CN101648995B - Human recombination Reg4 protein and coding gene thereof as well as preparation method thereof - Google Patents

Abstract

The invention discloses a human recombination Reg4 protein and a coding gene thereof as well as a preparation method thereof, belonging to the technical field of gene engineering. The invention relates to a human recombination Reg4 protein which is the protein of (a) or (b) as follows: (a) a protein shown as an amino acid sequence, such as SEQ ID NO: 1; and (b) a protein which is formed by substituting, deleting one or more amino acids from or adding one or more amino acids to the amino acid sequence in (a), has the added value promoting activity of a cancer cell and is derived from the (a). The invention also relates to a DNA sequence for coding the human recombination Reg4 protein. The invention also provides a method for preparing the human recombination Reg4 protein, which comprises the following steps: constructing a recombination expression vector containing DNA for coding the human recombination Reg4 protein; preparing a transformant containing the recombination expression vector obtained in the step (1); culturing the transformant and expressing the protein; purifying the protein and obtaining the human recombination Reg4 protein. The human recombination Reg4 protein is in a way of directly having activity and has simple preparation method, low cost, protein product purity more than 98 percent, low endotoxin content and high activity.

Description

The people proteic preparation method of Reg4 albumen and encoding sox and this thereof that recombinates

Technical field

The present invention relates to a kind of people proteic preparation method of Reg4 albumen and encoding sox and this thereof that recombinates, belong to gene engineering technology field.

Background technology

Reg4 albumen can promote the propagation and the growth of several kinds of tumour cells, in colorectal carcinoma, cancer of the stomach, carcinoma of the pancreas and prostate cancer, and expresses obviously rising in the inflammatory bowel.People Reg4 gene (NM_032044.2) 1285bp, CDS length 477bp.The 66bp length of encoding in CDS front is 22 amino acid whose signal peptides.Signal peptide is not included in the Reg4 that secretes.But Reg4 content in vivo seldom and is difficult to purifying.Still there is not at present recombinate Reg4 albumen report or go on the market of the people that biologically active is arranged.Our laboratory is developed and a kind of in intestinal bacteria, directly the expression and the recombinate method of Reg4 of the people of purifying mature form, and in vitro detection the proteic BA of reorganization Reg4.The people who adopts our method purifying the to come out Reg4 that recombinates has purity height, low, the active strong advantage of endotoxin content.

Summary of the invention

The objective of the invention is to overcome the deficiency of existing prior art, a kind of people is provided the proteic preparation method of Reg4 albumen and encoding sox and this thereof that recombinates.People provided by the present invention recombinates Reg4 albumen for directly having active form, and the preparation method is simple, with low cost, and protein product purity reaches more than 98%, and endotoxin content is low, and is active high.

The present invention realizes through following technical scheme,

First aspect the present invention relates to a kind of people Reg4 albumen of recombinating, and this albumen is (a) or protein (b) as follows:

(a) protein of aminoacid sequence shown in SEQ ID NO:1;

(b) aminoacid sequence in (a) is through replacing, lack or adding one or several amino acid and have a short increment of tumour cell active by (a) deutero-protein.

Second aspect the present invention relates to the above-mentioned people of a kind of coding proteic dna sequence dna of Reg4 of recombinating, and sequence is shown in SEQ ID NO:2.

The third aspect the present invention relates to the above-mentioned people of a kind of preparation proteic method of Reg4 of recombinating, and comprises the steps:

Step 1 makes up the recombinant expression vector that contains coding human reorganization Reg4 protein D NA;

Step 2, preparation contains the transformant of step 1 gained recombinant expression vector;

Step 3, culture transformation body, expressing protein;

Step 4, purifying protein obtains people's Reg4 albumen of recombinating.

In the step 1, the sequence of said DNA is shown in SEQ ID NO:2.

In the step 1, said recombinant expression vector is prokaryotic expression carrier or carrier for expression of eukaryon.

In the step 1, said recombinant expression vector is a prokaryotic expression carrier.

In the step 1, said recombinant expression vector is the pET30a plasmid.

In the step 2, said transformant is intestinal bacteria.

After step 3 with before the step 4, also comprise the steps: intestinal bacteria are broken bacterium and collect inclusion body; After inclusion body washs with Pellet Wash Buffer; Be dissolved in the guanidine hydrochloride denaturation solution; And then guanidine hydrochloride denaturation solution joined in the renaturation solution, obtain people after the renaturation Reg4 protein solution of recombinating; Wherein,

The component of said renaturation solution and content are: the component of 1L renaturation solution and content are: Tris 6.057g, KCl0.7455g, NaCl 14g, MgCl ₂0.4g, CaCl ₂0.3g, Guanidine-HCL 47.76g, Sucrose136.92g, Arginine-HCL 105.35g, GSH 300mg, GSSH 60mg, surplus is a water.

Preferably, the people's Reg4 protein concentration of recombinating of recombinating in the Reg4 protein solution of the people after the said renaturation is 0.1mg/mL.

People after the renaturation that the obtains Reg4 protein solution of recombinating is handled as follows: 4 ℃ of hold over night, the centrifugal 30min of 12000rpm, supernatant, supernatant pH value is transferred to 8.0, the centrifugal 30min of centrifugal again 12000rpm, collection supernatant; Afterwards supernatant being used with the isopyknic pH of supernatant is 7.2 phosphoric acid buffer dilution, and afterwards with film bag 1/10 of to the dilution back TV that anhydrates that desalts, using pH again is 10 times of the solution dilutions that obtain after 6.5 phosphoric acid buffer will anhydrate.

Said purifying is the cationic exchange column purification, is specially:

Step 1, using pH is 6.5 phosphate buffered saline buffer detergent line and cationic exchange coloums, leads and UV value balance until electricity;

Step 2, last appearance, the control flow velocity is 1ml/min;

Step 3, use pH is 6.5 the phosphate buffered saline buffer eluted protein that contains 1M NaCl;

Step 4 is collected stream and is worn liquid.

Said cationic exchange coloum is the S/CM post.

Compared with prior art, the present invention has following beneficial effect: the present invention discloses the people proteic preparation method of Reg4 that recombinates first.People provided by the present invention recombinates Reg4 albumen for directly having active form.The preparation people according to the invention proteic method of Reg4 of recombinating, technology is simple, with low cost, does not need enzyme extra step such as to cut, and the reorganization Reg4 protein product purity of being produced reaches more than 98%, and endotoxin content is low, and is active high.This for Reg4 albumen the application of new drug development and detection reagent provide enrich, high-quality raw materials.

Description of drawings

Fig. 1 is the electrophorogram of the people Reg4 gene fragment that PCR comes out in people Reg4cDNA and the Reg4 gene fragment after reclaiming of tapping rubber;

Fig. 2 is the pET30a plasmid synoptic diagram of packing;

Fig. 3 is the recombinate electrophorogram of Reg4 of the people who expresses;

Fig. 4 is the Reg4 detected result figure that recombinates with the people of FPLC method purifying;

Fig. 5 is the people of the purifying Reg4 electrophorogram of recombinating;

The behave SEC-HPLC detected result figure of reorganization Reg4 purity of Fig. 6;

Fig. 7 reorganization Reg4 albumen western blotting electrophorogram of behaving;

Fig. 8 is the purifying descendant comparison diagram of Reg4 albumen to the short proliferation function of colon cancer cell of recombinating.

The e. coli bl21 that the present invention relates to (DE3) is at " Guo D; Hu K; Lei Y, Wang Y, MaT; He D.Identification and characterization of a novel cytoplasm proteinICF45 that is involved in cell cycle regulation.J Biol Chem.2004,279 (51): 53498-53505 " open in the document.E. coli bl21 (DE3) can be obtained through disclosing commercially available commercial channel, as buying from German Novagen company, is numbered Novagen:69389;

The expression vector PET30a (+) that the present invention relates to is at " Lin M; Trottier E; Pasick J; Sabara M.Identification of antigenic regions of the Erns protein for pigantibodies elicited during classical swine fever virus infection.JBiochem.2004,136 (6): 795-804 " open in the document.Expression vector PET30a (+) can obtain through disclosing commercially available commercial channel, as buying from German Novagen company, is numbered Novagen:69909-3.

Embodiment

Further set forth the present invention below in conjunction with specific embodiment.Be interpreted as: these embodiment only be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to normal condition; Sambrook equimolecular clone for example: laboratory manual is seen the condition described in the New York ColdSpring Harbor Laboratory press version in 1989, or the condition of advising according to manufacturer.

Through from yeast, as secreting the mikrobe of bacterium or the human or animal's clone, the people that can produce the present embodiment of the recombinant molecule form Reg4 albumen of recombinating.Choose secrete polypeptide from host cell wantonly.

Many expression systems are known and available; Comprise bacterium (for example intestinal bacteria and withered grass bud robe bacillus), yeast (for example yeast saccharomyces cerevisiae, newborn yeast kluyveromyces fragilis and pichia pastoris phaff), filamentous fungus (for example aspergillus); Vegetable cell, zooblast and insect cell.

Present embodiment comprises carrier, the transformant that the people of code book embodiment recombinates the proteic DNA of Reg4 and contains these DNA.

In the present embodiment, transformant (transformant) promptly has the recipient cell of allogeneic dna sequence DNA molecule.

Present embodiment also comprises the people who produces present embodiment through synthetic and the recombinant technology proteic method of Reg4 of recombinating.Can separate and purifying polynucleotide (DNA or RNA), carrier, host cell and organism through methods known in the art.

The carrier that is used for present embodiment can be like phage, plasmid, clay, minichromosome, virus or retroviral vector.The carrier that can be used for cloning and/or express the polynucleotide of present embodiment is to duplicate and/or to express the carrier that duplicates and/or express polynucleotide in the host cell of polynucleotide at need.Generally speaking; Polynucleotide and/or carrier can be used for any eucaryon or prokaryotic cell prokaryocyte, comprise mammalian cell (like people (like HeLa), monkey (like Cos), rabbit (like the rabbit reticulocyte), rat, hamster (like CHO, NSO and baby hamster kidney cell) or mouse cell (like the L cell)), vegetable cell, yeast cell, insect cell or bacterial cell (like intestinal bacteria).Relevantly be applicable to that the example of the suitable carrier of broad variety host cell can be referring to for example F.Ausubel et al., Current Protocols in Molecular Biology.GreenePublishing Associates and Wiley-Interscience (1992) and Sambrook etal. (1989).Can use the host cell that contains these polynucleotide to come great expression to can be used for the for example protein of medicine, diagnostic reagent, vaccine and therapeutical agent.

Having developed several different methods is used for via the complementary sticky end DNA being operated with carrier and links to each other.For example, can add complementary with the aggressiveness sequence fragment by the DNA section in desire is inserted carrier DNA.Then through the hydrogen bond connection carrier between the complementary homopolymeric tail and DNA section to form recombinant DNA molecules.

The synthetic linker that contains one or more restriction site provides the method for another kind of connection DNA section and carrier.Handle the DNA section that produces through the endonuclease restrictive diges-tion with phage T4DNA polysaccharase or e. coli dna polymerase I; Described two kinds of polysaccharases with its 3 '; It is terminal that 5 '-exonucleolytic activity is removed outstanding γ-strand, and mend flat 3 '-recessed end with its polymerization activity.Therefore, these active associatings have produced flush end DNA section.The enzyme that connects at ability catalysis flush end dna molecular then is as under the existence of phage T4DNA ligase enzyme being incubated the linkers of flush end section with big molar excess.Therefore, reaction product is the DNA section that end carries the polylinker sequence.Use these DNA sections of suitable Restriction Enzyme cracking then, and be connected in the expression vector of using enzymatic lysis, said enzyme can produce and the compatible end of said DNA section.Can buy the synthetic linker that contains a plurality of restriction endonucleases site from a plurality of businessmans.

The polynucleotide inset should be operably connected to on the compatible suitable promotor of the host cell of expressing polynucleotide.Promotor can be strong promoter and/or inducible promoter.The example of some promotors of enumerating comprises phage PL promotor of a specified duration, intestinal bacteria lac, trP, phoA, tac promotor, SV40 is early stage and late promoter and retrovirus LTR promotor.Other suitable promotor is well known by persons skilled in the art.The express recombinant carrier further contains transcription initiation, termination site, and contains the ribosome bind site that is useful on translation at transcriptional domain.The encoding part of the transcript that recombinant vectors is expressed can comprise the translation initiation codon that is positioned at the starting point place and suitably be positioned at by the terminator codon (UAA, UGA or UAG) of the end of translation polypeptide.

As stated, expression vector can comprise at least one selective marker.Said mark comprises Tetrahydrofolate dehydrogenase, G418, glutamine synthase or the neomycin resistance as far as eukaryotic cell culture; And the tsiklomitsin, kantlex or the acillin resistant gene that are used for intestinal bacteria and other microbial culture.Suitably host's representative example includes but not limited to: bacterial cell, like intestinal bacteria, streptomycete and salmonella typhimurium cell; The fungal cell is like yeast cell (like yeast saccharomyces cerevisiae or pichia pastoris phaff); Insect cell is like fruit bat S2 and noctuid SF9 cell; Zooblast, like CHO, COS, NSO, 293 with the Bowes melanoma cells; And vegetable cell.The appropriate culture medium of above-mentioned host cell and culture condition are known in the art.

Present embodiment also comprises the host cell of the nucleotide sequence that contains present embodiment, and said nucleotide sequence can be operated with one or more allos control region (like promotor and/or enhanser) through technology known in the art and link to each other.Can select to regulate the expression of the gene order of inserting, or can be according to the required particular form modification and the host strain of processed gene product.In the presence of some inductor, the expression that some promotor starts can raise; Therefore, can control polypeptide expression through genetic modification.In addition, different host cells have distinctive and special translation, translation post-treatment and the proteinic mechanism of modification (like phosphorylation, cracking).Can select suitable clone to guarantee that the exogenous protein of expressing is carried out desirable modification and processing.

Through the transfection of calcium phosphate transfection, the mediation of DEAE-VISOSE, transfection, electroporation, transduction, infection or other method of cation lipid mediation, can the nucleic acid and the nucleic acid recombinant vectors of present embodiment be imported host cell.Said method is described in the laboratory manual of a plurality of standards, like Davis et al., and BasicMethodsIn Molecular Biology (1986).

The people of the code book embodiment proteic polynucleotide of Reg4 of recombinating can be connected in the host, to breed with the carrier that contains selective marker.Generally speaking, can be at throw out, import plasmid vector in the mixture like calcium phosphate precipitation thing or itself and charged lipids.If carrier is a virus, can use suitable packing cell to tie up to and external it packed, transduce to host cell again.

Can identify by successful cell transformed through well-known technology, promptly contain the cell of the DNA recombinant vectors of present embodiment.For example, the cell that can cultivate importing express recombinant carrier gained is to produce required polypeptide.Collect and lysing cell, use like Southem (1975) J.Mol.Biol.95,503 or Berentet al (1985) Biotech.3,208 described methods detect the existence of DNA in its DNA content.Perhaps, use proteinic existence in the antibody test supernatant.

Through well-known method from the reconstitution cell culture, reclaim and the Reg4 albumen of going into to recombinate of purifying present embodiment comparatively favourable, said method comprise sulfuric acid by or ethanol sedimentation, acid extraction, negatively charged ion or cation-exchange chromatography, phosphorylated cotton chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, dewatering electric charge effect chromatography and lectin chromatography.In some embodiments, can use high performance liquid chromatography (HPLC) to carry out purifying.

In some embodiments, can use the people of one or more the above-mentioned chromatography method purifying present embodiments Reg4 albumen of recombinating.In other embodiments; Can use the people of one or more the following chromatography column purifying present embodiments Reg4 albumen of recombinating, said chromatography column has: Q sepharose FF post, SP sepharose FF post, Q sepharose High Performance post, Blue sepharose FF post, Blue post, Phenyl Sepharose FF post, DEAE Sepharose FF or Methyl post.

In addition, can use the people of the method purifying present embodiment of describing among the international publication number WO00/44772 (list this paper in as a reference in full) the Reg4 albumen of recombinating.Those skilled in the art can easily change wherein said method with the people who is used for the purifying present embodiment Reg4 albumen of recombinating.The Reg4 albumen of can recombinating from the protokaryon that comprises for example bacterium, yeast, higher plant, insect and mammalian cell or eucaryon host reclaim present embodiment through the product that recombinant technology produces people.

Embodiment

Step 1, the recombinate structure of Reg4 protein expression vector of people

From human liver cDNA with primer 5 ' GGAATTC CATATGGATATCATCATGAGACCCAGC 3 ' (SEQ ID NO:4) and reverse primer 5 ' CG GGATCCCTATGGTCGGTACTTGCACAGG 3 ' (SEQID NO:5) (it is synthetic to give birth to the worker by Shanghai) PCR goes out people Reg4 gene.Underlined part is the restriction enzyme site of NdeI and BamH I in the primer.The PCR condition is: 94 ℃ 2 minutes: 94 ℃ of 30 second, 58 ℃ of 30 second, 68 ℃ of 30 second, 35 the circulation.PCR product gel electrophoresis reclaims the dna fragmentation (see figure 1) of about 500bp, with Nde I and BamH double digestion and with the pET30a plasmid that the fragment packet that enzyme scales off feed into Nde I and BamH double digestion also check order (Invitrogene).Select positive colony with the kalamycin flat board, and, test and the correct plasmid of packing (SEQID NO:2) of sequence verification with Nde I and BamH double digestion with positive colony extracting plasmid.Fig. 1 is the electrophorogram of the people Reg4 gene fragment that PCR comes out in people Reg4cDNA and the Reg4 gene fragment after reclaiming of tapping rubber; Fig. 2 is the pET30a plasmid synoptic diagram of packing, and wherein italicized item is the restriction enzyme site of Nde I and BamH, and terminator is " TAG ".The pET30a carrier of packing is transformed in BL21 (DE3) intestinal bacteria, and parallel double digestion, PCR and order-checking are identified, select and make up successful Reg4-pET30a-BL21 engineering strain.

Step 2, people's proteic expression of Reg4 of recombinating

The engineering strain for preparing in the step 1 is at LB substratum (1%NaCl; 1%Tryptone; 0.5%YeastExtract; When being cultured to the OD600=0.6 left and right sides pH7.0), adding IPTG and induce (what we used is 1mM concentration, yet higher or lower concentration also is suitable for), induce to cultivate and carried out 4 hours at 37～42 ℃ of following shaking tables.Induce and finish the centrifugal collection thalline in back, and with 1 * PBS (137mM NaCl; 2.7mMKCl; 4.3mM Na ₂HPO ₄1.4mM KH ₂PO ₄PH7.4) wash.Fig. 3 is the recombinate electrophorogram of Reg4 of the people who expresses; Among Fig. 3, first road: molecular weight marker; Second road: without IPTG inductive engineering strain; The 3rd road: through IPTG inductive engineering strain; It is thus clear that the people who the derives Reg4 that recombinates is arranged at about 16kDa place.

Step 3, people recombinate proteic sex change of Reg4 and renaturation

In the step 2 thalline of centrifugal collection break bacterium with ultransonic mode and collect inclusion body (new sesame JY92-2D, 500W, ultrasonic in right amount.What use in our method is that rest in 3 seconds ultrasonic 3 seconds is a circulation, totally 30 minutes.Ultrasonic damping fluid: 1 * PBS; 1mM EDTA; 0.1mM PMSF; PH7.4.Inclusion body with Pellet Wash Buffer (component and the content of said Pellet Wash Buffer are: component and the content of 100mlPellet Wash Buffer are: Triton X-100 1ml, EDTA 0.292g, NaCl0.293g, surplus is 1 * PBS; Wherein the component of 1L 1 * PBS and content are: NaCL 8g, KCL 0.2g, Na ₂HPO ₄1.42g, KH ₂PO ₄0.27g surplus is a water);

(component of said guanidine hydrochloride denaturation solution and content are: the component and the content of 100ml guanidine hydrochloride denaturation solution are: Tris 0.606g with the guanidine hydrochloride denaturation solution dissolving of 50 times of volumes for washing back; EDTA 0.292g; NaCl0.293g, Guanidine-HCL 57.318g, surplus is a water; PH8.0);

After fully dissolving, inclusion body again the sex change drop is added to that (component of said renaturation solution and content are: the component of 1L renaturation solution and content are: Tris 6.057g, KCl 0.7455g, NaCl 14g, MgCl in the renaturation solution ₂0.4g, CaCl ₂0.3g, Guanidine-HCL 47.76g, Sucrose 136.92g, Arginine-HCL105.35g, GSH 300mg, GSSH 60mg, surplus is a water); Need rigorous control protein concentration during renaturation, optimum concn is 0.1mg/mL;

Protein solution behind the denaturation renaturation is carefully sealed, 4 ℃ of hold over night, the centrifugal 30min of 12000rpm gets supernatant, and supernatant pH value is transferred to 8.0, and the centrifugal 30min of centrifugal again 12000rpm collects supernatant; Afterwards supernatant being used with the isopyknic pH of supernatant is 7.2 phosphoric acid buffer dilution, and afterwards with film bag 1/10 of to the dilution back TV that anhydrates that desalts, using pH again is 10 times of the solution dilutions that obtain after 6.5 phosphoric acid buffer will anhydrate, treats column purification.The contriver finds that the people who adopts this buffer solution system can guarantee that renaturation the is come out Reg4 albumen of recombinating can be come out and have corresponding BA by purifying easily.

Step 4, people's proteic purifying of Reg4 of recombinating

Prepared people recombinates Reg4 protein renaturation liquid after 15000rpm is centrifugal 30 minutes in the step 3, after getting supernatant and anhydrating to desalt through the film bag, carries out the IX column purification.In our method, adopted the method for a step IX column purification.Step is following:

(1) Phase A (phosphate buffered saline buffer, pH 6.5) balance columns bed: using pH is 6.5 phosphate buffered saline buffer detergent line and pillars, leads and UV value balance until electricity;

(2) go up appearance, the control flow velocity is 1ml/min;

(3) use pH is 6.5 the phosphate buffered saline buffer eluted protein that contains 1M NaGl;

(4) collect Flow Through (stream is worn liquid): observe ultraviolet absorption curve, collection Flow Through during the uv-absorbing rising during with wash-out when last appearance;

(5) people behind the purifying recombinates Reg albumen with the 1 * PBS dialysis with pH7.4;

(6) protein concentration after the dialysis can reach more than the 1mg/mL, and purity can reach more than 98%, and albumen can directly be placed on-80 ℃ of cryogenic refrigerators with liquid nitrogen flash freezer and preserve.

Fig. 4 is the Reg4 detected result figure that recombinates with the people of FPLC method purifying; What show among the figure is the cation seperation column purifying, according to ultraviolet absorption peak and electric lead curve, collects elution peak.

Below be the correlation detection that Reg 4 albumen that prepare are carried out:

One, Reg 4 proteic conventional sense

(1) according to conventional SDS-PAGE electrophoresis operation detection purity.Fig. 5 is the people of the purifying Reg4 electrophorogram of recombinating; As shown in Figure 5, first road: molecular weight marker.Second road: the engineering strain after inducing without IPTG.The 3rd road: the engineering strain after IPTG induces.The 4th road: washing back inclusion body.The 5th road: supernatant after the sex change.The 6th road: the people of the purifying that cationic exchange coloum the elutes Reg4 albumen of recombinating.Purity of protein can reach more than 98% through its purity of BandScan software analysis;

(2) people of the step 4 preparation Reg4 albumen of recombinating carries out HPLC-SEC and detects; Condition is: (condition: ACME 9000 (Younglin, Korea), TSK-GEL G2000SWXL (Tosoh; Japan) applied sample amount is 20 μ l; Protein concentration is 0.5 μ g/ μ l, and flow velocity is 0.8mL/min, and UV detects 280nm).It is thus clear that in elutriant, have only a peak to exist.As shown in Figure 6, the behave SEC-HPLC detected result figure of reorganization Reg4 purity of Fig. 6;

(3) detect the specificity of expressing protein according to conventional Western blotting.Tropina behind the SDS-PAGE electrophoresis, is changeed film to pvdf membrane, and the 4 degree sealings of 5% skim-milk are spent the night, and commercial anti-Reg4 antibody incubated at room 1h washes film 3 times, two anti-incubated at room 45mins, and ECL detects.Fig. 7 reorganization Reg4 albumen western blotting electrophorogram of behaving; Among Fig. 7, first road: IPTG inductive tropina; Second road: without IPTG inductive tropina.It is thus clear that expressed proteins is specific Reg 4 albumen really.

Two, people's Reg4 albumen intracellular toxin of recombinating detects

Adopt TAL (Xiamen TAL demonstration plant ltd), three crowdes of people that detected the step 4 preparation proteic endotoxin content of Reg4 of recombinating, all＜1E.U/ug.

Three, people's Reg4 protein-active of recombinating detects

The people of the step 4 preparation Reg4 albumen of recombinating has shown stronger short proliferation function for colon cancer cell.When HCT116 (a) and HT29 (b) cell cover with petridish 70-80%, overnight cultures in no calf serum RPMI-1640; With HCT116 and HT29 cell with 1 * 10 ³The density in/hole is inoculated in 96 well culture plates respectively, in 0.1ml RPMI-1640 (containing 10% foetal calf serum) in 37 ℃, contain overnight cultures in the incubator of 5%CO2; Nutrient solution is removed in suction, adds the fresh RPMI-1640 of 0.1ml and (contain 5% foetal calf serum, but the pure article of reorganization hReg4 (0nM,, 10nM, 100nM, 200nM, 500nM, 1000nM)) that contain different concns continues to cultivate 68h; Add CCK-8 solution 10ul/ hole before stopping cultivating, 37 ℃ of incubation 3h measure OD450nm and OD490nm value.Blank well (substratum, CCK-8 solution) is set simultaneously, control wells (the medicine dissolution medium of cell, same concentrations, nutrient solution, CCK-8 solution), every settings 6 multiple holes, the result gets its MV.Fig. 8 is the purifying descendant comparison diagram of Reg4 albumen to the short proliferation function of colon cancer cell of recombinating: the purifying descendant recombinates Reg4 albumen to colon cancer cell having been shown stronger short proliferation function.

Four, people's Reg4 the 12nd amino acids of recombinating changes Ala into by Gly

Make the 32nd bit base after initiator codon ATG of the PCR target gene fragment described in the step 1 into G with the method for rite-directed mutagenesis; Promptly (ATGGATATCATCATGAGACCCAGCTGTGCTCCTGGA) changes (ATGGATATCATCATGAGACCCAGCTGTGCTCCTGCA) into; Express and purifying after the 12nd of protein sequence become Ala (seeing SEQ ID NO:3) by Gly, promptly ( MDIIMRPSCAPG) become ( MDIIMRPSCAPA).Protein to behind this purifying has adopted the method described in " three, people's Reg4 protein-active of recombinating detects ", and the Reg4 protein concentration of recombinating of the people after variation is 0nM; 10nM; 100nM, 200nM, 500nM; During 1000nM, the people of its activity and the step 4 preparation Reg4 albumen of recombinating is compared no noticeable change.

Sequence table

< 110>Shanghai Communications University

< 120>the people proteic preparation method of Reg4 albumen and encoding sox and this thereof that recombinates

<160>5

<170>PatentIn version 3.3

<210>1

<211>137

<212>PRT

<213>Homo sapiens

<220>

<221>MUTAGEN

<222>(1)..(1)

<400>1

Met Asp Ile Ile Met Arg Pro Ser Cys Ala Pro Gly Trp Phe Tyr His

1 5 10 15

Lys Ser Asn Cys Tyr Gly Tyr Phe Arg Lys Leu Arg Asn Trp Ser Asp

20 25 30

Ala Glu Leu Glu Cys Gln Ser Tyr Gly Asn Gly Ala His Leu Ala Ser

35 40 45

Ile Leu Ser Leu Lys Glu Ala Ser Thr Ile Ala Glu Tyr Ile Ser Gly

50 55 60

Tyr Gln Arg Ser Gln Pro Ile Trp Ile Gly Leu His Asp Pro Gln Lys

65 70 75 80

Arg Gln Gln Trp Gln Trp Ile Asp Gly Ala Met Tyr Leu Tyr Arg Ser

85 90 95

Trp Ser Gly Lys Ser Met Gly Gly Asn Lys His Cys Ala Glu Met Ser

100 105 110

Ser Asn Asn Asn Phe Leu Thr Trp Ser Ser Asn Glu Cys Asn Lys Arg

115 120 125

Gln His Phe Leu Cys Lys Tyr Arg Pro

130 135

<210>2

<211>423

<212>DNA

<213>Artificial

<220>

< 223>artificial sequence

<400>2

catatggata tcatcatgag acccagctgt gctcctggat ggttttacca caagtccaat 60

tgctatggtt acttcaggaa gctgaggaac tggtctgatg ccgagctcga gtgtcagtct 120

tacggaaacg gagcccacct ggcatctatc ctgagtttaa aggaagccag caccatagca 180

gagtacataa gtggctatca gagaagccag ccgatatgga ttggcctgca cgacccacag 240

aagaggcagc agtggcagtg gattgatggg gccatgtatc tgtacagatc ctggtctggc 300

aagtccatgg gtgggaacaa gcactgtgct gagatgagct ccaataacaa ctttttaact 360

tggagcagca acgaatgcaa caagcgccaa cacttcctgt gcaagtaccg accataggga 420

tcc 423

<210>3

<211>137

<212>PRT

<213>Homo sapiens

<400>3

Met Asp Ile Ile Met Arg Pro Ser Cys Ala Pro Ala Trp Phe Tyr His

1 5 10 15

Lys Ser Asn Cys Tyr Gly Tyr Phe Arg Lys Leu Arg Asn Trp Ser Asp

20 25 30

Ala Glu Leu Glu Cys Gln Ser Tyr Gly Asn Gly Ala His Leu Ala Ser

35 40 45

Ile Leu Ser Leu Lys Glu Ala Ser Thr Ile Ala Glu Tyr Ile Ser Gly

50 55 60

Tyr Gln Arg Ser Gln Pro Ile Trp Ile Gly Leu His Asp Pro Gln Lys

65 70 75 80

Arg Gln Gln Trp Gln Trp Ile Asp Gly Ala Met Tyr Leu Tyr Arg Ser

85 90 95

Trp Ser Gly Lys Ser Met Gly Gly Asn Lys His Cys Ala Glu Met Ser

100 105 110

Ser Asn Asn Asn Phe Leu Thr Trp Ser Ser Asn Glu Cys Asn Lys Arg

115 120 125

Gln His Phe Leu Cys Lys Tyr Arg Pro

130 135

<210>4

<211>34

<212>DNA

<213>Artificial

<220>

< 223>artificial sequence

<400>4

ggaattccat atggatatca tcatgagacc cagc 34

<210>5

<211>30

<212>DNA

<213>Artificial

<220>

< 223>artificial sequence

<400>5

cgggatccct atggtcggta cttgcacagg 30

Claims (3)

1. one kind prepares people's proteic method of Reg4 of recombinating, and the Reg4 albumen of recombinating of people wherein is (a) or protein (b) as follows:

(a) protein of aminoacid sequence shown in SEQ ID NO:1;

(b) aminoacid sequence in (a) is characterized in that through the protein of an amino acid mutation deutero-shown in SEQ ID NO:3 said method comprises the steps:

Step 1 makes up the recombinant expression vector that contains coding human reorganization Reg4 protein D NA;

Step 2, preparation contains the transformant of step 1 gained recombinant expression vector;

Step 3, culture transformation body, expressing protein; With the broken bacterium of intestinal bacteria and collect inclusion body, inclusion body is dissolved in the guanidine hydrochloride denaturation solution, and then guanidine hydrochloride denaturation solution is joined in the renaturation solution after washing with Pellet Wash Buffer then, obtains people after the renaturation Reg4 protein solution of recombinating; Wherein, the component of said renaturation solution and content are: the component of 1L renaturation solution and content are: Tris 6.057g, KCl 0.7455g, NaCl 14g, MgCl ₂0.4g, CaCl ₂0.3g, Guanidine-HCL 47.76g, Sucrose 136.92g, Arginine-HCL 105.35g, GSH 300mg, GSSH 60mg, surplus is a water;

People after the said renaturation people's Reg4 protein concentration of recombinating of recombinating in the Reg4 protein solution is 0.1mg/ml; People after the renaturation that the obtains Reg4 protein solution of recombinating is handled as follows: 4 ℃ of hold over night; The centrifugal 30min of 12000rpm gets supernatant, and supernatant pH value is transferred to 8.0; The centrifugal 30min of centrifugal again 12000rpm collects supernatant; Afterwards supernatant being used with the isopyknic pH of supernatant is 7.2 phosphoric acid buffer dilution, and afterwards with film bag 1/10 of to the dilution back TV that anhydrates that desalts, using pH again is 10 times of the solution dilutions that obtain after 6.5 phosphoric acid buffer will anhydrate;

Step 4, purifying protein obtains people's Reg4 albumen of recombinating;

Said purifying is the cationic exchange column purification, is specially:

I) using pH is 6.5 phosphate buffered saline buffer detergent line and cationic exchange coloums, leads and UV value balance until electricity;

Ii) go up appearance, the control flow velocity is 1ml/min;

Iii) using pH is 6.5 the phosphate buffered saline buffer eluted protein that contains 1M NaCl;

Iv) collect stream and wear liquid.

2. the people according to claim 1 proteic preparation method of Reg4 that recombinates is characterized in that in the step 1, the sequence of said DNA is shown in SEQ ID NO:2.

3. the people according to claim 1 proteic preparation method of Reg4 that recombinates is characterized in that in the step 1, said recombinant expression vector is the pET30a plasmid.

Images