structure and Function; Madison EL, et al.J Biol Chem, 1995,270:7558.), delete certain structural domain or between structural domain, insert the amino acid sequence other structural domain influences little (Waldenstrom M, etal.Gene, 1991,99:243; Smith J W, et al.J Biol Chem, 1995,270:30486.).And the boundary of proteolytic enzyme structural domain and other 4 structural domains is just between the 275th amino acids-the 276th amino acids.Therefore, the 274th of intercepting htPA 1-can not influence the affine character of its liver theoretically as the N end parts of the fusion rotein of our invention.

HtPA has very high liver affinity, and it is a naturally occurring protein in the human body simultaneously, does not have the immunogenicity problem.Simultaneously, fusion rotein provided by the invention, do not adopt and the affine basic irrelevant htPA proteolytic enzyme structural domain part of liver, so both avoided consequent haemolysis risk (proteolytic enzyme partly is responsible for activating the thrombolysis function), the inhibition of having avoided PAI again is in conjunction with (binding site of PAI is in the proteolytic enzyme structural domain).Experiment all shows in the external body that is carried out: the htPA-hPRM1 fusion rotein can import liver cell to siRNA in target ground.

Description of drawings

Fig. 1 is a transfection experiment of the present invention column diagram as a result.

Embodiment

The invention will be further described below in conjunction with accompanying drawing subordinate list and embodiment.

[gene splicing]

At first, use RNA to extract test kit (Qiagen, USA) from cervical cancer cell (Hela) culturing cell, extract total RNA, get the total RNA of 1 μ g after quantitatively and be primer, become cDNA with cDNA synthetic agent box (precious biological Dalian company limited, China) reverse transcription with oligo dT.Be pcr template with this cDNA then, use ExTaq (precious biological Dalian company limited, China) to carry out pcr amplification.Amplification condition is as follows:

The amplification of the corresponding nucleotide sequence of htPA 1-the 274th amino acids

Forward primer: GAATTCTCTTACCAAGTGATCTGCAG

Reverse primer: CGACAGCATCTGTACCTGGCAAACTGAGGCTGGCTGTACT

The PCR condition: 94 ℃ 5 minutes; 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute, 25 circulations; 72 ℃ 10 minutes.

After PCR finishes, use gel-purified to reclaim test kit (Qi Teke company, China) and reclaim standby.

The amplification of the corresponding nucleotide sequence of hPRM1 2-the 51st amino acids

Forward primer: AGTACAGCCAGCCTCAGTTTGCCAGGTACAGATGCTGTCG

Reverse primer: GCGGCCGCTTAGTGTCTTCTACATCTCGGTC

The PCR condition: 94 ℃ 5 minutes; 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute, 25 circulations; 72 ℃ 10 minutes.

After PCR finishes, use gel-purified to reclaim test kit (Qi Teke company, China) and reclaim standby.

Fusion rotein the splicing of corresponding gene: use the PCR method that htPA (1-274) and hPRM1 (2-51) are stitched together.

Pcr template: above-mentioned two kinds of PCR product gel purifying reclaim the product equal amount of mixture.

Forward primer: GAATTCTCTTACCAAGTGATCTGCAG

Reverse primer: GCGGCCGCTTAGTGTCTTCTACATCTCGGTC

The PCR condition: 94 ℃ 5 minutes; 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute, 25 circulations; 72 ℃ 10 minutes.

After PCR finishes, use gel-purified to reclaim test kit (Qi Teke company, China) and reclaim, promptly obtain the gene splicing product of purifying.

[genetic expression, purifying]

The gene splicing product of above-mentioned purifying is connected into pMD-18T carrier (precious biological Dalian company limited, China), and the clone advances bacillus coli DH 5 alpha, after the order-checking evaluation is errorless, extract plasmid, use EcoRI and NotI (NEB, USA) double digestion, the fragment that gel reclaims about 975bp is standby; PPICZ α A plasmid (Invitrogen, USA) with same double digestion handle, gel-purified, the fragment about the 975bp of the fragment of recovery and front purifying is connected, transformed into escherichia coli Top10F ', the extraction plasmid, standby.

(NEB, USA) after the single endonuclease digestion wireization, phenol is taken out alcohol precipitation, is dissolved in 10 μ L aseptic double-distilled waters, electric shock conversion pichia spp to get usefulness Pme I about the above-mentioned plasmid of preparing 10 μ g.Electric shock transformation method is: the pichia spp cell is with 50 milliliters of YPD substratum (1% yeast extract pastes, 2% peptone, when 2% glucose) being cultured to O.D. and being 1.4 (600 nano wave lengths), 4000 rev/mins, 4 ℃, centrifugal 5 minutes collecting precipitations, with the ice-cold sterile distilled water in 25 milliliters of left and right sides resuspended after, 4000 rev/mins, 4 ℃, centrifugal 5 minutes, collecting precipitation.Precipitation adds the ice-cold aseptic sorbitol solution of 10 milliliter of 1 mol, resuspended, according to above-mentioned condition recentrifuge, outwell supernatant, precipitation is resuspended in the ice-cold aseptic sorbitol solution of 200 μ L1 mol, 80 μ L and the aforesaid wire plasmid solution got wherein mix, change in the ice-cold electric shock cup, placed on ice 5 minutes, use electroporation apparatus at 1500 volts, 25 microfarads shock by electricity to this cell-DNA mixed solution under 200 ohmic conditions.After electric shock finishes, in the electric shock cup, add 1 milliliter of ice-cold aseptic sorbitol solution (1 mol) rapidly, with pipettor gently with cell resuspended after, after all liquid in the electric shock cup changed in the aseptic plastic pipe over to 30 ℃ of conversion fluids and leave standstill 1 hour, (dull and stereotyped prescription is surplus coat on the YPDS flat board that contains Zeocin (100 μ g/mL): 1% yeast extract (w/v), 2% peptone (w/v), 1% agar (w/v), 2% glucose (w/v), the Sorbitol Powder of 1mol/L, 100 μ g/mLZeocin), 30 ℃ of cultivations, after son to be transformed grew, the picking clone carried out liquid culture.

The clone who grows on the above-mentioned YPDS flat board of picking, be inoculated in (BMGY:1% yeast extract paste in 10 milliliters of BMGY substratum respectively, 2% peptone, 100mM potassium phosphate buffer (pH 6.0), 1.34%YNB (Gibcol, the U.S.), 0.00004% vitamin H, 1% glycerine), cultivate O.D.600=2.0 for 30 ℃ 250 rev/mins, 4000 rev/mins of centrifugation mediums 5 minutes after the supernatant discarded, add 10 milliliters of left and right sides BMMY substratum (BMMY:1% yeast extract pastes, 2% peptone, 100mM potassium phosphate buffer (pH 6.0), 1.34%YNB, 0.00004% vitamin H, 0.5% methyl alcohol), 3 layers of sterile gauze of bottleneck lid keep ventilative, and 50 μ L methyl alcohol were added in 30 ℃ of 250 rev/mins of cultivations in per 24 hours.96 as a child centrifugal collection supernatants, i.e. acquisition contains the fermented liquid of fusion protein molecule.Use the conventional ion exchange chromatography to handle fermented liquid, elutriant is crossed the G-100 exclusion chromatography after using the desalination of G-25 exclusion chromatography, collects the part about 37kd, promptly obtains the pure product of fusion rotein.-70 ℃ of preservations were standby after pure product were measured protein content.

[fusion rotein target importing siRNA property testing]

Transfection the day before yesterday, get some amount Hela cell and the HepG2 cell is layered on respectively in 24 orifice plates, cell degree of converging is about 70%-90% when making transfection in second day.

Transfection same day, prepare to specifications the Lipofectamine2000-pCDNALacZ transfection composite (Lipofecatmine2000, pCDNALacZ plasmid be all available from Invitrogen, USA), operation steps transfectional cell to specifications.

Behind the pCDNA-lacZ plasmid transfection first day, preparation siRNA transfection mixture (table 1).Wherein the anti-LacZsiRNA sequence is 5 '-AAUUUAACCGCCAGUCAGGCU-3 ' (Zender L, et al.Proc Natl AcadSci U S A, 2003,100:7797.), contrast siRNA (mock siRNA) sequence is 5 '-AAUUUAAACUGACCGCCGGCU-3 ', and is all synthetic in Shanghai JiMa pharmacy Technology Co., Ltd.

Table 1. transfection mixture prescription

	Fusion rotein	Blank (PBS)
			anti-LacZ siRNA	Every hole consumption: 0.8 μ gsiRNA, 0.5 μ g fusion rotein	Every hole consumption: 0.8 μ gsiRNA, 0.5 μ LPBS
mock siRNA	Every hole consumption: 0.8 μ gsiRNA, 0.5 μ g fusion rotein	Every hole consumption: 0.8 μ gsiRNA, 0.5 μ LPBS

In different sterile tubes, add above-mentioned siRNA and fusion rotein respectively, (Invitrogen USA) to 50 μ L, with the soft mixing of liquid-transfering gun, placed 30 minutes for 4 ℃ to mend the MEM substratum.

Discard old substratum, change to fresh pre-temperature substratum, add above-mentioned siRNA transfection mixture respectively by the every hole of table 2, rock the culture plate mixing gently after, put into 37 ℃ of cell culture incubators.

Table 2. all cells transfection experiment summary table

	Anti-LacZ siRNA-fusion rotein mixture	Mock siRNA-fusion rotein mixture	anti-LacZ siRNA-PBS	Mock siRNA-PBS
					Hela	3 holes	3 holes	3 holes	3 holes
HepaG2	3 holes	3 holes	3 holes	3 holes

After the siRNA transfection 48 hours, use β-Gal detection kit (Invitrogen, USA) specification sheets that provides according to producer is measured each hole in the O.D. of 405nm wavelength value, each is handled 3 holes and averages as the O.D. value of this processing, again divided by this kind cell resulting average O.D. value after mock siRNA-PBS handles, as the end value of this processing.

HepG2 is the Bel7402, and Hela is a human cervical carcinoma cell system.As can be seen from Figure 1, when not adding the importing preparation, anti-LacZ siRNA does not influence (Fig. 1: c) to the expression of LacZ.Add fusion rotein as after importing preparation, anti-LacZ only has faint restraining effect to the expression of LacZ in the Hela cell, and on the contrary, anti-LacZ has obvious suppression effect (Fig. 1: a) to the expression of LacZ in the HepG2 cell.This shows: 1. our constructed fusion rotein has the siRNA guiding effect really; 2. this guiding effect is a liver cell targeting.

Sequence table

＜110〉Guangzhou Top Genomics Ltd.

＜120〉fusion rotein a kind of novel liver target, that have the siRNA guiding effect

<160>1

<210>1

<211>324

<212>PRT

＜213〉artificial sequence

<400>1

Ser Tyr Gln Val Ile Cys Arg Asp Glu Lys Thr Gln Met Ile Tyr Gln

1 5 10 15

Gln His Gln Ser Trp Leu Arg Pro Val Leu Arg Ser Asn Arg Val Glu

20 25 30

Tyr Cys Trp Cys Asn Ser Gly Arg Ala Gln Cys His Ser Val Pro Val

35 40 45

Lys Ser Cys Ser Glu Pro Arg Cys Phe Asn Gly Gly Thr Cys Gln Gln

50 55 60

Ala Leu Tyr Phe Ser Asp Phe Val Cys Gln Cys Pro Glu Gly Phe Ala

65 70 75 80

Gly Lys Cys Cys Glu Ile Asp Thr Arg Ala Thr Cys Tyr Glu Asp Gln

85 90 95

Gly Ile Ser Tyr Arg Gly Thr Trp Ser Thr Ala Glu Ser Gly Ala Glu

100 105 110

Cys Thr Asn Trp Asn Ser Ser Ala Leu Ala Gln Lys Pro Tyr Ser Gly

115 120 125

Arg Arg Pro Asp Ala Ile Arg Leu Gly Leu Gly Asn His Asn Tyr Cys

130 135 140

Arg Asn Pro Asp Arg Asp Ser Lys Pro Trp Cys Tyr Val Phe Lys Ala

145 150 155 160

Gly Lys Tyr Ser Ser Glu Phe Cys Ser Thr Pro Ala Cys Ser Glu Gly

165 170 175

Asn Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr Arg Gly Thr His

180 185 190

Ser Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp Asn Ser Met Ile

195 200 205

Leu Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser Ala Gln Ala Leu

210 215 220

Gly Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp Gly Asp Ala Lys

225 230 235 240

Pro Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr Trp Glu Tyr Cys

245 250 255

Asp Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln Tyr Ser Gln Pro

260 265 270

Gln Phe Ala Arg Tyr Arg Cys Cys Arg Ser Gln Ser Arg Ser Arg Tyr

275 280 285

Tyr Arg Gln Arg Gln Arg Ser Arg Arg Arg Arg Arg Arg Ser Cys Gln

290 295 300

Thr Arg Arg Arg Ala Met Arg Cys Cys Arg Pro Arg Tyr Arg Pro Arg

305 310 315 320

Cys Arg Arg His

Claims (2)

1. a fusion rotein novel liver target, that have the siRNA guiding effect, it is characterized in that: it is made of two portions, its N end is human histiotype plasminogen activator mature form 1-the 274th amino acids, and its C end is people's protamine I 2-the 51st amino acids; Its aminoacid sequence is as described in the SEQ ID NO.1.

2. the described fusion rotein of claim 1 imports the application of preparation as the siRNA of liver target.

Images