CN101955969A - Construction and application for general efficient and soluble pronucleus fusion expression vector - Google Patents
Construction and application for general efficient and soluble pronucleus fusion expression vector Download PDFInfo
- Publication number
- CN101955969A CN101955969A CN2009100890182A CN200910089018A CN101955969A CN 101955969 A CN101955969 A CN 101955969A CN 2009100890182 A CN2009100890182 A CN 2009100890182A CN 200910089018 A CN200910089018 A CN 200910089018A CN 101955969 A CN101955969 A CN 101955969A
- Authority
- CN
- China
- Prior art keywords
- dsba
- mut
- protein
- fusion
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of biology and relates to the construction of a general pronucleus fusion expression vector pET-dsbA-dsbAmut by forming a fusion companion body of a prokaryotic expression interest protein which is obtained after dsBA is connected in series with DsbA mutant DsbAmut protein (DsbA-L-DsbAmut) in a protein family by using an escherichia coli disulfide bond. The DsbA-L-DsbAmut fusion protein has kinetic energy of disulfide bond oxidation-reduction enzyme and the function of a molecular chaperone, so that the constructed fusion expression vector pET-dsbA-dsbAmut can realize expression of a polypeptide or a protein molecule, particularly a foreign protein which is rich in the disulfide bond in an efficient and soluble way. Therefore, the vector has very wide application prospect in the aspects of the production of gene engineering products, antigen diagnostic reagents and enzyme activity functional proteins and the research of the structural functions of proteins.
Description
Technical field
The present invention relates to make up a kind of prokaryotic fusion expression vector, be specifically related to make up a kind of fusion vector of suitable prokaryotic expression system, this carrier can make and manyly low express at prokaryotic expression system, SA functional protein or cytokine obtain in intestinal bacteria efficiently, solubility expression, and have good biological activity.The fusion expression vector that the present invention makes up is worth utilizing prokaryotic expression system to produce to have important use aspect recombinant protein medicine, antigen diagnose reagent and the enzyme activity functional protein.
Background technology
Intestinal bacteria (E.coli) because have genetic background clear, for the time advantage such as short, easy to control, become the major project bacterium of production recombinant protein.But be not each foreign gene effective expression therein.The complexity of the stability of gene self particular structure, mRNA and translation efficiency, protein folding, host cell proteins enzyme to proteinic degraded, foreign gene and E.coli on codon utilizes difference and protein to host's factor affecting expression of exogenous gene amounts such as genotoxic potential.Simultaneously, prokaryotic expression system lacks the ability that forms disulfide linkage, utilizes the recombinant protein of prokaryotic expression system production often to form inclusion body, and often biological activity is very low for product after the sex change renaturation.The method of employing amalgamation and expression can improve the expression amount and the solubility of target protein.The fusion companion body commonly used at present has GST, MBP, NusA etc., carry out expression amount and the solubility that amalgamation and expression can improve target protein though utilize these to merge the companion body, but the recombinant protein that generates often makes the recombinant protein biological activity of acquisition very low owing to not forming correct space structure, and some albumen may form the aggressiveness precipitation again after removing the fusion companion body.
The formation of intestinal bacteria self disulfide linkage all is to carry out in its pericentral siphon chamber with oxidative environment.And the recombinant protein of expressing in Bacillus coli cells matter is difficult for forming correct disulfide linkage and complete quaternary structure because of the reductibility environment of Bacillus coli cells matter.Disulfide linkage formation protein family member is the key factor that the intestinal bacteria oneself protein forms correct disulfide linkage in the colibacillus periplasm chamber, and they have the character of disulfide linkage oxydo-reductase or isomerase, plays auxiliary disulfide linkage and forms.These disulfide linkage form in the albumen primary structure and all contain avtive spot Cys-X-X-Cys, and just intermediary amino acid is formed different.Wherein, disulfide linkage forms albumin A (Disulfide bond formation protein A, DsbA) participate in the formation of disulfide linkage directly, the strongest one of oxidisability all can assist protein folding with external DsbA in vivo in the Trx family that is so far to be found.Discovering, is Ser with two Cys rite-directed mutagenesises among the functional area Cys-Pro-His-Cys of DsbA, constitutes the Ser-Pro-His-Ser structure, and the DsbA albumen after the sudden change is DsbA
MutAlbumen no longer has the function of oxydo-reductase, but still has the effect of the solvable and cellular localization of short target protein.In prokaryotic expression system, utilize DsbA can assist the correct disulfide linkage space pairing of target protein as merging the companion body, obtain having the active target protein of good biological-DsbA fusion rotein; Utilize DsbA
MutAlbumen is as merging solubility and the expression amount that the companion body can improve fusion rotein greatly.
The present invention is in view of DsbA and DsbA
MutThe property of protein characteristics are together in series the two with DsbA-DsbA
MutFusion rotein merges companion body albumen as prokaryotic expression system, has made up a kind of universal protokaryon highly-soluble fusion expression vector (pET-dsbA-dsbA
Mut).And realized the amalgamation and expression of a plurality of functional protein protokaryon solubilities with this carrier, the target protein of expression has good biological activity.Have not yet to see with DsbA-DsbA
MutSeries protein is as the research report of prokaryotic expression fusion rotein.Therefore, the fusion expression vector (pET-dsbA-dsbA of the present invention's structure
Mut) in prokaryotic system, produce research and development, the production functional enzyme proteinoid of recombination engineering medicine, diagnosis type reagent and study aspect the proteinic structure function etc. and all have the potential using value.
Summary of the invention
The present invention has made up a kind of universal prokaryotic fusion expression vector (pET-dsbA-dsbA
Mut).Utilize this carrier can realize that functional protein especially is rich in the solubility expression of functional protein in prokaryotic system of disulfide linkage, simultaneously, the recombinant protein of this carrier production is keeping having clear superiority aspect the target protein biological activity.
Fusion expression vector pET-dsbA-dsbA
mConstructional feature:
1) carrier is with the T7 promotor, and the expressive host bacterium is BL21 (DE3) series, induces Recombinant Protein Expression by IPTG.
2) translation initiation site contains the NcoI restriction enzyme site, can pass through NcoI restriction enzyme site independence express recombinant protein.
3) at DsbA and DsbA
mAlbumen and DsbA
mAnd all contain the flexible linker small peptide that 36 amino acid are formed between the target protein, help function and DsbA that DsbA exercises its oxidation disulfide linkage formation and molecular chaperones
mProteic short molten and improve the function of expression amount.
4) have histidine-taggedly at the N of fusion rotein end, the fusion rotein that helps expressing carries out affinity purification by metal a flat iron plate for making cakes resin.
5) multiple clone site that contains (MCS) comprises 6 restriction endonuclease sites GTCGAC (Sal), AAGCTT (HindIII), GCGGCCGC (NotI), GAATTC (EcoRI), GCTAGC (NheI), CTCGAG (XhoI), has more selectivity when making the foreign protein genes clone.
6) zymoplasm recognition site CTGGTGCCGCGCGGCAGC (LVPRGS) is arranged before multiple clone site, can the effect of cutting be purified into target recombinant protein to the fusion protease of expressing by zymoplasm.
Fusion expression vector (pET-dsbA-dsbA
Mut) advantage:
1) carrier is promotor with T7 and has the fusion companion body DsbA that improves expression amount
MutAlbumen makes the fusion protein expression amount of expression can account for more than 40% of bacterial protein.
2) contain DsbA in the fusion rotein of Biao Daing, this albumen can be assisted the formation of the correct folding and disulfide linkage of target protein.
3) under the expression condition optimized conditions, can obtain the fusion rotein solubility expression, the biological activity that this helps the purifying in later stage and keeps target protein.
4) foreign protein of expressing is not had selectivity, can make most eukaryotic proteins realize the highly-soluble expression.
Description of drawings:
Fig. 1 is fusion expression vector pET-dsbA-dsbA
MutThe mode chart (a) and the plasmid map (b) that make up;
Fig. 2 is pET-dsbA-dsbA
MutProtokaryon amalgamation and expression choleratoxin B subunit (CTB) SDS-PAGE analysis chart.Utilize choleratoxin B subunit (Cholera toxin B Subunit, CTB) whole cell fusion rotein, ultrasonication and the affinity purification SDS-PAGE analysis of vector expression.A:1. inductive whole cell wherein; 2. there is not the whole cell of inducing contrast; M.protein marker; B:M.protein marker; 3. the ultrasonic supernatant of thalline; 4. thalline ultrasound precipitation; C:1. nickel post one goes on foot affinity purification DsbA-DsbA
Mut-CTB; M.proteinmarker;
Fig. 3 is pET-dsbA-dsbA
MutProtokaryon amalgamation and expression prostate specific antigen (PSA) SDS-PAGE analysis chart.Utilize prostate specific antigen (prostate specific antigen, PSA) whole cell fusion rotein, ultrasonication, affinity purification SDS-PAGE analysis and the Western-Blot evaluation of vector expression.A:M:protein marker wherein; 1. there is not the whole cell of inducing contrast; 2. inductive whole cell; 3. the ultrasonic supernatant of thalline; 4. thalline ultrasound precipitation; B:M:protein marker; 1. nickel post one goes on foot affinity purification DsbA-DsbA
Mut-PSA albumen;
Fig. 4 is pET-dsbA-dsbA
MutProtokaryon amalgamation and expression growth factor of human nerve (hNGF) SDS-PAGE analysis chart.Utilize growth factor of human nerve (hNGF) whole cell fusion rotein, ultrasonication, affinity purification SDS-PAGE analysis and Western-Blot and the biological activity of vector expression to identify.A:M:proteinmarker wherein; 1. there is not the whole cell of inducing contrast; 2. inductive whole cell; B:3. the ultrasonic supernatant of thalline; 4. thalline ultrasound precipitation; M:protein marker; C:1. nickel post one goes on foot affinity purification DsbA-DsbA
Mut-hNGF albumen; M.protein marker;
Embodiment
The structure of embodiment 1, fusion expression vector
1) be basic framework with carrier pET-28a (Novagen company) at first, the dsbA sequence that pcr amplification obtains is cloned into carrier construction pET-dsbA among the carrier pET-28a by restriction endonuclease sites NdeI and BamHI.
2) adopt the method for rite-directed mutagenesis that original zymoplasm recognition site on the carrier is suddenlyd change, it is not being discerned by zymoplasm.
Before the sudden change:
CCATGGGCAGCCATCATCATCATCATCACAGCAGCGGC
CTGGTGCCGCGCGGCAGCCATATG
The underscore corresponding amino acid sequence is that LVPRGS is discerned by zymoplasm
The sudden change back:
CCATGGGCAGCCATCATCATCATCATCACAGCAGCGGC
ACTGTTTCTAGCGATAGCCATATG
The underscore corresponding amino acid sequence is that TKSSRS is not discerned by zymoplasm
3) obtain dsbA by rite-directed mutagenesis and overlapping PCR
MutSequence, point mutation comprise that TGC sports AGC (Cys sports Ser) and same sense mutation GGA sports GGT (Gly).Synthetic 108 base linker sequences, and then by overlapping PCR acquisition linker-dsbA
Mut-linker sequence is cloned among the carrier pET-dsbA by restriction endonuclease sites BamHI and XhoI, wherein at linker-dsbA
mIt is respectively GTCGAC (Sal), AAGCTT (HindIII), GCGGCCGC (NotI), GAATTC (EcoRI), GCTAGC (NheI) and CTCGAG (XhoI) that the C end of-linker sequence has multiple clone site (MCS) sequence.In multiple clone site (MCS) preceding containing zymoplasm recognition site sequence C TGGTGCCGCGCGGCAGC (LVPRGS) is arranged, thereby make up complete fusion expression vector pET-dsbA-dsbA
MutThe mode chart and the plasmid map of carrier construction are seen Fig. 1.
4) fusion rotein and multiple clone site nucleotide sequence are:
GCGCAGTATGAAGATGGTAAACAGTACACTACCCTGGAAAAACCGGTAG
CTGGCGCGCCGCAAGTGCTGGAGTTTTTCTCTTTCTTCTGCCCGCACTGCT
ATCAGTTTGAAGAAGTTCTGCATATTTCTGATAATGTGAAGAAAAAACTG
CCGGAAGGCGTGAAGATGACTAAATACCACGTCAACTTCATGGGTGGTGA
CCTGGGCAAAGATCTGACTCAGGCATGGGCTGTGGCGATGGCGCTGGGCG
TGGAAGACAAAGTGACTGTTCCGCTGTTTGAAGGCGTACAGAAAACCCAG
ACCATTCGTTCTGCTTCTGATATCCGCGATGTATTTATCAACGCAGGTATT
AAAGGTGAAGAGTACGACGCGGCGTGGAACAGCTTCGTGGTGAAATCTCT
GGTCGCTCAGCAGGAAAAAGCTGCAGCTGACGTGCAATTGCGTGGCGTTC
CGGCGATGTTTGTTAACGGTAAATATCAGCTGAATCCGCAGGGTATGGAT
ACCAGCAATATGGATGTTTTTGTTCAGCAGTATGCTGATACAGTGAAATAT
CTGTCCGAGAAAAAAGGATCC?
AAACCGGTAGCTGGCGCGCCGCAAGTGCTGGAGTTTTTCTCTTTCTTC?
GC
CCGCAC?
GCTATCAGTTTGAAGAAGTTCTGCATATTTCTGATAATGTGAAG
AAAAAACTGCCGGAAGGCGTGAAGATGACTAAATACCACGTCAACTTCAT
GGGTGG?
GACCTGGGCAAAGATCTGACTCAGGCATGGGCTGTGGCGATGG
CGCTGGGCGTGGAAGACAAAGTGACTGTTCCGCTGTTTGAAGGCGTACAG
AAAACCCAGACCATTCGTTCTGCTTCTGATATCCGCGATGTATTTATCAAC
GCAGGTATTAAAGGTGAAGAGTACGACGCGGCGTGGAACAGCTTCGGGT
GAAATCTCTGGTCGCTCAGCAGGAAAAAGCTGCAGCTGACGTGCAATTGC
GTGGCGTTCCGGCGATGTTTGTTAACGGTAAATATCAGCTGAATCCGCAG
GGTATGGATACCAGCAATATGGATGTTTTTGTTCAGCAGTATGCTGATACA
GTGAAATATCTGTCCGAGAAAAAA?
Wherein black matrix partly is the linker sequence, the black matrix underscore comprises that for the base rite-directed mutagenesis TGC sports AGC (Cys sports Ser) and same sense mutation GGA sports GGT (Gly), underscore is zymoplasm restriction enzyme site sequence C TGGTGCCGCGCGGCAGC (LVPRGS), in the frame is multiple clone site, includes 6 restriction endonuclease sites
[GTCGAC(Sal)AAGCTT(HindIII)GCGGCCGC(NotI)GAATTC(EcoRI)GCTAGC(NheI)CTCGAG(XhoI)]
Pcr amplification is obtained foreign gene (X) sequence be cloned into expression vector pET-dsbA-dsbA by multiple clone site (MCS)
MutOn.Transform among the expression strain BL21 (DE3), get the correct pET-dsbA-dsbA of order-checking
mThat LB of-X expression strain BL21 (DE3) adapter cultivates based on 37 ℃ and activates, and to make its final concentration be 0.3mmol when thalli growth density (OD) adds IPTG when value is about 0.4.Change 29 ℃ over to and continue to induce about 7 hours, the thalline of collect expressing, 6000 rev/mins, 4 ℃ centrifugal 5 minutes, the collecting precipitation thalline.Get the precipitation thalline and add 4 ℃ of carrying out ultrasonic bacteria breaking of 1 * PBS damping fluid, collect supernatant liquor and precipitation respectively, utilize the His label of fusion rotein N-terminal the fusion rotein in the supernatant to be carried out affinitive layer purification by Ni ion chelating resin.On the required buffer solution system of purifying was selected, our 1 * PBS system buffer system was in purge process, with the buffer solution elution bonded foreign protein of 50mmol imidazoles, with the buffer solution elution target protein of 150mmol imidazoles.Fusion rotein DsbA-DsbA by the metal chelating column affinitive layer purification
m-X detects through SDS-PAGE, and purity can both reach substantially＞and 90%.The fusion rotein water dialysis final vacuum ice of purifying is done-20 ℃ of refrigerators in back and is preserved.
Toxins,exo-, cholera is the main working substance that causes cholera diarrhoea, is made up of A, a B2 subunit, and its B subunit does not have toxicity, is linked to be a pentamer ring texture by 5 identical polypeptide chains with the non covalent bond form.Choleratoxin B subunit (Cholera toxin B Subunit, CTB) be carrier and the oral immunity adjuvant that a kind of ideal prepares disease-resistant vaccine, the CTB albumen that utilizes prokaryotic system to express at present all is that the form with inclusion body exists, and does not see the report that solubility expression is arranged.
At first by pcr amplification CTB product, with restriction enzyme SaLI, NotI double digestion PCR product, then under the effect of T4DNA ligase enzyme in the plasmid plasmid pET-dsbA-dsbA of same double digestion
mBe connected transformed into escherichia coli BL21 (DE3).
Secondly with the pET-dsbA-dsbA that transforms
mThat LB of-CTB expression strain BL21 (DE3) adapter cultivates based on 37 ℃ and activates, and to make its final concentration be 0.3mmol when thalli growth density (OD) adds IPTG when value is about 0.4, changes 29 ℃ over to and induce about 7 hours.Collect thalline and add 4 ℃ of carrying out ultrasonic bacteria breaking of 1 * PBS damping fluid, collect supernatant liquor and precipitation respectively, carry out the 12%SDS-PAGE electrophoresis, electrophoresis result shows: after prokaryotic expression system is expressed, and recombination fusion protein DsbA-DsbA
m-CTB obtains higher expression, and fusion rotein can account for tropina more than 20%.Find fusion rotein DsbA-DsbA through after the carrying out ultrasonic bacteria breaking
m-CTB the overwhelming majority all is to have in the ultrasonic supernatant (molecular weight is 60kDa) and account for more than 50% of supernatant total protein with soluble form.
Utilize the His label of fusion rotein N-terminal to pass through Ni ion chelating resin to fusion rotein DsbA-DsbA in the supernatant
m-CTB carries out affinitive layer purification.With the buffer solution elution bonded foreign protein of 50mmol imidazoles+1 * PBS, with the buffer solution elution target protein of 150mmol imidazoles+1 * PBS.Fusion rotein DsbA-DsbA by the metal chelating column affinitive layer purification
m-CTB detects through SDS-PAGE, and purity reaches＞and 90%.The fusion rotein water dialysis final vacuum ice of purifying is done-20 ℃ of refrigerators in back and is preserved, and the fusion rotein after ice is done is water-soluble to reach 100%.
Above experimental result is seen Fig. 2.
Prostate specific antigen (prostate specific antigen, PSA) be the tumor markers of diagnosing prostate cancer, it has brought into play huge effect in prostate cancer screening, diagnosis and monitoring after operation, PSA has the inhibition angiogenic action simultaneously, reduce tumour and form, suppress metastases and invasion and attack.The PSA that is applied to clinical diagnosis and treatment at present extracts from seminal fluid, and this method material collection is got loaded down with trivial details, can't produce in enormous quantities, and there is the report of solubility expression at the prokaryotic expression end.
Pcr amplification PSA nucleotide sequence is with the fusion expression vector pET-dsbA-dsbA of Not I and Sal I double digestion and same double digestion
MutLigase enzyme connects, with its transformed competence colibacillus e. coli bl21 (DE3).
Get expression strain and connect bacterium in fresh LB substratum, at OD in 1% ratio
600Be 0.4～0.6 o'clock, add inductor IPTG to final concentration be 0.3mmol/L, induce 7h for 29 ℃.Collect thalline and add 4 ℃ of carrying out ultrasonic bacteria breaking of 1 * PBS damping fluid, collect supernatant liquor and precipitation respectively, carry out the 12%SDS-PAGE electrophoresis, electrophoresis result shows: after prokaryotic expression system is expressed, and recombination fusion protein DsbA-DsbA
m-PSA obtains higher expression, and fusion rotein can account for tropina more than 40%.Find fusion rotein DsbA-DsbA through after the carrying out ultrasonic bacteria breaking
mThere is (molecular weight is 74kDa) in the ultrasonic supernatant in-PSA with soluble form, and accounts for more than 50% of supernatant total protein.
Utilize the His label of fusion rotein N-terminal to pass through Ni ion chelating resin to fusion rotein DsbA-DsbA in the supernatant
m-PSA carries out affinitive layer purification.With the buffer solution elution bonded foreign protein of 50mmol imidazoles+1 * PBS, with the buffer solution elution target protein of 150mmol imidazoles+1 * PBS.Fusion rotein DsbA-DsbA by the metal chelating column affinitive layer purification
m-PSA detects through SDS-PAGE, and purity reaches＞and 95%.The fusion rotein water dialysis final vacuum ice of purifying is done-20 ℃ of refrigerators in back and is preserved, and the fusion rotein after ice is done is water-soluble to reach 100%.
Get the DsbA-DsbA of purifying
m-PSA fusion rotein 12%SDS-PAGE.With the anti-people PSA of rabbit is an anti-Western engram analysis DsbA-DsbA
m-PSA fusion protein immunization originality, Western-Blot result shows: the fusion rotein DsbA-DsbA of prokaryotic expression
m-PSA can be special in conjunction with people source PSA antibody, the fusion rotein DsbA-DsbA of prokaryotic system expression and purifying be described
m-PSA has special immunogenicity.Utilize carrier pET-dsbA-dsbA
MutThe fusion rotein DsbA-DsbA that expresses
mThe antibody that-PSA can produce in conjunction with people source PSA is for monitoring, diagnosis and the treatment of clinical relative disease provides critical material.
Above experimental result is seen Fig. 3.
Embodiment 5, utilize carrier pET-dsbA-dsbA
MutProkaryotic expression growth factor of human nerve (hNGF)
NGF (nerve growth factor) helps the survival and the differentiation of maincenter and peripheral nerve unit, and senile dementia, peripheral neuropathy and Spinal injury are had therapeutic action.Complete NGF is by α, 3 kinds of peptide chains of beta, gamma with the form of α 2 β γ 2 by the non covalent bond be combined into, wherein the β subunit has nerve growth factor biological function completely.The β subunit is our usually said NGF, and it has 3 groups of disulfide linkage by 2 120 amino acid dimer by the non covalent bond be combined in each unit.Prokaryotic expression NGF expression amount is low, and biological activity is poor, and there is the report of prokaryotic cell prokaryocyte matter solubility expression at the end at present.
Pcr amplification hNGF nucleotide sequence is with the fusion expression vector pET-dsbA-dsbA of Sal I and Not I double digestion and same double digestion
MutLigase enzyme connects, with its transformed competence colibacillus e. coli bl21 (DE3).
Get expression strain and connect bacterium in fresh LB substratum, at OD in 1% ratio
600Be 0.3 o'clock, add inductor IPTG to final concentration be 0.3mmol/L, induce 7h for 29 ℃.Collect thalline and add 4 ℃ of carrying out ultrasonic bacteria breaking of 1 * PBS damping fluid, collect supernatant liquor and precipitation respectively, carry out the 12%SDS-PAGE electrophoresis, electrophoresis result shows: after prokaryotic expression system is expressed, and recombination fusion protein DsbA-DsbA
Mut-hNGF obtains higher expression, and fusion rotein can account for tropina more than 60%.Find fusion rotein DsbA-DsbA through after the carrying out ultrasonic bacteria breaking
Mut-hNGF major part is to have (molecular weight is 64kDa) in the ultrasonic supernatant with soluble form, and accounts for more than 50% of supernatant total protein.
Utilize the His label of fusion rotein N-terminal to pass through Ni ion chelating resin to fusion rotein DsbA-DsbA in the supernatant
Mut-hNGF carries out affinitive layer purification.With the buffer solution elution bonded foreign protein of 50mmol imidazoles+1 * PBS, with the buffer solution elution target protein of 150mmol imidazoles+1 * PBS.Fusion rotein DsbA-DsbA by the metal chelating column affinitive layer purification
Mut-hNGF detects through SDS-PAGE, and purity reaches＞and 98%.The fusion rotein desalination of purifying or water dialysis final vacuum ice are done-20 ℃ of refrigerators in back and are preserved, and the fusion rotein after ice is done is water-soluble to reach 100%.
Get the DsbA-DsbA of purifying
Mut-hNGF fusion rotein 12%SDS-PAGE.With the anti-people NGF of rabbit is an anti-Western engram analysis DsbA-DsbA
Mut-hNGF immunogenicity, Western-Blot result shows: the fusion rotein DsbA-DsbA of prokaryotic expression
Mut-NGF can be special in conjunction with people NGF antibody, the fusion rotein DsbA-DsbA of prokaryotic system expression and purifying be described
Mut-PSA has special immunogenicity.
With the positive contrast of mouse NGF of extracting, the negative contrast of aseptic PBS utilizes the chick embryonic dorsal root ganglion culture experiment to identify fusion rotein DsbA-DsbA
Mut-NGF biological activity.Observe chick embryonic dorsal root ganglion neurite-outgrowth situation down at inverted microscope (* 400 times), the result confirms fusion rotein DsbA-DsbA
Mut-NGF can urge the chick embryonic dorsal root ganglion neurite-outgrowth, has good biological activity.
Above experimental result is seen Fig. 4.
Claims (6)
1. protokaryon highly-soluble fusion expression vector pET-dsbA-dsbA
Mut, it is characterized in that utilizing the intestinal bacteria disulfide linkage to form DsbA and DsbA mutant DsbA in albumen (Disulfide bond) family
MutAlbumen series connection back (DsbA-L-DsbA
Mut) the fusion companion body of expressing as target protein.
2. according to method described in the claim 1, fused in tandem albumen can be DsbA-L-DsbA
MutOr DsbA
Mut-L-DsbA mode.
3. according to method described in the claim 1, in L in the series protein (linker) sequence base number can be 3 arbitrary integer doubly.
4. according to method described in the claim 1, DsbA-L-DsbA
MutOr DsbA
Mut-L-DsbA fusion rotein and foreign protein phraseology in prokaryotic expression system can be amalgamation and expression or coexpression form.
5. according to method described in the claim 1, DsbA-L-DsbA
MutOr DsbA
Mut-L-DsbA fusion rotein comprises amino acid change such as aminoacid deletion, increase or the displacement etc. of self aminoacid sequence or other form.
6. the described expression vector of claim 1 is in the medical research Application for Field.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100890182A CN101955969A (en) | 2009-07-20 | 2009-07-20 | Construction and application for general efficient and soluble pronucleus fusion expression vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100890182A CN101955969A (en) | 2009-07-20 | 2009-07-20 | Construction and application for general efficient and soluble pronucleus fusion expression vector |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101955969A true CN101955969A (en) | 2011-01-26 |
Family
ID=43483556
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100890182A Pending CN101955969A (en) | 2009-07-20 | 2009-07-20 | Construction and application for general efficient and soluble pronucleus fusion expression vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101955969A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517260A (en) * | 2011-12-29 | 2012-06-27 | 中国人民解放军军事医学科学院野战输血研究所 | Fusion protein carrying NS3 preponderant area of non-structural protein of bovine viral diarrhea virus as well as recombinant expression method and application thereof |
| CN103898146A (en) * | 2012-12-31 | 2014-07-02 | 石药集团中奇制药技术（石家庄）有限公司 | Method for preparing recombined human vascular endothelial cell growth factor A |
| CN112505330A (en) * | 2020-11-09 | 2021-03-16 | 昆明市妇幼保健院 | Novel coronavirus detection kit based on fusion protein of nucleocapsid protein |
| CN112500494A (en) * | 2020-11-09 | 2021-03-16 | 昆明市妇幼保健院 | Antigen for detecting novel coronavirus and preparation method thereof |
-
2009
- 2009-07-20 CN CN2009100890182A patent/CN101955969A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517260A (en) * | 2011-12-29 | 2012-06-27 | 中国人民解放军军事医学科学院野战输血研究所 | Fusion protein carrying NS3 preponderant area of non-structural protein of bovine viral diarrhea virus as well as recombinant expression method and application thereof |
| CN103898146A (en) * | 2012-12-31 | 2014-07-02 | 石药集团中奇制药技术（石家庄）有限公司 | Method for preparing recombined human vascular endothelial cell growth factor A |
| CN112505330A (en) * | 2020-11-09 | 2021-03-16 | 昆明市妇幼保健院 | Novel coronavirus detection kit based on fusion protein of nucleocapsid protein |
| CN112500494A (en) * | 2020-11-09 | 2021-03-16 | 昆明市妇幼保健院 | Antigen for detecting novel coronavirus and preparation method thereof |
| CN112500494B (en) * | 2020-11-09 | 2023-01-24 | 昆明市妇幼保健院 | Antigen for detecting novel coronavirus and preparation method thereof |
| CN112505330B (en) * | 2020-11-09 | 2024-03-29 | 昆明市妇幼保健院 | Kit for detecting novel coronavirus based on fusion protein of nucleocapsid protein |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2399031T3 (en) | Production of recombinant proteins by self-protection cleavage of a fusion protein | |
| JP4504014B2 (en) | Methods for producing insulinotropic GLP-1 (7-36) polypeptides and / or GLP-1 analogs | |
| JP2528232B2 (en) | Method for activating recombinant protein | |
| JPH06505624A (en) | Purification and directional cloning of peptides | |
| CN108912221A (en) | For producing auxilin, encoding gene, recombination fusion protein, recombinant expression carrier and the preparation method of recombination fusion protein | |
| CN111117977B (en) | Recombinant polypeptide linked zymogen, preparation method, activation method and application thereof | |
| CN113121704B (en) | Nanoparticle-based coronavirus vaccines | |
| JPH0376580A (en) | Escherichia coli manifestation vector and production of antiviral protein using the same | |
| US20160168226A1 (en) | Process for production of insulin and insulin analogues | |
| CN101955969A (en) | Construction and application for general efficient and soluble pronucleus fusion expression vector | |
| JP2003504069A (en) | Modified human granulocyte colony stimulating factor and production method thereof | |
| KR102038876B1 (en) | Novel peptides for enhancing soluble expression of target proteins | |
| CN112239760A (en) | Recombinant engineering bacterium for efficiently expressing recombinant hGH (human growth hormone) and construction method and application thereof | |
| JP7016552B2 (en) | How to increase the secretion of recombinant proteins | |
| AU2371195A (en) | Methods for peptide synthesis and purification | |
| CN114276413A (en) | Preparation method of artificial antibacterial peptide G3 | |
| CN113980880A (en) | Genetically engineered bacterium, application thereof and method for producing psicose by taking glucose as raw material | |
| KR20000059787A (en) | Preparation of Peptides by Use of Human Glucagon Sequence as a Fusion Expression Partner | |
| CN108913697B (en) | Pseudoleopard pardalus B family insecticidal gene, coded mature peptide thereof and application | |
| RU2376368C2 (en) | STRAIN OF BACTERIA Escherichia coli JM109/pHINS21 - PRODUCER OF HYBRID PROTEIN WITH HUMAN PROINSULIN AND METHOD FOR PRODUCTION OF HUMAN PROINSULIN | |
| RU2120475C1 (en) | Method of synthesis of polypeptide, hybrid dna (variants), fusion protein (variants) | |
| JPH0380096A (en) | Production of motilin-like polypeptide and recombinant dna and manifestation plasmid therefor | |
| CN112898407B (en) | Preparation method of recombinant camel-derived serum albumin | |
| CN103214561B (en) | Human hepatitis c virus core antigen and preparation method and application thereof | |
| CN107217069B (en) | Prokaryotic expression vector, rbFGF-2 expression method, engineering bacteria and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20110126 |