JPH0380096A - Production of motilin-like polypeptide and recombinant dna and manifestation plasmid therefor - Google Patents

Abstract

NEW MATERIAL:A recombinant DNA bound via Met to the downstream portion of the leader sequence polypeptide having at least six non-charged polar amino acid residues, with the Met at the C-terminal and motilin-like polypeptide bound thereto. The motilin-like polypeptide is expressed by the formula (A is Pro, Gly, Asn or Ser; B is Gly, Pro, Asn or Ser; C is Gln, Glu or Asp; D is Asn, Glu or Asp : E is Gln, Lys or Arg; X is amino acid residue except Met; Y is homoserine including homoserinelactone or polypeptide made up of < 10 amino acids and containing homoserine at the C-terminal). USE:Production of motilin-like polypeptides. PREPARATION:DNA fragments including the base sequence coding the amino acid sequence of motilin-like gene are segmented, put to chemical synthesis, and bound.

Description

Detailed Description of the Invention (Industrial Field of Application) The present invention relates to a motilin-like polypeptide, particularly a motilin-like polypeptide containing Hse at the C-terminus.
The present invention includes a method for producing a motilin-like polypeptide having a motilin-like polypeptide, a recombinant DNA for the same, and a plasmid for expression.

The polypeptide according to the invention can be used as a medicament, in particular for the treatment of gastrointestinal disorders.

(Prior Art) Motilin is a substance whose structure was first isolated from the upper small intestine mucosa of pigs by Brown et al., and is a type of peptide hormone.
"Can, J. Biochem," Vol. 52, pp. 7-10 (1974)]. This butamotilin is
It is composed of 22 amino acids and has a molecular weight of approximately 27
It is 00.

On the other hand, the present inventors isolated a cDNA clone of human-derived motilin and determined its structure, and as a result, it was revealed that its amino acid sequence was the same as that of pig-derived motilin (particularly Gansho 62-1
09757>.

The physiological effects of motilin are well known to include gastrointestinal motility enhancing effects and gastrointestinal smooth muscle contracting effects. Among these effects, regarding the gastrointestinal motility-promoting effect, for example, it has been reported that the effect shortens gastric emptying time ["G
astroenLerology” Volume 80 No. 456-
460 (1981)], and is known to cause strong contraction of gastrointestinal smooth muscle in both antrum and duodenum of rabbits and humans, independent of the nerve pathway. Therefore, since motilin facilitates gastrointestinal motility and no particular side effects have been reported, it has been considered effective in treating and diagnosing gastrointestinal disorders after surgery. The problem lies in the fact that prostacrancin is currently used to treat intestinal paralysis, etc., and that it has strong side effects.)

The 13th position in the amino acid sequence of motilin is methionine, but it has been reported that chemically synthesized polypeptides with an amino acid structure in which methionine is converted to leucine or norleucine also exhibit physiological activities similar to motilin [
”5cand, J, Ga5tr.

11, pages 119-203 (1976)], methionine at position 13 does not affect the activity and is thought to have almost no effect.

Furthermore, motilin-like polypeptides containing Hse at the C-terminus also exhibit physiological activity equal to or greater than motilin.
The inventors of the present invention et al. (Patent application 1986
-286 specification).

(Problems to be Solved by the Invention and Objects of the Invention) According to conventional technology, motilin is generally derived from pigs and obtained by extraction, and therefore it has been extremely difficult to mass produce it. On the other hand, even when chemical synthesis is used, motilin is a polypeptide with 22 amino acids, so it has been difficult to obtain it in large quantities at a low cost. That is, although motilin is expected to be effective in treating gastrointestinal disorders, its productivity has been a bottleneck and it has not been widely used in clinical treatments.

Therefore, research has been carried out to produce polypeptides with motilin-like activity at low cost by applying so-called "biotechnology" (Japanese Unexamined Patent Publication No. 71195/1983 and the patent application developed by the present inventors). (method described in the specification of 1986-208006, etc.).

However, the above-mentioned methods using biotechnology include a step of cleaving using bromcyanide, and the peptide containing Hse at the C-terminus generated at this time is removed by enzymatic treatment. This enzyme treatment step causes a decrease in yield and an increase in cost, and therefore poses a problem in actual mass production. Therefore, as a result of intensive research, the inventors of the present invention found the following (patent application No. 642
86 specification), it has been recognized that motilin-like polypeptides having Hse at the C-terminus have physiological activity equal to or greater than motilin, and therefore removal of the Hse portion is unnecessary. .

The present invention has been made based on these recently developed methods, and its essential purpose is to provide a method for producing motilin-like polypeptides more easily.

A secondary, but important, object of the present invention is to provide a highly efficient and inexpensive method of producing motilin-like polypeptides.

Another object of the present invention is to provide a novel recombinant DNA that can be used to carry out the above production method.

Still another object of the present invention is to provide an expression plasmid incorporating the above-mentioned 41 replacement DNA.

(Means and Printing for Solving the Problems and Achieving the Objects According to the present invention, the above problem can be solved by formula (1) % formula % [wherein A means Pro, Gly, Asn or Ser, and B is Gly, Pro, Asn or Ser, C means Gln, Glu or Asp, D means A
sn, Glu or Asp, E stands for Gln, L
ys or Arg; means a peptide] A method for producing a motilin-like polypeptide shown in
One i DNA encoding a peptide having at least six uncharged polar amino acid residues and a methionine at the end, and one DNA encoding the amino acid sequence shown by the above formula (1). A single-stranded DNA whose C-terminus is Met and each original DNi'l having a base sequence complementary to the base sequence in these original M DNAs are synthesized. Using single-stranded DN△, the above uncharged polar amino acids are used as a leader sequence, and the C-terminus is Met.
A double-stranded DNA is created that coats a polypeptide, and a specific restriction enzyme recognition site is added to each end of this double-stranded DNA, and a vector containing genetic information that allows expression of a foreign protein in E. coli is created. The plasmid is cut with restriction enzymes of the same type as both of the above restriction enzymes, and the plasmid is reconstituted by adding two synthetic 8i DNAs containing the above restriction enzyme recognition sites to the cut points, and the reconstituted plasmid is injected into microorganisms. The amino acid sequence shown by the above formula (1) and the C-terminal or M
et is produced as a part of the fusion protein, and then the microorganism is destroyed and then treated with bromcyan to separate the polypeptide represented by the above formula (1) from the above fusion protein. The problem is solved by a method for producing a motilin-like polypeptide, which is characterized in that the polypeptide is isolated by fractionation treatment, and the above-mentioned main objective is also achieved.

Here, a polypeptide having the amino acid sequence shown by the above formula (1) and having methionine (Met) at the C-terminus (converted to Hse after cleavage with bromcyanide) is produced in a microorganism and as part of a fusion protein. In order to produce a large amount of motilin-like polypeptide as a protein, multiple motilin-like polypeptide genes whose C-terminus is methionine (Met) are joined in tandem, thereby expressing the motilin-like polypeptide as a polymer protein. is important, but regarding linking multiple genes in tandem to motilin-like polypeptide 1 and incorporating them into an expression vector,
Since it has already been reported by the present inventors (Patent Application No. 63
-208006 specification>, this method can be used. Note that the amino acid sequence between the motilin-like polypeptide parts described above may have Met at the C-terminus. because,
This is because when a polymer protein consisting of a motilin-like polypeptide bound via Met is treated with bromcyanide, cleavage occurs at the Met portion and the protein is separated into monomers.

In the motilin-like polypeptide produced by the method of the present invention, X is the amino acid residue at position 13 in formula (1).
is considered to be an amino acid residue other than Met because if this site is 14et, cleavage will also occur at the MeL site at position 13 during the subsequent step, that is, when the produced fusion protein is treated with bromcyanide. This is because the desired polypeptide having motilin-like activity cannot be obtained. formula(
The reason why the C-terminus or Hse is the site corresponding to Y in 1) is that the desired polypeptide having motilin-like activity can be obtained only by the step of treating the produced fusion protein with bromcyanide. be. As a result of various studies, asparagine (Asn
), glutamine (G I n ), threonine (Thr
) and serine (Ser) were found to be suitable in terms of improving the expression rate. In the present invention, the reason why the amino acid at the end of the leader sequence peptide is composed of methionine (Met) is that the leader sequence portion can be easily removed in a later step, that is, by treatment with 3 frommsia. This is so that it can be cut and removed. still,
A single-stranded DNA encoding a polypeptide having the amino acid sequence shown in the leader sequence and formula (1) and having Met at the C-terminus (converted to Hse after being cleaved by bromcyan treatment) is divided. This can facilitate synthesis.

As is clear from the above description, the recombinant DNA according to the present invention comprises a leader sequence polypeptide having at least 6 residues of uncharged polar amino acids, and the above formula ( It is characterized in that polypeptides having the amino acid sequence shown in 1) and having Met at the C-terminus are linked. Also in this case,
Advantageously, a plurality of motilin-like polypeptides are joined in tandem, and the polypeptides are advantageously connected to each other by a peptide having Met at the C-terminus.

On the other hand, the expression plasmid according to the present invention is characterized by incorporating the dark blue DNA as described in 4- above.

(Examples, etc.) Next, the present invention will be described in further detail with reference to production examples and pharmacological activity test examples. In addition, in the following, motilin 13
position is converted to leucine (Leu) and Hse is converted to the 23rd position.
We will explain the production of a motilin-like polypeptide (L-leucine-13-motilin-homoserine) to which is added, but if the C-terminus is Hse, other motilin-like polypeptides (not containing methionine as an amino acid residue) can be produced. It should be noted that can be made in a similar manner.

Production Example 1 (1) Synthesis of DNA encoding motilin-like physiologically active polypeptide A motilin-like polypeptide in which position 13 was converted to Leu and Hse was added to position 23 had the following amino acid sequence. are doing.

5 10 Phe-Val-Pro-11e-Phe-Thr-T
yr-Gly-Glu-Leu13 15
20GIn-Arg-Leu-
Gln-Glu-Lys-Glu-Arg-As, n-
Lys3 Qly-Gln-Hse In the above polypeptide, Hse at position 23 is converted from 14 e L by treatment with bromcyan after the above polypeptide is produced by a microorganism.

It is known.

Therefore, the leader peptide (Met-Thr
-Met-11e-Thr-Asn-3er-Gln-
Gln-Gln-Gln-Gln-Gln-41e-P
The following formula (2
The double-stranded DNA fragment shown in ) was produced.

Formula (2) %Formula% The double-stranded DNA represented by the above formula (2) was synthesized as follows.

First, six types of single-stranded DNA having the following base sequences were synthesized using a DIJA synthesizer "Scene Assembler" manufactured by Pharmacia. Among these, equations (3) and (
8), (4) and (7), and (5) and (6) are DNAs that are complementary to each other except for part of the ends.

Formula (3) % Formula % Formula (4) 5' GATCTTCATGTTCGTTCCGATCTTC
ACCTACGGCGAACTGCAG 5″- 5′ Formula (5) % Formula % Formula (6) AGCTTATCACAGGATCCCCATCTGG
CCTTTGTTGCGCTCTTTTTCTTG Formula (7) %Formula% Formula (8) 5'-GATCTGTTGTTGTTGTTGTTGT
GAGTTCGTAATCATGGTCATG Single-stranded DNA represented by formulas (3) to (8)
After treating 8- with polynucleotide kinase and phosphorylating the 5' end, complementary DNA pairs of formulas (3> and (8), (4) and (7), and (5) and (6) The three double-stranded DNAs formed by annealing the
Formula (2) can be obtained by joining tandemly with ligase.
The DNA fragment shown in was obtained.

(2> Integration into an expression vector The procedure for integrating the synthetic NA fragment obtained in item (1) above into an expression vector will be explained with particular reference to FIG. 1.

Plasmid pTM1 with E. coli Trp promoter
was cut with the restriction enzymes HindIII and EcoRI, and the synthesized N obtained in section (1) above was added to the cut point.
The A fragment was conjugated with a plasmid for expression in Escherichia coli having a Trp promoter using DNA ligase to reconstruct a plasmid. This reconstituted plasmid is named pTMHl, and has an SD in the downstream region of the Trp promoter.
It is designed so that protein synthesis is initiated at a position 10 residues away from the sequence. □If this expression lasmid is introduced into Escherichia coli or the like, the protein can be induced with indole acrylic acid (IAA) or the like.

The above reconstituted vector contains restriction enzymes BglII and B
It is designed to have an amHI recognition site.

(3) Construction of an expression plasmid containing two or more motilin-like polypeptide genes For this, see Figure 2. First, the plasmid (pTM) obtained in section (2) above is treated with restriction enzymes EcoRI and BamHI to cleave at the upstream region of the motilin-like polypeptide gene portion and at one location within the vector to recover fragments. did. Next, the above (
Separately from the above cleaved plasmid obtained in Section 2), the plasmid (pTMHl) was treated with restriction enzymes EcoRI and BglII to obtain the same sites as above in the vector and the motilin-like polypeptide gene portion. The motilin-like polypeptide gene can be generated by cutting the downstream region so that it is common to the above-mentioned upstream region, and reconstructing the plasmid by joining the cut and recovered fragment to that break point using DNA ligase. An expression plasmid (pTMH2) containing two is obtained. In this case, the motilin-like polypeptide gene is Gly-
It is connected by a peptide of 11e-Phe-Met.

In the above case, the break point caused by the restriction enzyme BamHI and the break point caused by the restriction enzyme BglII are joined by DNA ligase, but this joining site is no longer a cleavage recognition site for these two enzymes. Therefore, by repeating the above-described cutting and joining operations, it is possible to obtain a plasmid in which an arbitrary number of motilin-like polypeptide genes are linked in tandem and a leader peptide sequence is provided upstream of the motilin-like polypeptide gene via a methionine.

4> Production of fusion protein containing motilin-like polypeptide A plasmid prepared as described in item (3) above and containing four motilin-like polypeptide genes linked in tandem. (pTMH4) was incorporated into Escherichia coli (HBIOI) to obtain a transformed bacterium [this has been internationally deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology (Feikokuken Article No. 2555)]. This transformed bacterium ampicillin 50 μg/m 1-containing culture medium (e.g., M
9 medium supplemented with 0.5% casamino acids> at 30°C using a D-type fermenter manufactured by Aiple Co., Ltd.
The cells were aerated and cultured. When A350 reached 0.6-0.8, indole acrylic acid (IAA) was added,
The final concentration was 15 μg/ml.

Thereafter, culture was continued for 16 hours, and then centrifuged (80
00 rpm, 4° C., 5 minutes). When a portion of this bacterial cell was collected and analyzed by SDS polyacrylamide gel electrophoresis (15%), it was found that the desired fusion protein accounted for approximately 30% of the total protein. This is presumed to be because the leader peptide sequence portion of the synthetic NA incorporated into the plasmid promotes the formation of granulocytes very efficiently and is hardly degraded by protease.

(5) Separation and purification of motilin-like polypeptide (4) above.
20 ml of paste-like bacterial cells (equivalent to 30 ml) obtained in section ).
After suspending in 0 ml of cold acetone, it was filtered with a glass filter, the residue was suspended in 300 ml of physiological saline, and the bacterial cells were destroyed by high-pressure homogenizer or ultrasonic treatment. The bacterial cell residue was pelleted by centrifugation at 110,000 rpm for 15 minutes. This pellet contains a fusion protein of a leader peptide and a motilin-like polypeptide tetramer.

Therefore, this pellet (500 mg protein) was
% formic acid solution, 500 mg of bromcyan was added to this solution, and the mixture was reacted overnight at a temperature of 30°C. After that, 840g of NaO and 20g of distilled water
The supernatant was collected by centrifugation treatment (1000 rpm x 20 minutes) and desalted using Sephadex G-15 to remove formic acid and bromocyanide, and the motilin was removed. The eluted fraction of similar polypeptides was treated with cation exchange chromatography, and then subjected to HP analysis using a Waters Microbondosphere C-18 column (19 mm x 15 cm).
It was purified by LC under the following conditions.

Eluent = 30% to 60% in 0.1% trifluoroacetic acid
Linear gradient of acetonitrile up to 30 minutes) Flow rate: 7. Oml/m1n The main peak portion obtained by HPLC was collected and lyophilized, and a portion of it was collected and examined using a peptide sequencer manufactured by Abrite Biosystems.
It was confirmed that it was a motilin-like polypeptide with the correct sequence having se.

By performing the operation as described above, 400-500% of the desired motilin-like polypeptide can be obtained by culturing 1 liter of E. coli.
I was able to obtain 0mg.

Physiological activity test example (measurement of intestinal contractile activity) Motilin-like polypeptide (L-leucine-1) obtained in the above production example
3-motilin-homoserine) was used as the test substance, pure motilin obtained by the synthetic method was used as the control substance, and the Magnus method using Uzaky's duodenum [J, Pharm, Phar
mac,” Vol. 28, p. 650,651 (1976)]
The intestinal contractile activity was measured according to the method, and the results were as shown in FIG.

As is clear from this figure, acetylcholine (10-6
It was confirmed that the intestinal contractile activity exhibited by L-leucine-13-motilin-homoserine obtained according to the present invention was at the same level as that of pure motilin, when the contraction by M) was taken as 100%.

(Effects of the Invention) According to the present invention, a DNA fragment including a base sequence encoding the amino acid sequence of a motilin-like gene is divided, chemically synthesized, and then combined to form a desired fragment. , synthesis of this DNA fragment is relatively easy. In this DNA fragment, a leader peptide sequence is present via methionine on the N-terminal side of the amino acid sequence encoding the motilin-like gene, and this motilin-like gene-containing DNA fragment is integrated into a 15 plasmid as a vector, and the plasmid is When cultured by ingesting the motilin-like active substance into a living organism, the leader peptide promotes the production of a motilin-like active substance, increasing production efficiency.

Incidentally, after the leader peptide sequence described above, multiple motilin-like genes can be linked in tandem via Met, and in this way, DNA containing multiple motilin-like genes can be incorporated into a plasmid and the Naturally, when a plasmid is incorporated into a microorganism and cultured, the expression rate of a motilin-like active substance can be significantly improved.

Moreover, the method of the present invention is extremely simple because the purification treatment is only a treatment with brom cyanide.

Therefore, the present invention makes it possible to produce motilin-like physiologically active substances at low cost and in large quantities, and can replace prosteracrandins, etc., which are currently used for post-operative intestinal paralysis of patients and have strong side effects. The goal is to provide the safest medicines possible.

6

[Brief explanation of drawings]

Figure 1 is an explanatory diagram showing construction B of a recombinant plasmid containing one motilin-like gene, which constitutes the main part of the method of the present invention, and Figure 2 is the same as Figure 1, but with the motilin-like gene. FIG. 3 is an explanatory diagram showing the construction mode of a genetically recombinant plasmid containing two tandem plasmids. It is a graph showing the results of measuring intestinal contractile activity by the McNas method. 7

Claims (5)

[Claims] (1) Formula (1) [There is a gene sequence] [In the formula, A means Pro, Gly, Asn or Ser, B means Gly, Pro, Asn or Ser, C
means Gln, Glu or Asp, D means Asn, G
lu or Asp, E is Gln, Lys or Ar
g, X means an amino acid residue other than Met, Y means homoserine (including homoserine lactone, “Hs
e) or amino acid 1 containing homoserine at the C-terminus
means any polypeptide within 0] A method for producing a motilin-like polypeptide shown in
A single-stranded DNA encoding a peptide having at least six uncharged polar amino acid residues and a methionine at the end, and an amino acid sequence encoding the amino acid sequence represented by the above formula (1). Then, a single-stranded DNA whose C-terminus is Met and each single-stranded DNA having a complementary base sequence to the base sequence in these single-stranded DNAs are synthesized. Using stranded DNA, the above uncharged polar amino acid is used as a leader sequence and the C-terminus is Met.
A double-stranded DNA encoding a polypeptide is created, specific restriction enzyme recognition sites are added to the ends of this double-stranded DNA, and a vector carrying genetic information capable of expressing a foreign protein in E. coli is created. The plasmid is cut with restriction enzymes of the same kind as both of the above restriction enzymes, the synthetic double-stranded DNA with the above restriction enzyme recognition site is added to the cut point to reconstruct the plasmid, and this reconstructed plasmid is taken into microorganisms. The microorganism is transformed and cultured to produce a polypeptide having the amino acid sequence represented by the above formula (1) and having Met at the C-terminus as part of a fusion protein, and then the microorganism is destroyed. A motilin-like polypeptide, which is characterized in that the polypeptide represented by the formula (1) is separated from the fusion protein by treatment with bromcyanide, and then the polypeptide is isolated by fractionation treatment. Manufacturing method. (2) The uncharged polar amino acid is asparagine (Asn),
The method for producing a motilin-like polypeptide according to claim 1, wherein the motilin-like polypeptide is selected from glutamine (Gln), threonine (Thr), and serine (Ser). (3) A reconstituted plasmid containing synthetic double-stranded DNA was treated with two types of restriction enzymes and cut at the upstream region of the gene encoding motilin-like polypeptide and at one location within the vector. The fragment was recovered, while the homologous reconstituted plasmid containing the above synthetic double-stranded DNA was digested with two types of restriction enzymes, one with the same restriction enzyme as above used for cutting within the vector. In yet another type, the downstream region of the gene encoding the motilin-like polypeptide is cut using a different restriction enzyme than the above-mentioned one, so that the downstream region of the gene region encoding the motilin-like polypeptide is common to the breakpoint of the above-mentioned upstream region, and the A plasmid is constructed by joining the cut and recovered fragments in tandem with DNA ligase, and repeating this operation as necessary to create a plasmid in which two or more genes encoding motilin-like polypeptides are integrated. The method for producing a motilin-like polypeptide according to claim (1) or (2), which comprises constructing a plasmid, ingesting this plasmid into a microorganism, and culturing it. (4) A leader sequence polypeptide having at least 6 residues of uncharged polar amino acids, which is linked downstream of this leader sequence polypeptide via methionine (Met), has Met at the C-terminus, and has the formula A recombinant DNA for producing a motilin-like polypeptide, characterized in that a polypeptide corresponding to (1) is linked thereto. (5) A leader sequence polypeptide having at least 6 residues of uncharged polar amino acids, which is linked downstream of this leader sequence polypeptide via methionine (Met), has Hse at the C-terminus, and has the formula An expression plasmid for producing a motilin-like polypeptide, characterized in that it incorporates a recombinant DNA to which a polypeptide corresponding to (1) is linked.