IL88934A - Recombinant human interleukin-1 polypeptides, their preparation and pharmaceutical compositions containing them - Google Patents

Recombinant human interleukin-1 polypeptides, their preparation and pharmaceutical compositions containing them

Info

Publication number
IL88934A
IL88934A IL8893489A IL8893489A IL88934A IL 88934 A IL88934 A IL 88934A IL 8893489 A IL8893489 A IL 8893489A IL 8893489 A IL8893489 A IL 8893489A IL 88934 A IL88934 A IL 88934A
Authority
IL
Israel
Prior art keywords
leu
ala
thr
lys
phe
Prior art date
Application number
IL8893489A
Other versions
IL88934A0 (en
Original Assignee
Hoffmann La Roche
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hoffmann La Roche filed Critical Hoffmann La Roche
Publication of IL88934A0 publication Critical patent/IL88934A0/en
Publication of IL88934A publication Critical patent/IL88934A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/545—IL-1
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Dermatology (AREA)
  • Biochemistry (AREA)
  • Obesity (AREA)
  • Diabetes (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to homogeneous recombinant human interleukin- 1 alpha polypeptides, to DNA sequences which code for such polypeptides, to recombinant vectors which contain a DNA of this type, to host organisms which contain a recombinant vector of this type, and to methods for the preparation of the said polypeptides. The homogeneous recombinant human interleukin-1 alpha polypeptides and pharmaceutical compositions which contain such polypeptides can be used to stimulate the immune system of a patient, to promote wound healing or to promote the recovery of seriously ill, protein-undernourished patients. [EP0324447A2]

Description

,ΏΊΚ OS ί?(ΰ 1α- V > li OJ N ¾Κ> O^Oa- -Ml "! a>"PO£J£l»i S dniN t t?Oan mnpii ^TeDtn onion Recombinant human interleukin-ΐα pol peptides, their preparation and pharmaceutical compositions containing them F. HOFFMAN -LA ROCHE AG., C: 76497 Two forms of human inter leukin-1 are known, the so-called a- and the β-form (March et al.. Nature 315, 641-647 [1985]). The analysis of. the nucleotide sequence of a DNA encoding human interleukin-la (hIL-la) revealed a large open reading frame of .271 amino acids, corresponding to a hIL-la precursor polypeptide having a molecular weight of 30 '606 Dalton. The nucleotide sequence and the amino acid sequence of the hIL-la precursor polypeptide as determined by Gubler et al., J. Immunol. 136.. 2492-2497 (1986) is shown in Fig. la/lb.
'Zarawski, SJVL et aL, [Gene 49., 61-68 (1986)] disclose the cloning and expression of the C-terminal 159 amino acids of human Interleukin-la as well as of muteins having a C-teiminal additional eleven amino acids and having deletions of six and fourteen N-terminal amino acids. In each case an N- terminal methionine amino acid is present?'.
European Patent Application. Publication No. 188 864 discloses that the C-terminal portion of the hIL-la precursor polypeptide extending- from Ser at position 113 to Ala at position 271 (Fig. la/lb) is biologically active.
European Patent Application. Publication No. 188 920 discloses a hIL-la precursor polypeptide which differs in the amino acid sequence from the amino acid sequence shown in Fig. la/lb by having a Ser at position 114 instead of a Ala, which Ser is encoded by the codon TCA. European Patent Application No. 188 920 discloses further the preparation of various hIL-la polypeptides, namely the hIL-la polypeptides having an amino acid sequence extending from positions 63 to 271. 113 to 271. 115 to 271. 123 to 271. 127 to 271. 128 to 271, 129 to 271. 113 to 267. 113 to 264. 113 to 266. 113 to 265 and 128 to 267 of the amino acid sequence shown in Fig. la/lb, but wherein, as mentioned above, the alanine residue at position 114, where present, is replaced by a serine residue. European Patent application^ Publication Wa/22.11.88 88934/2 - 2 - No. 200 986 describes the preparation of a recombinant hIL-Ια polypeptide having an amino acid sequence extending from position 118 to 271 and having a methionine residue at position 117, which methionine is derived from the ATG codon used for expressing a DNA fragment encoding the amino acid sequence from position 118 to 271. Since the natural hIL-Ια polypeptide has a serine residue at position 117 the recombinant hIL-Ια polypeptide prepared as described in European Patent Appliction. Publication No. 200 986 differs at the N-terminus from a corresponding natural mature hIL-Ια polypeptide isolated from a human body fluid or from a supernatant of a cultured human cell. In this publication, no distinction is made between hIL-la polypeptides comprising N-terminus methionines and those not comprising N-terminus methionines although the presence of the modified N-terminus in the recombinant hIL-la polypeptide might give rise to side effects in a patient treated with said recombinant polypeptide. In order to avoid such side effects ways and means were searched for methods for the preparation of recombinant mature hIL-la polypeptides which have an amino acid sequence which is identical to the amino acid sequence of the natural mature hIL-la. It was found that surprisingly the recombinant mature 1ilL-:la polypeptide having the amino acid sequence Ser Phe Leu Ser Asn Val Lys Tyr As Phe MET Arg He He Lys T r Glu Phe He Leu Asn Asp Ala Leu Asn Gin Ser He He Arg Ala Asn Asp Gin Tyr Leu Thr Ala Ala Ala Leu His Asn Leu Asp Glu Ala Val Lys Phe Asp MET Gly Ala Tyr Lys Ser Ser Lys Asp Asp Ala Lys He Thr Val He Leu Arg He Ser Lys Thr Gin Leu Tyr Val Thr Ala Gin Asp Glu Asp Gin Pro Val Leu Leu Lys Glu MET Pro Glu He Pro Lys Thr He Thr Gly Ser Glu Thr Asn Leu Leu Phe Phe Trp Glu Thr His Gly Thr Lys Asn Tyr Phe Thr Ser Val Ala His Pro Asn Leu Phe He Ala Thr Lys Gin Asp Tyr Trp Val Cys Leu Ala Gly Gly Pro Pro Ser lie Thr As Phe Gin He Leu Glu As Gin Ala (I) which amino acid sequence corresponds to the amino acid sequence extending from position 117 to 271 of the amino acid sequence shown in Fig. la/lb and the recombinant mature hIL-la polypeptide having the amino acid sequence Ser Asn Val Lys Tyr Asn Phe. MET Arg He He Lys Tyr Glu Phe He Leu Asn Asp Ala Leu Asn Gin Ser He He Arg Ala Asn Asp Gin Tyr Leu Thr Ala Ala Ala Leu His Asn Leu Asp Glu Ala Val Lys Phe Asp MET Gly Ala Tyr Lys Ser Ser Lys Asp Asp Ala Lys He Thr Val He Leu Arg He Ser Lys Thr Gin Leu Tyr Val Thr Ala Gin Asp Glu Asp Gin Pro Val Leu Leu Lys Glu MET Pro Glu He Pro Lys Thr He Thr Gly Ser Glu Thr Asn Leu Leu Phe Phe Trp Glu Thr His Gly Thr Lys Asn Tyr Phe Thr Ser Val Ala His Pro Asn Leu Phe He Ala Thr Lys Gin As Tyr Trp Val Cys Leu Ala Gly Gly Pro Pro Ser He Thr Asp Phe Gin He Leu Glu Asn Gin Ala (Π) which amino acid sequence corresponds to the amino acid sequence extending from position 120 to 271 of the amino acid sequence shown in Fig. la/lb can be produced in a unicellular organism without the N-terminal methionine residue.
Thus the present invention provides homogeneous recombinant human inter leukin-la polypeptides having the amino acid sequence (I) or (II). DNAs coding for said polypeptides, recombinant vectors containing a DNA coding for either of said polypeptides and unicellular organisms containing such a recombinant vector which unicellular organism is capable of expressing said DNA sequence.
Furthermore the present invention relates to a process for the production of said inter leukin-la polypeptides, to pharmaceutical compositions comprising such a polypeptide and to the use of said polypeptides or pharmaceutical compositions for stimulating the immune system of a host subject, for the promotion of wound healing and for improving the recovery of critically ill, protein-malnourished patients.
The polypeptides of the present invention may be produced by conventional methods of peptide synthesis in the liquid phase or, preferably, on the solid phase, such as the methods of Merrifield (J. Am. Chem. Soc. 85. 2149-2154 [1963]) or by other equivalent methods of the state of the art.
Alternatively and preferably, the polypeptides of the present invention are produced using methods of the recombinant DNA technology. Thereby a unicellular organism containing a recombinant vector containing a DNA sequence coding for a mature human inter leukin-la polypeptide of the present invention is cultured under conditions suitable for the expression of said DNA sequence and the human inte leukin-la polypeptide produced by the unicellular organism is isolated from the culture.
Such unicellular organism may be a prokaryotic or a eukaryotic cell. A large number of such unicellular organisms are commercially available or freely available from depositories such as the American Type Culture Collection (ATCC) located at 1230.1 Parkla n Drive, Rockville. Maryland. USA. Examples of prokaryotic cells are bacteria such as E.coli [e.g. E.coli M15 described as DZ291 by Villarejo et al. in J. Bacteriol. 120. 466-474 [1974], E.coli 294 (ATCC No. 31446). E.coli RR1 (ATCC No. 31343) or E.coli W3110 (ATCC No. 27325)]. bacilli such as B.subtilis and enterobacter iceae among which can be mentioned as examples Salmonella typhimurium and Serratia marcescens. Especially preferred is E.coli strain MC1061 containing the plasmid pRK248dts (see Example). Alternatively yeast cells such as Saccharomyces cerevisiae may be used as host organisms. A large number of eukaryotic cells suitable as host organisms for recombinant vectors are known to the man skilled in the art. Mammalian cells such as CV-1 (ATCC No. CCL 70) and derivatives thereof such as COS-1 (ATCC No. CRL 1650) or COS-7 (ATCC No. CRL 1651) are preferably used. In addition, it is possible to use insect cells such as described by Smith et al. (Mol. Cell. Biol. 2. 2156-2165 [1983]).
Various methods for introducing recombinant vectors into unicellular organisms are known. Examples for such methods are microinjection, transfection or transduction. The man skilled in the art has no difficulty to select the most suitable method foe the specific host organism used.
The recombinant vectors used in the present invention are vectors containing a DNA coding for the hIL-Ι polypeptide of the present invention such as the DNAs having the nucleotide sequence from position 385 to position 852 or from position 394 to position 852 of the nucleotide sequence shown in Fig. la/lb. Such a DNA may be synthesized by conventional chemical methods, e.g. by the phosphotr iester method which is described by Narang et al. in Meth. Enzymol. 68.. 90-108 id="p-1979" id="p-1979" id="p-1979" id="p-1979" id="p-1979"
[1979], or by the phosphodiester method (Brown et al.. Meth. Enzymol. 68_. 109-151 [1979]). In both methods long oligonucleotides are first synthesized and then joined together in a predetermined way. The nucleotide sequence of the DNA may be identical to the nucleotide sequences mentioned above or may be partially or completely different. This is due to the fact that the genetic code is degenerate, that means that one amino acid may be coded by several codons. The codons selected may be adapted to the preferred codon usage of the host organism used to express the hIL-la polypeptide (Grosjean et al.. Gene 18_. 199-209 [1982]). Care must be taken that the DNA obtained in this way does not contain partial sequences which make the construction of the recombinant vector difficult, e.g. by introducing an undesired restriction enzyme cleavage site, or which prevents the expression of the polypeptide.
The DNA coding for the hIL-la polypeptide of the present invention may also be prepared by isolating a DNA coding for the hIL-la precursor polypeptide from a human cDNA library or a human genomic library according to procedures known in the art (e.g. March et al., supra; Gubler et al., supra) and then tailoring the DNA to the desired size and nucleotide sequence using restriction endonucleases and possibly small synthetic oligonucleotides according to methods well known in the art of recombinant DNA technology.
A large number of vectors such as those mentioned in European Patent Application. Publication No. 200 986 may be used for constructing the recombinant vectors mentioned above. These vectors contain elements necessary for transcription and translation of the DNA coding for the hIL-Ια polypeptide as well as elements needed for the maintenance and replication of the vector in the host. The selection of a suitable vector for constructing the recombinant vectors of the present invention and the selection of a unicellular host organism compatible with said recombinant vectors is within the skills of an artisan in the field.
Alternatively and preferably the recombinant vectors of the present invention are prepared by modifying recombinant vectors containing a DNA coding for a hIL-Ια polypeptide using the oligonucleotide directed site specific mutagenesis method described by orinaga et al.. BIO/TECHNOLOGY 2 . 636-639 (1984). An example for such a recombinant vector containing a vector and a DNA coding for a hIL-la polypeptide is the plasmid phil #1-154*. The construction of this plasmid is described in European Patent Application, Publication No. 200 986.
The manner in which the expression of the polypeptides in accordance with the invention is effected depends on the expression vector and on the host organism used. Usually, the host organisms which contain the expression vector are grown up under conditions which are optimal for the growth of the host organism. Towards the end of the exponential growth, when the increase in the number of cells per unit time decreases, the expression of the polypeptide of the present invention is induced, i.e. the DNA coding for the polypeptide is transcribed and the transcribed mRNA is translated. The induction can be effected by adding an inducer or a derepressor to the growth medium or by altering a physical parameter, e.g. by a temperature change.
The polypeptide produced in the host organisms can be secreted from the cell by special transport mechanisms or can be isolated by breaking open the cell. The cell can be broken open by mechanical (Charm et al.. eth. Enzymol. 22, 476-556 [1971]). enzymatic (lysozyme treatment) or chemical (detergent treatment, urea or guanidine*HCl treatment, etc.) means or by a combination thereof.
In eukaryotes. polypeptides which are secreted from the cell are synthesized in the form of a precursor molecule. The mature polypeptide results by cleaving off the so-called signal peptide. As prokaryotic host organisms are not capable of cleaving eukaryotic signal peptides from precursor molecules, eukaryotic polypeptides must be expressed directly in their mature form in prokaryotic host organisms. The translation start signal AUG. which corresponds to the codon ATG on the level of the DNA, causes that all polypeptides are synthesized in- a prokaryotic host organism with a methionine residue at the N-terminus. In certain cases, depending on the expression system used and possibly depending on the polypeptide to be expressed this N-teminal methionine residue is cleaved off.
The polypeptides in accordance with the present invention can be purified to homogeneity by known methods such as, for example, by centrifugation at different velocities, by precipitation with ammonium sulphate, by dialysis (at normal pressure or at reduced pressure), by preparative isoelectric focusing, by preparative gel electrophoresis or by various chromatographic methods such as gel filtration, high performance liquid chromatography (HPLC) , ion exchange chromatography, reverse phase chromatography and affinity chromatography (e.g. on Sepharose™ Blue CL- 6B or on carrier-bound monoclonal antibodies directed against a tiIL-Ι polypeptide) .
The purified recombinant hIL-Ια polypeptides of the present invention can be employed in a manner known per se to stimulate the immune system of a host subject, such as. for example, by improving host defense response to pathogens, by acting as a vaccine adjuvant and by enhancing host defense against neoplastic diseases. Other clinical uses identified for hIL-Ια in the art include promotion of wound healing via stimulation of fibroblast proliferation and improvement of the recovery of critically ill. protein-malnourished patients.
Homogeneous hIL-la polypeptides prepared in accordance with this invention may be administered to warm blooded •mammals for the clinical uses indicated above. The administration may be by any conventional method such as by parenteral application either intravenously, subcutaneous ly or intramuscularly. Obviously, the required dosage will vary with the particular condition being treated, the severity of the condition, the duration of the treatment and the method for administration. A suitable dosage form for pharmaceutical use may be obtained from sterile filtered, lyophilized hIL-la polypeptide reconstituted prior to use in a conventional manner. It is also within the skill of the artisan in the field to prepare pharmaceutical compositions containing a homogeneous human inter leukin- la of the present invention by mixing said inter leukin- la with compatible pharmaceutically acceptable carrier materials such as buffers, stabilizers, bacte iostats and other excipients and additives conventionally employed in pharmaceutical parenteral dosage forms.
Example The oligonucleotide-directed site specific mutagenesis method described by Morinaga et al.. BIO/TECHNOLOGY 2 , 636-639 (1984) was used to mutate plasmid phil #1-154* (European Patent Application. Publication No. 200 986) to produce genes encoding hIL-la polypeptides having an amino acid sequence extending from position 117 to 271. 119 to 271 and 120 to 271 of Fig. la/lb. To carry out these procedures. synthetic oligonucleotides having the nucleotide sequences GGA ATT AAT ATG AGC TTC CTG AGC (O. 117), GGA ATT AAT ATG CTG AGC AAT GTG (O. 119) and GGA ATT AAT ATG AGC AAT GTG AAA (O. 120) were produced by the phosphoraraidite solid support method of Matteucci et al.. J. Am. Chem. Soc. 103. 3185-3191 (1981).
Plasmid phil #1-154* was converted to the gapped form using Bglll and Sail and to the linearized form using PstI. Gapped heteroduplexes were created. In three separate reactions, the above oligonucleotides were annealed. converted into a double-stranded form and ligated. and transformed into E.coli K-12 strain C1061 (Casadaban et al.. J. Mol. Biol. 138. 179-207 [1980]) containing the plasmid pRK248cIts (Bernard et al.. Meth. Enzym. .68, 482-492 [1979]) using the CaCl2- ethod (Maniatis et al.. in "Molecular Cloning: A Laboratory Manual", pp. 250-251, Cold Spring Harbor Laboratory [1982]). E.coli MC1061 and the plasmid pRK248cIts are available from the American Type Culture Collection. 12301 Parklawn Drive. Rockville. Maryland. USA under the accession numbers ATCC No. 53338 and ATCC No. 33766, respec ively.
Colonies containing the desired mutation were identified by hybridization as described by Maniatis et al. (supra, pp. 312-315). The same oligonucleotides used for primer-directed mutagenesis were used as probes for the hybridizations after 32 5' end labeling with γ- P-ATP using polynucleotide kinase according to the procedure of Maniatis et al.. supra. p. 396.
Oligonucleotide (O. 117) directed the conversion of phil #1-154* to pHuIL-la (117-271) with the following sequence modification: code for extra amino acids 118 119 120 121 phil #1-154* ATGAATAGAATTCGGATCCGC TTC CTG AGC AAT Met Phe Leu Ser Asn 117 118 119 120 pHuIL-la (117-271) GGAATTAATATG AGC TTC CTG AGC Met Ser Phe Leu Ser Similarly, oligonucleotide (O. 119) created pHuIL-la (119-271) with the following sequence: 119 120 121 122 GGAATTAATATG CTG AGC AAT GTG Met Leu Ser Asn Val; and oligonucleotide (O. 120) produced pHuIL-la (120-271) with the following sequence: 120 121 122 123 GGAATTAATATG AGC AAT GTG AAA Met Ser Asn Val Lys .
DNA sequence analysis confirmed the above mutations.
E. coli C1061/pRK248cIts containing phil ttl-154 (see European Patent Application. Publication Nr. 200 986. capable of expressing hIL-la (118-271)). pHuIL-la (117-271). pHuIL-la (119-271) and pHuIL-la (120-271) were grown in M9 media (Maniatis et al., supra, pp. 68-69) containing ampicillin at 30°C until the absorbance at 550 nra (A_c-.) reached 0.7, at which time the cultures were shifted to 42°C for 3 hours. The bacterial cells from 1 ml of culture were collected by centr ifugation and solubilized in 50 μΐ 7 M guanidine«HCl . The crude bacterial extracts were assayed for inter leukin-l bioactivity using the murine thymocyte proliferation assay of Mizel et al.. J. Immunol. 120. 1497-1508 (1978). All four extracts were active.
Insoluble cytoplasmic inclusion bodies were isolated from all four induced cultures, purified as described above, solubilized and subjected to SDS polyacrylamide gel electrophoresis (Laemmli, Nature 227. 680-685 [1970]). The major inter leukin-la band was eluted from each gel by the method of Aebersold et al., J. Biol. Chem. 261 , 4229-4238 (1986) and subjected to N~terminal amino acid sequence analysis by the method of Hewick et al., J. Biol. Chem. 256. 7990-7997 (1981). with the following results after 10 cycles: hIL--la (117 -271) : Ser Phe Leu Ser Asn Val Lys Tyr As Phe hIL--la (118 -271) : Me Phe Leu Ser Asn Val Lys Tyr As Phe hIL--la (119 -271) : Met Leu Ser Asn Val Lys Tyr Asn Phe Met hIL-la (120-271): Ser Asn Val Lys Tyr Asn Phe Met Arg lie It can ceadily be seen that the initiating methionine was cleaved from hIL-la (117-271) and hIL-la (120-271), but not from hIL-la (119-271) or hIL-la (118-271).
To further investigate the hIL-la polypeptides hIL-la (117-271). hIL-la (118-271) and hIL-la (120-271). purification of the supernatant fractions of lysates of MCl061/pRK248cIts trans f orraants harboring pHulL-la (117-271). phil #1-154 and pHuIL-la (120-271) was carried out as follows: 1. Cultures containing 5 kg of each transformant were adjusted to pH 1.8 with H2S0 and maintained at room temperature for 30 minutes to 1 hour, and the acid-killed cells were recovered by cent fugation. 2. The acid-killed cells were suspended in 18 liters water and stirred for 1 hour at room temperature with a mechanical -blade stirrer. 3. Suspended material was filtered through 2 double- layered cheese cloth sections to remove cell debris 4. The filtered material was passed twice through a Manton-Gaulin cell homogenizer (Meth. Enzymol. [ [11997711]])) ooppeerraatteedd aatt 88..000000 ppsi (approx. 5.5 x 10 Pa), first at 15°C. then at about 30°C 5. The material was centrifuged in a Sorvall centrifuge (Du Pont, Wilmington. Delaware. USA) at 4°C for 1 hour at 8.000 rpm. using a GS-3 rotor (Du Pont). About 16.6 liters of supernatant fluid were recovered, and the pellet was discarded . 6. The supernatant fluid was filtered through a 0.8/0.2 micron Sartorius filter (available from Sartorius Filters Inc., Hayward, California. USA or from Sartor ius- embranf ilter GmbH, D-3400 Gottingen) , after which the pH was adjusted to 3.0 with a 50% (v/v) sodium hydroxide solution. 7. The supernatant fluid was applied to a 10 x 40 cm Nugel P-SP silica column (a sulfopropyl cation exchanger; 40-60 micron, 200 Angstrom; Separation Industries. etuchen. New Jersey, USA) which had been equilibrated with 0.02 M acetic acid. After sample application, the column was washed with 31 liters of 0.02 M acetic acid and then eluted with 30 mM Tris-HCl, pH 8.0. Column effluent was monitored spectrophotometr ically at 280 nm. Two peaks of protein were thus obtained -- a 4.5 liter volume first peak and a 7.5 liter main peak. 8. The main peak from step 7 was applied to a 10 x 40 cm NuGel P-DE silica column (a diethylaminoethyl anion exchanger; 40-60 micron. 200 Angstrom; Separation Industries) which had been equilibrated with 30 mM Tris-HCl. pH 8.0. The column was washed with 17 liters of 30 mM Tris-HCl and 0.075 M NaCl. pH 8.0. and then eluted with 13 liters of 30 mM Tris-HCl and 0.25 M NaCl. pH 8.0. The effluent was monitored for the presence of proteins spectrophotometr ically at an optical density of 280 nm (O.D.28Q). An O.D.2g0 protein peak contained in a 13 liter volume was thereby obtained. 9. The eluate from step 8 was diluted 4 fold with 3.7 mM acetic acid, pH 4.8. adjusted to pH 4.8 and applied to a 5 x 250 cm NuGel P-SP HPLC column (Separation Industries) at a flow rate of 150 ml/min. The column was then eluted with a linear gradient of from pH 4.8 (3.75 mM acetic acid) to pH 6.8 (10 mM K2HP04) over a 120 minute period, at a flow rate of 75 ml/min. A 9.3 liter O.D. peak was thus 280 obtained . 10. The eluate from the HPLC column was concentrated to about 225 ml in an Amicon spiral cartridge (1,000 molecular weight cutoff, available from Amicon, Div. of W.R. Grace & Co.. Danvers. Massachusetts, USA) and then applied to two 10 x 100 cm Sephadex™ G-50 columns (Pharmacia Fine Chemicals, Piscataway. New Jersey, USA) in series which had been equilibrated with 50 mM 2HP04 and 0.1 M NaCl. pH 6.8.
An 800 ml volume O.D. peak was obtained which was 280 depyrogenated in an Amicon spiral cartridge (30,000 molecular weight cutoff). The final product was in a volume of about 1.070 ml.
Unless otherwise noted, all of the above purification steps were carried out at 4°C. except for the HPLC column which was run at room temperature.
The purified hIL-la (117-271). hIL-la (118-271) and hIL-la (120-271) proteins were subjected to SDS polyacrylamide gel electrophoret ic analysis as described above and stained with Coomassie blue. All were found to be in homogeneous form.
Bioactivity assays were carried out on the purified proteins using the murine DIO thymocyte proliferation assay of Kaye et al.. J. Exp. Med. 158. 836-856 (1983), with the results shown in Table I.
Table I Activity of hlL-lg Polypeptides Soluble hIL-Ια in Specific Activity of Crude Homogenate3 Purified Proteins Protein (mq/Κσ) (units/mq) hlL-la (117-271) 1.800 2 X 10 hIL-la (118-271) 600 2 X lo' hIL-la (120-271) 600 2 X 10' The amount of soluble hlL-la in the crude homogenate was calculated based upon an immunoassay using hIL-la specific antibodies.
The data of Table I (taken together with the data presented in Table I of European Patent Appliction.
Publication No. 200 986) show that the exact length of the hIL-la protein is not critical, as long as the minimum carboxy- terminus sequence extending from position 132 to 271 (Fig. la/lb) is present in the molecule. All of the proteins had the same specific bioactivity. The data also show that the presence or absence of an N- terminal initiation methionine does not affect activity. The polypeptide hIL-la (118-271) comprising an additional methionine at the N-terminus was as active as the other proteins, both of which lacked such methionine.
Surprisingly, the data of Table I also show that the level of expression of the soluble hIL-la (117-271) protein was three times the level of expression of the soluble hTL-la (118-271) and hIL- la (120-271) proteins, although the genes coding for the proteins were all in the same vector and host cell, and the cells were cultured and harvested in the same way.
The present invention will be more readily understood when considered in connection with the accompanying Figure la/lb which shows the nucleotide sequence and predicted amino acid sequence of human inter leukin- la cDNA.

Claims (15)

WHAT IS CLAIMED IS:
1. A homogeneous recombinant human inter leukin-la polypeptide having the amino acid sequence Ser Phe Leu Ser Asn Val Lys Tyr Asn Phe MET Arg He He Lys Tyr Glu Phe He Leu Asn As Ala Leu As Gin Ser He He Arg Ala Asn Asp Gin Tyr Leu Thr Ala Ala Ala Leu His Asn Leu Asp Glu Ala Val Lys Phe Asp MET Gly Ala Tyr Lys Ser Ser Lys Asp Asp Ala Lys He Thr Val He Leu Arg lie Ser Lys Thr Gin Leu Tyr Val Thr Ala Gin Asp Glu Asp Gin Pro Val Leu Leu Lys Glu MET Pro Glu He Pro Lys Thr He Thr Gly Ser Glu Thr Asn Leu Leu Phe Phe Trp Glu Thr His Gly Thr Lys Asn Tyr Phe Thr Ser Val Ala His Pro Asn Leu Phe He Ala Thr Lys Gin Asp Tyr Trp Val Cys Leu Ala Gly Gly Pro Pro Ser He Thr Asp Phe Gin He Leu Glu Asn Gin Ala or Ser As Val Lys Tyr Asn Phe MET Arg He He Lys Tyr Glu Phe He Leu As As Ala Leu Asn Gin Ser He He Arg Ala Asn Asp Gin Tyr Leu Thr Ala Ala Ala Leu His As Leu Asp Glu Ala Val Lys Phe Asp MET Gly Ala Tyr Lys Ser Ser Lys As Asp Ala Lys He Thr Val He Leu Arg He Ser Lys Thr Gin Leu Tyr Val Thr Ala Gin Asp Glu Asp Gin Pro Val Leu Leu Lys Glu MET Pro Glu He Pro Lys Thr He Thr Gly Ser Glu Thr Asn Leu Leu Phe Phe Trp Glu Thr His Gly Thr Lys Asn Tyr Phe Thr Ser Val Ala His Pro Asn Leu Phe He Ala Thr Lys Gin Asp Tyr Trp Val Cys Leu Ala Gly Gly Pro Pro Ser He Thr Asp Phe Gin He Leu Glu Asn Gin Ala.
2. A homogeneous recombinant human inte leukin-la polypeptide according to claim 1 having the amino acid sequence Ser Phe Leu Ser Asn Val Lys Tyr As Phe MET Arg He He Lys Tyr Glu Phe He Leu A n Asp Ala Leu Asn Gin Ser He He Arg Ala Asn Asp Gin Tyr Leu Thr Ala Ala Ala Leu His As Leu Asp Glu Ala Val Lys Phe Asp MET Gly Ala Tyr Lys Ser Ser Lys Asp Asp Ala Lys He Thr Val He Leu Arg He Ser Lys Thr Gin Leu Tyr Val Thr Ala Gin Asp Glu Asp Gin Pro Val Leu Leu Lys Glu MET Pro Glu He Pro Lys Thr lie Thr Gly Ser Glu Thr Asn Leu Leu Phe Phe Trp Glu Thr His Gly Thr Lys Asn Tyr Phe Thr Ser Val Ala His Pro Asn Leu Phe He Ala Thr Lys Gin Asp Tyr Trp Val Cys Leu Ala Gly Gly Pro Pro Ser He Thr Asp Phe Gin He Leu Glu Asn Gin Ala.
3. A DNA coding for a human inter leukin- la polypeptide as defined in claim 1 or 2.
4. A recombinant vector containing a DNA according to claim 3. which recombinant vector is capable of directing expression of said DNA in a compatible unicellular host organism.
5. A unicellular organism containing a recombinant vector according to claim 4 which unicellular organism is capable of expressing the DNA encoding the human inter leukin-la.
6. A homogeneous human inter leukin-la polypeptide according to claim 1 or 2 for stimulating the immune system of a host subject, for the promotion of wound healing and for improving the recovery of critically ill. protein-malnourished patients.
7. A process for producing a human inte leukin-la polypeptide as defined in claim 1 or 2 comprising: (a) culturing a unicellular organism according to claim 5 under conditions suitable for the expression of the DNA encoding the human inter leukin-la polypeptide; and (b) isolating the human inter leukin-la polypeptide from the culture and purifying it to homogeneity.
8. A pharmaceutical composition comprising a human inter leukin-la polypeptide according to claim 1 or 2 and a pharmaceutically acceptable carrier. - 19 88934/2
9. A human interleukin-la polypeptide according to Claim 1 or 2 prepared by a process according to Claim 7.
10. A homogeneous recombinant human interleukin- 1 apolypeptide according to Claim 1 as hereinbefore described.
11. A DNA sequence according to Claim 3 as hereinbefore described.
12. A recombinant vector according to Claim 4 as hereinbefore described.
13. A unicellular organism according to Claim 5 as hereinbefore described.
14. A process according to Claim 7 as hereinbefore described.
15. A pharmaceutical composition according to Claim 8 as hereinbefore described. 78497aaim/BG/be/18.3.19 3
IL8893489A 1988-01-15 1989-01-12 Recombinant human interleukin-1 polypeptides, their preparation and pharmaceutical compositions containing them IL88934A (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US14445788A 1988-01-15 1988-01-15

Publications (2)

Publication Number Publication Date
IL88934A0 IL88934A0 (en) 1989-08-15
IL88934A true IL88934A (en) 1994-05-30

Family

ID=22508674

Family Applications (1)

Application Number Title Priority Date Filing Date
IL8893489A IL88934A (en) 1988-01-15 1989-01-12 Recombinant human interleukin-1 polypeptides, their preparation and pharmaceutical compositions containing them

Country Status (19)

Country Link
EP (1) EP0324447B1 (en)
JP (1) JP2567079B2 (en)
AR (1) AR245958A1 (en)
AT (1) ATE142696T1 (en)
AU (1) AU616461B2 (en)
DE (1) DE58909723D1 (en)
DK (1) DK16489A (en)
ES (1) ES2091752T3 (en)
FI (1) FI890175L (en)
GR (1) GR3021887T3 (en)
HU (1) HU208996B (en)
IE (1) IE890087L (en)
IL (1) IL88934A (en)
MC (1) MC2002A1 (en)
NO (1) NO890174L (en)
NZ (1) NZ227594A (en)
PT (1) PT89438B (en)
YU (1) YU6889A (en)
ZA (1) ZA89202B (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3587605T2 (en) * 1984-12-25 1994-03-17 Dainippon Pharmaceutical Co Interleukin-1 and its derivative.
DE3818660A1 (en) * 1987-06-05 1988-12-15 Colgate Palmolive Co FREE-FLOWING, POWDERY DISHWASHING DETERGENT AND METHOD FOR PRODUCING THE SAME
US5120534A (en) * 1988-07-29 1992-06-09 Otsuka Pharmaceutical Co., Ltd. IL-1α derivatives and medicament for treating thrombocytopenia
US6191269B1 (en) * 1997-05-30 2001-02-20 The Regents Of The University Of California Selective induction of cell death by delivery of amino-terminal interleukin-1-α pro-piece polypeptide
US7176179B1 (en) 1997-05-30 2007-02-13 The Regents Of The University Of California Selective induction of cell death by delivery of amino-terminal interleukin-1-α pro-piece polypeptide
US20030154504A1 (en) 1998-06-24 2003-08-14 Farese Robert V. Methods and compositions for modulating carbohydrate metabolism
DE10252634A1 (en) * 2002-11-11 2004-05-27 Umwelttechnik Georg Fritzmeier Gmbh & Co. Purification of sewage or other substances laden with harmful organic matter and detergent or clarifying agent also useful laundry and cleaning surfaces involve introduction of photosensitizer releasing singlet oxygen when stimulated
WO2011038754A1 (en) * 2009-09-29 2011-04-07 United Technologies Ut Ag Oral care compositions containing human recombinant interleukin-1

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3587605T2 (en) * 1984-12-25 1994-03-17 Dainippon Pharmaceutical Co Interleukin-1 and its derivative.
DE3683186D1 (en) * 1985-04-25 1992-02-13 Hoffmann La Roche RECOMBINANT HUMANINTERLEUKIN-1.
DE3515217A1 (en) * 1985-04-26 1986-10-30 Siemens AG, 1000 Berlin und 8000 München DEVICE FOR MEASURING LOW MAGNETIC FIELDS
US5017692A (en) * 1986-09-04 1991-05-21 Schering Corporation Truncated human interleukin-a alpha

Also Published As

Publication number Publication date
DK16489A (en) 1989-07-16
FI890175A7 (en) 1989-07-16
JPH025892A (en) 1990-01-10
IL88934A0 (en) 1989-08-15
FI890175L (en) 1989-07-16
EP0324447B1 (en) 1996-09-11
YU6889A (en) 1990-08-31
FI890175A0 (en) 1989-01-13
NO890174D0 (en) 1989-01-13
DE58909723D1 (en) 1996-10-17
HU208996B (en) 1994-09-28
JP2567079B2 (en) 1996-12-25
PT89438B (en) 1993-09-30
AR245958A1 (en) 1994-03-30
GR3021887T3 (en) 1997-03-31
EP0324447A2 (en) 1989-07-19
EP0324447A3 (en) 1990-01-31
ATE142696T1 (en) 1996-09-15
AU2850989A (en) 1989-07-20
HUT50505A (en) 1990-02-28
ES2091752T3 (en) 1996-11-16
DK16489D0 (en) 1989-01-13
PT89438A (en) 1990-02-08
AU616461B2 (en) 1991-10-31
IE890087L (en) 1989-07-15
NO890174L (en) 1989-07-17
ZA89202B (en) 1989-09-27
MC2002A1 (en) 1990-01-26
NZ227594A (en) 1991-09-25

Similar Documents

Publication Publication Date Title
FI114398B (en) Recombinant nucleic acid sequence encoding a tumor necrosis factor (TNF) inhibitor, method of producing a recombinant tumor necrosis factor (TNF) inhibitor, vector useful in the method and recombinant host cell
Eschenfeldt et al. The human prothymosin alpha gene is polymorphic and induced upon growth stimulation: evidence using a cloned cDNA.
EP0335243B1 (en) Mutant human angiogenin (angiogenesis factor with superior angiogenin activity) genes therefor and methods of expression
CA1341240C (en) Dna encoding human tumor necrosis factor and human tumor necrosis factor polypeptide
ES2067486T5 (en) INHIBITING PROTEIN OF TUMOR NECROSIS FACTOR (TNF) AND ITS PURIFICATION.
KR960010949B1 (en) Pancreatic secretory trypsin inhibitor and its variants produced by genetic engineering
US5556767A (en) Polynucleotide encoding macrophage inflammatory protein γ
US6268180B1 (en) Recombinant human recombinant human interleukin-1α
EP0205475B1 (en) Recombinant methods for production of serine protease inhibitors and dna sequences useful for same
JP2533869B2 (en) DNA sequence encoding a protein having the biological activity of a HUSI type I inhibitor, recombinant cloning vector containing said DNA sequence and bacteria transformed with said vector
US5432261A (en) Motlin-like polypeptide and use thereof
AU616461B2 (en) Recombinant human interleukin-1 alpha polypeptides
US6143866A (en) Tumor necrosis factor (TNF) inhibitor and method for obtaining the same
CN101220092A (en) Structural analogue of human keratinocyte growth factor-1, its production method and application
US20130225500A1 (en) Analgesic active peptide vgg, preparation and use thereof
CA1339358C (en) Process for the preparation of motilin-like polypeptide and expression thereof
US6342374B1 (en) Human collagenase inhibitor, recombinant vector system for using same and recombinant-DNA method for the manufacture of same
EP0369316A2 (en) Recombinant interleukin-2 hybrid proteins
US6893844B1 (en) DNA encoding a new human hepatoma derived growth factor and producing method thereof
US5459049A (en) Motilin-like polypeptide and use thereof
JPH0380096A (en) Production of motilin-like polypeptide and recombinant dna and manifestation plasmid therefor
JP3534434B2 (en) Signal peptide for expression of thrombomodulins
JPH05308988A (en) Novel polypeptide, novel DNA, novel vector, novel transformant, novel pharmaceutical composition, and method for producing novel polypeptide
JPH07119237B2 (en) Hirudin mutant, its production method and anticoagulant
WO2012126150A1 (en) Peptide with analgesic activity and preparation method thereof

Legal Events

Date Code Title Description
RH Patent void