HU208996B - Process for producing recombinant human interleukin-1 alpha polipeptides and pharmaceuticals containing its - Google Patents

Abstract

The invention relates to homogeneous recombinant human interleukin-1α polypeptides, DNA sequences encoding such polypeptides, recombinant vectors containing such DNA, host organisms containing such a recombinant vector and methods of producing said polypeptides. The homogeneous recombinant human interleukin-1α polypeptides and pharmaceutical compositions containing such polypeptides can be used to stimulate a patient's immune system, promote wound healing, or promote recovery of critically ill, protein-malnourished patients.

Description

Two forms of human interleukin-1 are known; α and β forms (March et al., Natur. 315, 641647 (1985)). Analysis of the nucleotide sequence of DNA encoding Ahuman interleukin-1α (hIL-1α) revealed a 271 amino acid or open reading frame corresponding to the 30,606 Dalton hIL-1a precursor polypeptide. The hIL-1a precursor polypeptide is described by Gubler et al. Immunol. 136, 2492-2497 (1986)] are shown in Fig. 1a / 1b.

European Patent Publication No. 188 864 discloses that the C-terminal portion of the hIL-1a precursor polypeptide, from Ser-113 to Ala-271, is biologically active. The amino acid sequence of the hIL-1a precursor disclosed in European Patent Publication No. 188,920 differs from the amino acid sequence shown in Fig. 1a / 1b in that it contains Ser encoded by a TCA codon instead of 114 at Ala. No. 188,920. European Patent Application No. 5,123,123 discloses the preparation of various hILa polypeptides; the amino acid sequence of these hIL-1a polypeptides is the amino acid sequence shown in Figure 1a / Ib, 63-271, 113-271, 115-271. 123-271, 127-271, 128-271, 129-271, 113-267, 113 It ranges from positions -264, 113-266, 113-265 and 128-267, but, as noted above, the alanine residue at position 114 is replaced by a serine residue. European Patent Publication No. 200,986 discloses the preparation of a recombinant hILIIa polypeptide having an amino acid sequence of 118 to 271 and a methionine residue at position 117; the latter methionine can be derived from the ATG codon used to express the DNA fragment encoding the amino acid sequence at positions 118-271. Because the natural hIL-1a polypeptide contains a serine residue at position 117, the recombinant hIL-1a polypeptide produced as described in European Patent Publication No. 200,986 is isolated from the corresponding natural mature hIL-1a polypeptide from human body fluids or cultured human cell supernatant. end group. The modified N-terminal group present in the recombinant hIL-1a polypeptide may cause side effects in the patient treated with the recombinant polypeptide. To overcome these side effects, research has focused on the preparation of recombinant mature hIL-1a polypeptides having the same amino acid sequence as the native mature hIL-1a.

Surprisingly, it has been found that the amino acid sequence corresponding to the position 117-271 of the amino acid sequence of formula Ia in Fig. 1a / lb and the amino acid sequence of formula II in fig. 1a / lb is 120-271. A recombinant mature hIL-1α polypeptide having the amino acid sequence corresponding to the amino acid residue position 1 to position 2 of the amino acid residue position 3 to position 2 of the present invention can be prepared without the N-terminal methionine residue in Escherichia coli.

The present invention relates to a process

- homogeneous recombinant human interleukin-1? polypeptides comprising the amino acid sequence of formula (I) or (II);

- recombinant vectors containing DNA encoding the above polypeptides;

- producing E. coli containing the above recombinant vector capable of expressing the above DNA sequence.

The present invention also provides a process for the preparation of the above interleukin-α polypeptides. The present invention further relates to the preparation of a pharmaceutical composition comprising this polypeptide. The above polypeptides are useful in the preparation of a pharmaceutical composition for stimulating the immune system of the host, promoting wound healing, and improving the recovery of patients suffering from a critical disease or protein malnutrition.

The polypeptides of the present invention may be prepared by conventional methods of peptide synthesis in the liquid phase or preferably in the solid phase, e.g. By the method of Merifield [J. Chem. Soc. 85, 21492154 (1963)] or other equivalent methods known in the art.

Alternatively, it is advantageous to prepare the polypeptides of the invention by methods of recombinant DNA technology. In the process, a single-cell organism comprising a recombinant vector comprising the DNA sequence encoding the polypeptide of the mature human interleukin-1 of the invention is cultured under conditions capable of expressing the above DNA sequence and the human interleukin-1? Polypeptide produced by the single-cell organism is isolated from the culture.

These unicellular organisms may be prokaryotic or eukaryotic cells. Many such unicellular organisms are from commercially available or deposited sites [e.g. American Type Culture Collection (ATCC), 12 301 Parklawn Drive, Rockville, Maryland, USA]. Prokaryotic cells, e.g. bacteria, such as E. coli M15, designated DZ291, see Villarejo et al., J. Bacteriol. 120: 466474 (1974); E. coli 294 (ATCC No. 31,446); E. coli RR1 (ATCC Noo. 31,343); or E. coli W3110 (ATCC No. 27 325) bacilli, e.g. B. substilis. These include enterobacteria, of which e.g. Salmonella typhimurium and Serratia marcescens are mentioned. Especially preferred was the E. coli strain MC1061 containing the plasmid pRK248cIts. Alternatively, yeast cells (e.g., Saccharomyces cerevisiae) may be used as the host organism. One of ordinary skill in the art is aware of a number of eukaryotic cells that can be used as host organisms for recombinant vectors. Preferably, mammalian cells, e.g. CV-1 (ATCC No. CCL 70) and its derivatives, e.g. COS-1 (ATCC No. CRL 1650) or COS-7 (ATCC No. CRL 1651) is preferred. In addition, insect cells may be used (Smith et al., 1983, Mol. Cell. Biol. 2, 2156-2165).

Several methods are known for introducing recombinant vectors into single-cell organisms. Of these, e.g. microinjection, transfection or transduction. The specific host used

It is not difficult for the practitioner to choose the most appropriate method for the organization.

The recombinant vectors used in the method of the invention are vectors containing the DNA encoding the hIL-1a polypeptide of the invention; these DNAs contain a nucleotide sequence up to positions 385-852 or 394-852 of the nucleotide sequence shown in Figure 1a / Ib. Such DNA can be obtained by conventional chemical methods, e.g. by the phosphotriester method [Narang et al., Meth. Enzymol. 68, 90-108 (1979)] or by the phosphodiester method (Brown et al., Meth. Enzymol. 68: 109-151 (1979)]. In both methods, long oligonucleotides are first synthesized and then linked in a predetermined manner. The nucleotide sequence of the DNA may be the same or partially or completely different from the aforementioned nucleotide sequences. This is caused by the fact that the genetic code is degenerate, i.e. one amino acid can be encoded by more than one codon. The selected codons may be adapted to use the preferred codon for expression of the hIL-1a polypeptide (Grosjean et al., Gene 18: 199-209 (1982)). Care should be taken to ensure that the DNA thus obtained does not contain partial sequences which render the construction of the recombinant vector difficult (e.g., by introducing an unwanted restriction enzyme cleavage site) or inhibit expression of the polypeptide.

The DNA encoding the hIL-1a polypeptide of the present invention may also be prepared by DNA encoding the hIL-1a precursor polypeptide by methods known in the art (e.g., March et al., Supra; Gubler et al., Supra) from a human cDNA library or is isolated from a human genomic library and the DNA is brought to the desired shape and nucleotide sequence using known recombinant DNA technology using restriction endonucleases and optionally small synthetic oligonucleotides.

No. 200,986. A large number of vectors as described in European Patent Application EP-A-5,123,123 can be used to construct the above recombinant vectors. These vectors contain the elements necessary for the transcription and translation of the DNA encoding the hIL-1a polypeptide, as well as the elements necessary for the maintenance and replication of the vector in the host organism. The selection of single-cell host organisms compatible with the recombinant vectors of the present invention is within the skill of the art.

The recombinant vectors of the present invention may be prepared by other means and preferably by modifying the recombinant vectors containing the DNA encoding the hIL-1a polypeptide, an oligonucleotide site-directed mutagenesis method described by Morinaga et al. (BIO / TECHNOLOGY 2: 636-639 (1984)). using. Examples of such recombinant vectors containing a vector and DNA encoding the hILLA polypeptide are plasmid phil # 1-154 *. The construction of this plasmid is described in European Patent Publication No. 200,986.

The mode of expression of the polypeptide according to the invention depends on the expression vector used and the host organism used. Hosts containing the expression vector are generally cultured under optimal conditions for growth of the host organism. Towards the end of exponential growth, when the increase in cell number per unit time decreases, expression of the polypeptide of the invention is induced, i.e., the DNA code of the polypeptide is transcribed and the transcribed mRNA is translated. The induction can be accomplished by adding an inducer or depressor to the culture medium or by changing the physical parameters (e.g., changing the temperature).

The polypeptide produced in cellular organisms is either secreted from the cells by a specific transport mechanism or can be isolated by cellular digestion. Cell lysis is mechanical [Charm et al., Meth. Enzymol. 22, 476-556 (1971)], enzymatic (treatment with lysozyme) or chemical (treatment with detergent, urea or guanidine hydrochloride), or a combination thereof.

In eukaryotes, cell-secreted polypeptides are synthesized as precursor molecules. The mature polypeptide is the so-called. is produced by cleavage of the signal peptide. Because prokaryotic host organisms are unable to cleave eukaryotic signal peptides from precursor molecules, eukaryotic polypeptides must be expressed directly in their mature form in the prokaryotic host. At the DNA level, the AUG translation start signal corresponding to the ATG codon causes all polypeptides in prokaryotic hosts to be synthesized in the form of a methionine residue at the N-terminus. In some cases, depending on the expression system used and possibly the polypeptide to be expressed, the aforementioned methionine residue in the N-terminal group is cleaved.

The polypeptides of the invention may be purified to homogeneity by known methods. For this purpose, e.g. The following methods may be used: centrifugation at various speeds, precipitation of ammonium sulfate, dialysis (at normal or reduced pressure), preparative isoelectric focusing, preparative gel electrophoresis or various chromatographic methods, e.g. gel filtration, high performance liquid chromatography (HPLC), ion exchange chromatography, reverse phase chromatography, and affinity chromatography (e.g., on Sepharose® Blue CL-6B or on vehicle-bound monoclonal antibodies against hIL-1a polypeptide).

Purified hIL-1α polypeptides of the invention may be used in a manner known per se to stimulate the immune system of the host, e.g. by improving the host's defense response to pathogens, as a vaccine adjuvant, or by promoting host defense against neoplastic diseases. Other clinical uses of AhIL-Ια include: promoting wound healing by stimulating fibroblast proliferation and improving the healing and recovery of critically ill, protein-malnourished patients.

The homo3 produced by the process of the present invention

HU 208,996 én gene hIL-1a polypeptides may be administered to warm-blooded mammals within the above clinical indications. The active ingredient may be administered by any suitable conventional route, e.g. parenterally intravenously, subcutaneously or intramuscularly. The dosage of the active ingredient will, of course, vary with the nature and severity of the disease and condition being treated, the duration of treatment and the route of administration. Advantageously, the sterile-filtered lyophilized hIL-1a polypeptide is conventionally converted into a ready-to-use drug before use. The preparation of pharmaceutical compositions containing homogeneous human interleukin-1a according to the present invention is within the skill of the art. The pharmaceutical compositions may be prepared by admixing the interleukin-loc active ingredient with compatible pharmaceutically acceptable carriers (e. G. Buffers, stabilizers, bacteriostats and other excipients, and additives) for use in the preparation of parenteral pharmaceutical compositions.

The following examples further illustrate the process without limiting the invention to the examples.

Example

For the mutation of plasmid phil # 1-154 * (European Patent Application No. 200,986), the oligonucleotide described by Morinaga (BIO / TECHNOLOGY 2: 636-639 (1984)) utilizes the site-directed mutagenesis method shown in Fig. 1a / lb. genes encoding hIL-1a polypeptides comprising the amino acid sequence corresponding to positions 117-271, 119-271 and 120-271 of the sequence SEQ ID NO: 1-380. To perform the above procedures a

GGA ATT AAT ATG AGC TTC CTG AGC (0th 117), GGA ATT AAT ATG CTG AGC AAT GTG (0th 119) and GGA AAT AAT ATG AGC AAT GTG AAA (0th 120)

synthetic oligonucleotides containing nucleotide sequences by Matteucci et al. Chem. Soc., 103, 3185-3191 (1981)] is prepared by a solid support method.

Plasmid phil # 1-154 * was converted to a gap form using BglII and SalI and linearized using PstI. Gaped heteroduplexes are formed. The above oligonucleotides were annealed in three different reactions, double-stranded and ligated, and plasmid pRK248cIts [Bemard et al., Meth. Enzym. 68, 482-492 (1979)] in E. coli strain K-12 MC1061 (Casadaban et al., J. Mol. Biol. 138: 9-201 (1980)]; using the calcium chloride method (Maniatis et al., "Molecular Cloning: A Laboratory Manuel", 250251, Cold Spring Harbor Laboratory, 1982). Extra amino acids code i-1 phil l-154 ^x ATGAATAGAATTCGGATCCGC

Met pHuIL-Ία (117-271) GGAATTAATATG

Met

E. coli strain MCI061 and plasmid pRK248cIts available from the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland (USA) (accession no. ATCC 53338 and ATCC 33766),

Colonies containing the desired mutation were identified by the hybridization method described by Maniatis et al., Supra, pages 312-315. Oligonucleotides identical to those used for primer-directed mutagenesis were used as a template for hybridization to 5 'end of y- ³² P-ATP using polynucleotide kinase as described by Maniatis et al., Supra (page 396).

Oligonucleotide (0. 117) directs the conversion of phil # 1-154 * to pHuIL (117-271) with the following sequential modification:

118 119 120 121 TTC CTG AGC AAT Phe Leu Ser Asn 117 118 119 120 AGC TTC CTG AGC Ser Phe Leu Ser

Similarly, oligonucleotide (0. 119) generates pHuIL-α (119-271) with the following sequence:

119 120 121 122 GGAATTAATATG CTG AGC AAT GTG Met Leu Ser Asn With

GGAATTAATATG

120 121 122 123 AGC AAT GTG AAA

Similarly, oligonucleotide (0. 120) produces pHuIL (120-271) with the following sequence:

Met Ser Asn Val Lys

DNA sequence analysis confirmed the above mutations.

E1 expressing hIL-1 (118-271), pHuIL-1α (117-271), pHuIL1a (119-271), and pHuIL-1a (120-271), can be expressed in E1. coli MC1061 (pRK248cIts) see Publication No. 200,9864

(Patent Application _{No. 208,996} )) was grown on M9 medium containing ampicillin (Maniatis et al., Pp. 68-69 above) at 30 ° C until the absorbance at 550 nm (A _{55 O} ) reached 0.7. ; the cultures were then maintained at 42 ° C for 3 hours. Bacterial cells of 1 ml of culture were harvested by centrifugation and solubilized with 50 µl of 7 M guanidine hydrochloride. The interleukin-1 bioactivity of the crude bacterial extracts was determined by the rat / mouse thymocyte proliferation method of Mizel et al. Immunol. 720: 14971508 (1978)]. All four extracts were found to be active.

Insoluble cytoplasmic inclusion bodies were isolated from each of the four induced cultures, purified, solubilized as described above, and subjected to SDS polyacrylamide gel electrophoresis (Laemmli, Naturre 227: 680-685 (1970)). The major interleukin-ΐα band for each gel was as described by Aebersold et al. Biol. Chem. 267, 4229-4238. (1986)] and eluted by the method of Hewick et al. Biol. Chem. 256, 7990-7997. (1981)] subjected to N-terminal amino acid sequence analysis. After ten cycles we get the following results:

hIL-la. (117-271):

Ser Phe Leu Ser Asn Val Lys Tyr Asn Phe hIL-la (118-271):

Met Phe Leu Ser Asn Val Lys Tyr Asn Phe hIL-la ((119-271):

Met Leu Ser Asn Val Lys Tyr Asn Phe Met hIL-la (120-271):

Ser Asn Val Lys Tyr Asn Phe Met Arg Ile

It is seen that the initial methionine was cleaved from hIL-la (117271) and hIL-la (120-27l), hIL-la (119-271) or hIL-la (118-271) - but not about it.

For further study of the hIL-1a (117-271), hIL-1a (118-271) and hIL-1a (120-271) polypeptides, pHuIL-la (117-271), phil # 1-154 and purification of supernatant fractions of MC1061 / pRK248cIts transformants in the vicinity of pHuIL-loc (120-271) was performed as follows:

1. Cultures containing 5 to 5 kg of transformant were adjusted to pH 1.8 with sulfuric acid and allowed to stand at room temperature for 30-60 minutes, and the cells killed by the acid were recovered by centrifugation.

2. Acid-killed cells are suspended in 18 liters of water and stirred at room temperature with a mechanical stirrer for 1 hour.

3. The suspended material is screened through bilayer cellular tissue to remove cellular debris.

4. Approx. 5.5 x ^{10 7} Pa at a Manton-Gaulin cell homogenizer [Meth. Enzymol. 22, 482-484. (1971)], passed twice, first at 15 ° C and second at 30 ° C.

5. The material was centrifuged in a Sorvall centrifuge (Du Pont, Wilmington, Delaware, USA) at 8000 rpm for 4 hours at 4 ° C using a GS-3 rotor (DuPont). Approximately 16.6 liters of supernatant fluid was obtained and the pellet discarded.

6. Filter the supernatant liquid through a 0.8-0.2 micron Sartorius filter (manufactured by Sartorius Filters Inc., Hayward, California (USA) or Sertorius-Membranfilter GmbH, D-3400 Göttingen) and adjust the pH to 50. with sodium hydroxide solution (v / v) to 3.0.

7. Apply the supernatant liquid to a Nugel P-SP 10x40 cm column [sulfopropyl cation exchanger; 40-60 microns, 200 Angstroms; Separation Industries, Metuchen, New Jersey (USA)]; the column was previously equilibrated with 0.02 M acetic acid. After loading the sample, the column was washed with 31 L of 0.02 M acetic acid and eluted with 30 M TrisHCl, pH 8.0. The eluate leaving the column was analyzed spectrophotometrically at 280 nm. Two protein peaks are obtained, a first peak of 4.5 liters and a main peak of 7.5 liters.

8. The main peak obtained in Step 7 was loaded onto a 10 x 40 cm NuGel P-DE silica column (diethylaminoethyl anion exchanger; 40-60 microns, 200 Angstroms; Separation Industries), with 30 mM Tris-HCl (pH). 8.0) was pre-equilibrated. The column was washed with 17 L of 30 mM Tris-HCl and 0.075 M sodium chloride, pH 8.0, followed by 13 L of 30 mM Tris-HCl and 0.25 M sodium chloride, pH 8.0. ). The presence of proteins in the eluate is measured spectrophotometrically at 280 nm optical density (OD ₂₈₀ ) · The OD280 protein peak is obtained in a volume of 13 liters.

9. The eluate from step 8 was diluted four times with 3.7 mM acetic acid (pH 4.8), adjusted to pH 4.8, and applied to a 5x250 cm NuGel P-SP HPLC column (Separation Industries). up at a flow rate of 150 ml / min. The column was eluted with a linear gradient from pH 4.8 (3.75 mmol acetic acid) to pH 6.8 (10 mmol dipotassium hydrogen phosphate) at 75 mL / min for 120 minutes. The OD ₂₈₀ peak is obtained in a volume of 9.3 liters.

10. The eluate obtained from the HPLC column was in an Amicon spiral sleeve (1000 molecular weight cut; manufactured by Amicon from WR Grace and Co., Danvers, Massachusetts, USA) for approx. Concentrated to 225 ml and applied to two 10 x 100 cm columns of Sephadex® G-50 (Pharmacia Fine Chemicals, Piscataway, New Jersey, USA); the columns connected in series were pre-equilibrated with 50 mM dipotassium hydrogen phosphate solution and 0.1 M sodium chloride solution (pH 6.8). The OD ₂₈₀ peak obtained in an 800 ml volume is then deprotected in an Amicon spiral sleeve (30,000 molecular weight cuts). The final product is approx. It is obtained in a volume of 1070 ml.

All of the above purification steps were performed at 4 ° C, unless otherwise stated, except purification on an HPLC column which was carried out at room temperature.

Purified hIL-loc (117-271). hIL-1a (118-271) and hIL-1a (120-271) were subjected to SDS polyacrylamide gel electrophoresis as described above.

HU 208 996 és and stained with Coomassie blue. All proteins proved to be homogeneous.

Biological activity assays using purified proteins were reported by Kaye et al. Exp Med 158, 836-856. (1983)] rat / mouse D10 thymocyte proliferation method. The results obtained are summarized in Table I below.

Table I Activity of hIL-1a polypeptides

Protein Soluble hIL in the crude homogenate ^at (mg / kg) Specific activity of purified proteins (units / mg) hLL-lce (117-271) 1,800 2x10 ⁹ hIL-la (118-271) 600 2x10 ⁹ hIL-Itx (120-271) 600 2x10 ⁹

^a = the amount of soluble hIL-1α in the crude homogenate is calculated by immunoassay using hIL-1a specific antibodies.

The data in Table I (together with the data in Table I of European Patent Publication No. 200,986) show that the exact length of the hIL-1a protein is not critical as long as the amino acid sequence of Figure 132 in Figure 1a / lb. A minimal carboxy terminus sequence up to position 271 is present. All proteins have the same specific bioactivity. The data also show that the presence or absence of N-terminal initial methionine does not affect activity. In the N-terminal group, the activity of the additional methionine-containing hIL-1a (118-271) polypeptide is similar to that of the other two proteins, which do not contain methionine at this site.

It is also surprisingly found in Table I that the expression level of soluble hIL-1a (117-271) is three times higher than that of soluble hIL-1a (118271) and hIL-1a (120-271). the genes encoding the above proteins were located in the same vector and host cell and cultured and harvested in the same manner.

For a better understanding of the present invention, reference is made to Figure 1a / lb, which shows the nucleotide sequence and the expected amino acid sequence of the human interleukin-la cDNA.

Claims (4)

CLAIMS 1. A process for the preparation of a homogeneous recombinant human interleukin-1a polypeptide comprising the amino acid sequence of formula I or II free from the N-terminal methionine, comprising: a) culturing E. coli transformed with a recombinant expression vector comprising the DNA encoding said polypeptide under conditions suitable for expression of said DNA; and b) isolating the human interleukin-1a polypeptide from the culture and purifying it to homogeneity in a known manner. The method of claim 1 for the preparation of a homogeneous recombinant human interleukin-1a polypeptide comprising the amino acid sequence of formula (I): a) culturing E. coli transformed with a recombinant vector comprising the DNA encoding the above polypeptide under conditions suitable for expression of said DNA; and b) isolating the human interleukin-1a polypeptide from the culture and purifying it until homogeneity. 3. A method of producing a single-cell organism capable of expressing a polypeptide as defined in claim 1, wherein said E. coli organism is transformed with a recombinant expression vector containing DNA encoding said polypeptide in a manner known per se. 4. A process for the preparation of a pharmaceutical composition having interleukin-1a activity, wherein the homogenous recombinant human interleukin-1a polypeptide of claim 1 is mixed with pharmaceutically acceptable carriers and formulated into a pharmaceutical composition.