CN102190730A - Biotin protein ligase fusion protein - Google Patents
Biotin protein ligase fusion protein Download PDFInfo
- Publication number
- CN102190730A CN102190730A CN2010101466602A CN201010146660A CN102190730A CN 102190730 A CN102190730 A CN 102190730A CN 2010101466602 A CN2010101466602 A CN 2010101466602A CN 201010146660 A CN201010146660 A CN 201010146660A CN 102190730 A CN102190730 A CN 102190730A
- Authority
- CN
- China
- Prior art keywords
- leu
- protein ligase
- ligase enzyme
- biotin
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of biology technology, particularly relates to a biotin protein ligase fusion protein, gene, recombination expression vector, transformant and a preparation method of the biotin protein ligase fusion protein. The invention discloses a biotin protein ligase fusion protein like the following (a) or (b): (a) the amino acid sequence comprises the amino acid sequence shown in SEQ ID NO.1, the N end is protein of poly-alkaline amino acid; (b) a biotin protein ligase fusion protein at least has a 90 percent of homology with SEQ ID NO.1, the N end is protein of poly-alkaline amino acid possessing biotin protein ligase activity. The activity of the biotin protein ligase fusion protein is one time higher than that of the present commercialized BirA enzyme. The preparation method provided in the invention is characterized by simple technology and high output.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of biotin protein ligase enzyme fusion rotein, gene, recombinant expression vector, transformant and preparation method thereof.
Background technology
Biotin protein ligase enzyme (EC 6.3.4.15) can activate vitamin H and form biological acyl 5 ' adenylic acid (AMP), again vitamin H transferred on the vitamin H receptor protein, and also be the inhibition of the operon of vitamin H simultaneously, by the birA genes encoding.The biotin protein ligase enzyme extensively is present in prokaryotic organism and the Eukaryotic body, can be called vitamin H ligase enzyme, vitamin H operon aporepressor, vitamin H holoenzyme synthetic enzyme and holocarboxylase synthetase again, and the biotin protein ligase enzyme that is present in prokaryotic cell prokaryocyte has another name called the BirA enzyme.
The structure that spiral of 60 amino-acid residues formation of its N end changes spiral in the tertiary structure of BirA zymoprotein in the intestinal bacteria, this is the dna structure territory, and region intermediate forms catalytic domain, its C end structure is determined as yet.Molecular weight is about 35KD.In intestinal bacteria; the BirA enzyme is only discerned and a kind of protein type of biotinylation; be subunit biotin carboxyl carrier protein (the biotin carboxyl carrier protein of acetyl-CoA carboxylase; BCCP); because its biotinylated ability; the BirA enzyme has been widely used in the research of Study of Interaction between the protein molecule, particularly cell surface receptor-ligand interaction as a kind of important reagent.By on target protein, adding the peptide sequence that 1 energy discerned by the BirA enzyme (can biotinylated sequence B SP:Leu-His-His-Ile-Leu-Asp-Ala-Gln-Lys-Met-Val-Trp-Asn-H is-Arg), the BirA enzyme can be attached to vitamin H on the target protein, surveys target protein with regard to the avidin of serviceable indicia like this.Though the BirA enzyme is colibacillary proper constituent, existing commercial BirA enzyme cost an arm and a leg and activity not high.
Summary of the invention
Technical problem to be solved by this invention is to provide biotin protein ligase enzyme fusion rotein a kind of cheapness, that enzyme work is high and preparation method thereof.
For this reason, the invention discloses a kind of following (a) or biotin protein ligase enzyme fusion rotein (b):
(a) its aminoacid sequence comprises the described aminoacid sequence of SEQ ID NO.1, and its N end is the albumen of poly basic aminoacids;
(b) be the poly basic aminoacids and have the active albumen of biotin protein ligase enzyme with described aminoacid sequence 90% homology of SEQ ID NO.1, N end at least.
In one embodiment, described poly basic aminoacids is the poly Histidine, wherein preferred 6 polyhistidyls.
In one embodiment, described biotin protein ligase enzyme fusion rotein is the described aminoacid sequence of SEQ ID NO.2.
On the other hand, the invention discloses a kind of coding biotin protein ligase enzyme of the present invention fusion rotein polynucleotide molecule.
On the other hand, the invention discloses a kind of recombinant expression vector that comprises polynucleotide molecule of the present invention.
On the other hand, the invention discloses a kind of transformant that comprises recombinant expression vector of the present invention.
In one embodiment, described transformant is intestinal bacteria, is preferably e. coli bl21.
On the other hand, the invention discloses the preparation method of described biotin protein ligase enzyme fusion rotein, comprise the steps:
1. the structure of biotin protein ligase enzyme fusion protein expression vector;
2. the preparation of biotin protein ligase enzyme fusion rotein transformant;
3. biotin protein ligase enzyme Expression of Fusion Protein;
4. the purifying of biotin protein ligase enzyme fusion rotein.
In one embodiment, 4. step takes the metal-chelating column purification, is preferably nickel ion metal-chelating column purification.
Biotin protein ligase enzyme fusion rotein of the present invention exceeds about about 1 times than the activity of existing business-like BirA enzyme, and described preparation method's technology is simple, output is high.
Description of drawings
Fig. 1 is a PCR product electrophorogram;
Fig. 2 is a pET32-BirA plasmid transformant expression product SDS-PAGE electrophoresis;
Fig. 3 is a BirA1 bacterial classification large scale fermentation product S DS-PAGE electrophoresis;
Fig. 4 is a purified product SDS-PAGE electrophoresis;
Fig. 5 is BirA enzyme graphic representation alive;
Embodiment
At this paper, term described " biotin protein ligase enzyme " (Biotin Ligase, BirA, EC6.3.4.15), can activate vitamin H and form biological acyl 5 ' adenylic acid (AMP), vitamin H is transferred on the vitamin H receptor protein again, also be the inhibition of the operon of vitamin H simultaneously, by the birA genes encoding.Vitamin H-protein ligase extensively is present in prokaryotic organism and the Eukaryotic body, can be called vitamin H ligase enzyme, vitamin H operon aporepressor, vitamin H holoenzyme synthetic enzyme and holocarboxylase synthetase again, and the biotin protein ligase enzyme that is present in prokaryotic cell prokaryocyte has another name called the BirA enzyme.The aminoacid sequence of intestinal bacteria BirA enzyme is as described in the SEQ ID NO.1, and similar biotin protein ligase enzyme has 90% homology, and its biological action does not have species specificity.
Described protein of the present invention preferably this material is biotin protein ligase enzyme and mutant thereof; Its functional activity fragment or its analogue; Has for example dna vector (plasmid or virus) of proteinic carrier that the homologue of high homology and coding comprise the aminoacid sequence that SEQ ID NO.2 describes.Functional activity fragment or analogue can form by one or more amino-acid residue that adds, inserts, modifies, replaces or lack in the above listed aminoacid sequence.
Term " analogue " also comprises precursor and other functional equivalent or the stand-in of chimeric protein, fusion rotein, antiidiotypic antibody, above-claimed cpd.
Term " mutant " is meant the mutant of aminoacid sequence as biotin protein ligase enzyme as described in the SEQ ID NO.2.Than native protein, this mutant is compared with their wild-types, has the active and/or altered stereospecificity of enhanced.The aminoacid sequence mutant of native protein can be by introducing suitable Nucleotide variation or preparing by external synthetic required polypeptide in Nucleotide of the present invention.These mutant comprise, for example lack, insert or replace the residue in this aminoacid sequence.Can provide final protein product by disappearance, the combination of inserting and replacing to obtain final construct.
Proteic percent homology is analyzed (GCG program) by GAP (Needleman and Wunsh, 1970) and is determined, parameter gap creation penalty=5 wherein, gap extension penalty=0.3.When analyzed sequence length was at least 15 amino acid, GAP just analyzed and tests in 15 the amino acid whose zones that are at least of two sequences that participate in test.More preferably, when analyzed sequence length was at least 50 amino acid, GAP just analyzed and tests in 50 the amino acid whose zones that are at least of two sequences that participate in test.More preferably, when analyzed sequence length was at least 100 amino acid, GAP just analyzed and tests in 100 the amino acid whose zones that are at least of two sequences that participate in test.More preferably, when analyzed sequence length was at least 250 amino acid, GAP just analyzed and tests in 250 the amino acid whose zones that are at least of two sequences that participate in test.Even more preferably, when analyzed sequence length was at least 500 amino acid, GAP just analyzed and tests in 500 the amino acid whose zones that are at least of two sequences that participate in test.
The aspect that the present invention relates to also comprises biotin protein ligase enzyme analogue; carrying out different modifications between their synthesis phases or after synthetic; for example, by biotinylation, benzylization, glycosylation, acetylize, phosphorylation, by known protection/blocking groups derivatization, proteoclastic cutting action, be connected to antibody molecule or other cell ligand is first-class.These modifications can be used for increasing the stability and/or the biological activity of biotin protein ligase enzyme of the present invention.
Proteic expression
The present invention includes the DNA of coding biotin protein ligase enzyme of the present invention and carrier, the transformant that contains these DNA.
Among the present invention, the term of use " transformant " (transformant) promptly has the host cell of allogeneic dna sequence DNA molecule.
The present invention also comprises by synthetic and recombinant technology and produces proteic method of the present invention.Can separate and purifying polynucleotide (DNA or RNA), carrier, transformant and organism by methods known in the art.
Being used for carrier of the present invention can be as phage, plasmid, clay, minichromosome, virus or retroviral vector.The carrier that can be used for cloning and/or express polynucleotide of the present invention is to duplicate and/or to express the carrier that duplicates and/or express polynucleotide in the host cell of polynucleotide at need.In general, polynucleotide and/or carrier can be used for any eucaryon or prokaryotic cell prokaryocyte, comprise mammalian cell (as people (as HeLa), monkey (as Cos), rabbit (as the rabbit reticulocyte), rat, hamster (as CHO, NSO and baby hamster kidney cell) or mouse cell (as the L cell)), vegetable cell, yeast cell, insect cell or bacterial cell (as intestinal bacteria).Relevantly be applicable to that the example of the suitable carrier of broad variety host cell can be referring to for example F.Ausubel et al., Current Protocolsin Molecular Biology.Greene Publishing Associates andWiley-Interscience (1992) and Sambrook et al. (1989).Can use the host cell that contains these polynucleotide to come great expression to can be used for for example protein of medicine, diagnostic reagent, vaccine and therapeutical agent.
Having developed several different methods is used for via the complementary sticky end polynucleotide being operated with carrier and links to each other.For example, can add complementary with the aggressiveness sequence fragment by the DNA section in desire is inserted carrier DNA.Then by complementary with the hydrogen bond connection carrier between the aggressiveness and DNA section to form recombinant DNA molecules.
The synthetic linker that contains one or more restriction site provides the method for another kind of connection DNA section and carrier.Handle the DNA section that produces by the endonuclease restrictive diges-tion with phage T4DNA polysaccharase or e. coli dna polymerase I, described two kinds of polysaccharases with its 3 ', 5 '-exonucleolytic activity is removed outstanding γ-strand end, and mends flat 3 '-recessed end with its polymerization activity.Therefore, these active associatings have produced flush end DNA section.Then can catalysis the enzyme that connects of flush end dna molecular, as under the existence of phage T4DNA ligase enzyme the linkers of flush end section with molar excess being incubated.Therefore, reaction product is the DNA section that end carries the polylinker sequence.Use these DNA sections of suitable Restriction Enzyme cracking then, and be connected in the expression vector of using enzymatic lysis, described enzyme can produce and the compatible end of described DNA section.Can buy the synthetic linker that contains a plurality of restriction endonucleases site from a plurality of businessmans.
The polynucleotide inset should be operably connected to on the compatible suitable promotor of the host cell of expressing polynucleotide.Promotor can be strong promoter and/or inducible promoter.The example of some promotors of enumerating comprises phage PL promotor, intestinal bacteria lac, trP, phoA, tac promotor, SV40 is early stage and late promoter and retrovirus LTR promotor.Other suitable promotor is well known by persons skilled in the art.The express recombinant carrier further contains transcription initiation, termination site, and contains the ribosome bind site that is useful on translation at transcriptional domain.The encoding part of the transcript that recombinant vectors is expressed can comprise translation initiation codon that is positioned at the starting point place and the terminator codon that suitably is positioned at the end that is translated polypeptide (UAA, UGA or UAG).
As mentioned above, expression vector can comprise at least one selective marker.Described mark comprises Tetrahydrofolate dehydrogenase, G418, glutamine synthase or the neomycin resistance for eukaryotic cell culture; And the tsiklomitsin, kantlex or the ampicillin resistance gene that are used for intestinal bacteria and other microbial culture.Suitably host's representative example includes but not limited to: bacterial cell, as intestinal bacteria, streptomycete and salmonella typhimurium cell; The fungal cell is as yeast cell (as yeast saccharomyces cerevisiae or pichia pastoris phaff); Insect cell is as fruit bat S2 and noctuid SF9 cell; Zooblast, as CHO, COS, NSO, 293 and the Bowes melanoma cells; And vegetable cell.The appropriate culture medium of above-mentioned host cell and culture condition are known in the art.
For separation and purification effectively or secretion target protein, usually also can utilize label protein or the label polypeptide (Tag) of being convenient to separation and purification.Commonly used have glutathione-S-transferase (glutathioneS-transferase, GST), six polyhistidyl peptides (His.Tag), a-protein (protein A) and Mierocrystalline cellulose binding site (cellulose binding domain) etc.By the form of singularity albumen or polypeptide and target protein formation fusion rotein, utilize the special property of described label protein or label polypeptide to separate and purifying after the expression to target protein.Combine with Ni-ChelatingSepharose post specificity as His.Tag.Described label protein or label polypeptide can be removed fusion sequence with the locus specificity protease digestion behind purifying, as available zymoplasm, enteropeptidase and Xa factor etc., to obtain target protein.
The present invention also comprises the host cell that contains nucleotide sequence of the present invention, and described nucleotide sequence can be operated with one or more allos control region (as promotor and/or enhanser) through technology known in the art and link to each other.Can select to regulate the expression of the gene order of inserting, or can be according to the required particular form modification and the host strain of processed gene product.In the presence of some inductor, the expression that some promotor starts can raise; Therefore, can control polypeptide expression through genetic modification.In addition, different host cells have distinctive and special translation, translation post-treatment and the proteinic mechanism of modification (as phosphorylation, cracking).Can select suitable clone to guarantee that the exogenous protein of expressing is carried out desirable modification and processing.
By the transfection of calcium phosphate transfection, the mediation of DEAE-dextran, transfection, electroporation, transduction, infection or other method of cation lipid mediation, nucleic acid of the present invention and nucleic acid recombinant vectors can be imported host cell.Described method is described in the laboratory manual of a plurality of standards, as Davis et al., and BasicMethods In Molecular Biology (1986).
The proteic polynucleotide of the present invention of encoding can be connected to breed in the host with the carrier that contains selective marker.In general, can be at throw out, import plasmid vector in the mixture as calcium phosphate precipitation thing or itself and charged lipids.If carrier is a virus, can use suitable packing cell to tie up to and external it be packed, transduce to host cell again.
Can identify by successful cell transformed by well-known technology, promptly contain the cell of DNA recombinant vectors of the present invention.For example, can cultivate the cell of importing express recombinant carrier gained to produce required polypeptide.Collect and lysing cell, use as Southem (1975) J.Mol.Biol.95,503 or Berent et al (1985) Biotech.3,208 described methods detect the existence of DNA in its DNA content.Perhaps, use proteinic existence in the antibody test supernatant liquor.
By well-known method from the reconstitution cell culture, reclaim and purifying described albumen of the present invention comparatively favourable, described method comprise sulfuric acid by or ethanol sedimentation, acid extraction, negatively charged ion or cation-exchange chromatography, phosphorylated cotton chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, dewatering electric charge effect chromatography and lectin chromatography.In some embodiments, can use high performance liquid chromatography (HPLC) to carry out purifying.
In some embodiments, can use above-mentioned one or more chromatography method purifying described albumen of the present invention.In other embodiments, can use following one or more chromatography column purifying described fusion rotein of the present invention, described chromatography column has: Q sepharose FF post, SP sepharose FF post, Qsepharose High Performance post, Blue sepharose FF post, Blue post, PhenylSepharose FF post, DEAE Sepharose FF, Ni-Chelating Sepharose FF post or Methyl post etc.
In addition, can use the method purifying albumen of describing among the international publication number WO 00/44772 (listing this paper in as a reference in full) of the present invention.Those skilled in the art can easily change wherein said method to be used for purifying albumen of the present invention.Can be from comprising that for example the protokaryon or the eucaryon host of bacterium, yeast, higher plant, insect and mammalian cell reclaim albumen of the present invention through the product that recombinant technology produces.
Below in conjunction with specific embodiment, further illustrate the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer.
The structure of embodiment 1, expression vector
Pcr amplification upstream and downstream primer according to gene order design BirA enzyme is respectively: BirA-U1:5 ' TGCGGATCCATGAAGGATAACACCG 3 '; BirA-D1:5 ' TGCCCTCGAGTCATTTTTCTGCACTACG 3 ' is a template with the escherichia coli DH5a genomic dna, carries out pcr amplification with the pfu enzyme, the PCR reaction conditions: 95 ℃ 4 minutes; 95 ℃ 40 seconds, 52.5 ℃ 40 seconds, 72 ℃ 1 minute, totally 30 circulations; 72 ℃ 7 minutes; 4 ℃ of placements.The product that amplification is obtained carries out agarose gel electrophoresis and detects, and the result is illustrated in fig. 1 shown below, and wherein 1 be the PCR product of BirA, 2 be 250bp Marker from top to bottom 8 bands be followed successively by: 4.5kb, 3.0kb, 2.25kb, 1.5kb, 1.0kb, 750bp, 500bp, 250bp; Near 1.0kb, amplify specific band.
The specific PCR band of 1.0KB size on the sepharose is downcut, and blended rubber reclaims test kit recovery DNA wherein, through restriction endonuclease BamHI and Xho I double digestion, is connected with the carrier pET32a of BamHI/Xho I double digestion.Connect the competent cell of liquid transformed into escherichia coli bacterial strain Top10, be plated on the LB agar that contains penbritin.Separate the single bacterium colony transformed, amplification identifies positive colony, called after pET32-BirA/top10 with forward, the reverse primer PCR of BirA gene.Extracting plasmid pET32-BirA does preliminary evaluation by digestion with restriction enzyme, and result's demonstration successfully constructs.
Bacterium colony sample presentation to Shanghai Ying Jun Bioisystech Co., Ltd carries out sequence verification, sequencing primer is 5 ' T7promoter, 3 ' T7 terminator universal primer, sequencing result confirms that pET32-BirA is the correct construct of expression vector, and its dna sequence dna and designed BirA gene are identical.
The screening of expression strain
Extracting pET32-BirA plasmid, Calcium Chloride Method transform BL21 (DE3) host bacterium, obtain a plurality of clones, select 2 clones and express evaluation.In test tube, cultivate on a small quantity, after 0.5mM IPTG induces 4 hours, the results thalline.Carry out the SDS-PAGE electrophoresis behind the broken bacterium.Result such as Fig. 2,1 is BL21 (DE3) the host bacterium of empty pET32a among the figure; 2 is No. 1 clone; 3 is No. 2 clones;
Select the clone No. 1, protect and plant, called after BirA1 bacterial classification, and do further large scale fermentation.
Large scale fermentation
The BirA1 bacterial classification is in the LB substratum after the overnight incubation, the OD value is about 2.0, inoculate the 30L fermentor tank with 1% rate of vaccination then, 37 degree, pH keeps 7.0, and dissolved oxygen is controlled at 30%-60%, cultivated 5 hours, treat to begin feed supplement (30% glucose and 20% yeast powder mixed solution) about two hours after dissolved oxygen rises, add final concentration 0.5mM IPTG then and induced 4 hours, the results thalline.Broken bacterium SDS-PAGE electrophoresis, electrophorogram such as Fig. 3, wherein Marker from top to bottom 4 bands be followed successively by: 116KD, 66.2KD, 45KD, 35KD, 1, before fermentor tank is induced; 2, fermentor tank was induced 1 hour; 3, fermentor tank was induced 2 hours; 4, fermentor tank was induced 3 hours; 5, fermentor tank was induced 4 hours.Can observe target protein VR111 respective strap occurs.
Purifying
Use Ni-chelating nickel post to carry out the purifying of target protein.Get the BirA1 thalline that ferments, washes clean, be resuspended in level pad (50mM Tris, 0.5M NaCl, 20mM imidazol, PH8.0) in, the broken bacterium of high-pressure homogenization 2 times, centrifuging and taking supernatant.With level pad balance Ni-chelating nickel post, broken bacterium supernatant hanging column, use elution buffer (50mM Tris then, 0.5M NaCl, 500mMimidazol, PH8.0), collect each component of elution peak, collect protein-contg component, add glycerine and be diluted to 3mg/ml, frozen standby in-20 degree.SDS-PAGE electrophoresis detection purification result such as Fig. 4, wherein M be Marker from top to bottom 4 bands be followed successively by: 116KD, 66.2KD, 45KD, 35KD; 1 is elution peak component 1; 2 is the elution peak component; 3 is the elution peak component; 4 is the elution peak component; 5 is the elution peak component; 6 wear component for stream.
1, by following system VR111 albumen is carried out the biotinylation reaction:
| VR111-BSP | The BiomixA damping fluid | The BiomixB damping fluid | d-Biotin | The BirA enzyme | Altogether |
| 69ul | 10ul | 10ul | 10ul | 1ul | 100ul |
The VR111 albumen that wherein contains the BSP site is self-control, and concentration is 0.8mg/ml; The BiomixA damping fluid is 0.5M bicine, and pH 8.3; The BiomixB damping fluid is 100mM ATP, 100mM MgOAc, 200mMbiotin; D-biotin is 500mM biotin.The BirA enzyme is that (table source, Beijing Bioisystech Co., Ltd) two kinds bought in self-control and commercialization.Commercialization BirA enzyme is lived and is 5000U/ug albumen, and protein concentration is 3mg/ml.
Reaction solution placed room temperature reaction 12 hours.
2, biotinylation efficient detects:
The detection of biotinylation efficient is a direct enzyme-linked immunosorbent assay (ELISA).Wrap by 96 orifice plates with biotinylation reaction solution (being diluted to 3.2ug/ml) earlier.Bag was hatched 16 hours by 4 ℃ of plates, washed the plate rear enclosed.Every hole adds the Streptavidin of 100 μ l horseradish peroxidase-labeled.37 ℃ were reacted one hour, washed plate to remove unconjugated enzyme mark thing.Every hole adds 100 μ l colour developing liquid, color development at room temperature reaction 20 minutes.Last every hole adds the stop buffer color development stopping reaction of 50 μ l.Plate record result is read at 450nm wavelength place;
3, the result:
Measure the enzyme index alive of different protein concentrations, simulate roughly enzyme curve alive, as Fig. 5, and be that 5000U/ug albumen carries out standard reference with the work of commercialization BirA enzyme, calculate under the situation of 1ug enzyme usage quantity, the relative enzyme work of self-control BirA enzyme is: 5000U/ug* (2.096/1.007)=10389U/ug.The BirA enzyme of the homemade Trix of containing label exceeds about about 1 times than the activity of the BirA enzyme that commercialization is bought.
Scope of the present invention is not subjected to the restriction of described specific embodiments, and described embodiment also comprises the method and the component of functional equivalent only as the single example of illustrating all respects of the present invention in the scope of the invention.In fact, except content as herein described, those skilled in the art can easily grasp multiple improvement of the present invention with reference to above description and accompanying drawing.Described improvement also falls within the scope of appended claims.Every piece of reference mentioned above is listed this paper in as a reference all in full.
Sequence table
＜110〉Shanghai Runze Biotechnology Co., Ltd
＜120〉a kind of biotin protein ligase enzyme fusion rotein
＜130〉specification sheets sequence table
<160>2
<170>PatentIn?version?3.3
<210>1
<211>321
<212>PRT
＜213〉intestinal bacteria (Escherichia coli)
<400>1
Met?Lys?Asp?Asn?Thr?Val?Pro?Leu?Lys?Leu?Ile?Ala?Leu?Leu?Ala?Asn
1 5 10 15
Gly?Glu?Phe?His?Ser?Gly?Glu?Gln?Leu?Gly?Glu?Thr?Leu?Gly?Met?Ser
20 25 30
Arg?Ala?Ala?Ile?Asn?Lys?His?Ile?Gln?Thr?Leu?Arg?Asp?Trp?Gly?Val
35 40 45
Asp?Val?Phe?Thr?Val?Pro?Gly?Lys?Gly?Tyr?Ser?Leu?Pro?Glu?Pro?Ile
50 55 60
Gln?Leu?Leu?Asn?Ala?Lys?Gln?Ile?Leu?Gly?Gln?Leu?Asp?Gly?Gly?Ser
65 70 75 80
Val?Ala?Val?Leu?Pro?Val?Ile?Asp?Ser?Thr?Asn?Gln?Tyr?Leu?Leu?Asp
85 90 95
Arg?Ile?Gly?Glu?Leu?Lys?Ser?Gly?Asp?Ala?Cys?Ile?Ala?Glu?Tyr?Gln
100 105 110
Gln?Ala?Gly?Arg?Gly?Arg?Arg?Gly?Arg?Lys?Trp?Phe?Ser?Pro?Phe?Gly
115 120 125
Ala?Asn?Leu?Tyr?Leu?Ser?Met?Phe?Trp?Arg?Leu?Glu?Gln?Gly?Pro?Ala
130 135 140
Ala?Ala?Ile?Gly?Leu?Ser?Leu?Val?Ile?Gly?Ile?Val?Met?Ala?Glu?Val
145 150 155 160
Leu?Arg?Lys?Leu?Gly?Ala?Asp?Lys?Val?Arg?Val?Lys?Trp?Pro?Asn?Asp
165 170 175
Leu?Tyr?Leu?Gln?Asp?Arg?Lys?Leu?Ala?Gly?Ile?Leu?Val?Glu?Leu?Thr
180 185 190
Gly?Lys?Thr?Gly?Asp?Ala?Ala?Gln?Ile?Val?Ile?Gly?Ala?Gly?Ile?Asn
195 200 205
Met?Ala?Met?Arg?Arg?Val?Glu?Glu?Ser?Val?Val?Asn?Gln?Gly?Trp?Ile
210 215 220
Thr?Leu?Gln?Glu?Ala?Gly?Ile?Asn?Leu?Asp?Arg?Asn?Thr?Leu?Ala?Ala
225 230 235 240
Met?Leu?Ile?Arg?Glu?Leu?Arg?Ala?Ala?Leu?Glu?Leu?Phe?Glu?Gln?Glu
245 250 255
Gly?Leu?Ala?Pro?Tyr?Leu?Ser?Arg?Trp?Glu?Lys?Leu?Asp?Asn?Phe?Ile
260 265 270
Asn?Arg?Pro?Val?Lys?Leu?Ile?Ile?Gly?Asp?Lys?Glu?Ile?Phe?Gly?Ile
275 280 285
Ser?Arg?Gly?Ile?Asp?Lys?Gln?Gly?Ala?Leu?Leu?Leu?Glu?Gln?Asp?Gly
290 295 300
Ile?Ile?Lys?Pro?Trp?Met?Gly?Gly?Glu?Ile?Ser?Leu?Arg?Ser?Ala?Glu
305 310 315 320
Lys
<210>2
<211>327
<212>PRT
＜213〉artificial sequence (Artificial sequence)
<400>2
Met?His?His?His?His?His?His?Lys?Asp?Asn?Thr?Val?Pro?Leu?Lys?Leu
1 5 10 15
Ile?Ala?Leu?Leu?Ala?Asn?Gly?Glu?Phe?His?Ser?Gly?Glu?Gln?Leu?Gly
20 25 30
Glu?Thr?Leu?Gly?Met?Ser?Arg?Ala?Ala?Ile?Asn?Lys?His?Ile?Gln?Thr
35 40 45
Leu?Arg?Asp?Trp?Gly?Val?Asp?Val?Phe?Thr?Val?Pro?Gly?Lys?Gly?Tyr
50 55 60
Ser?Leu?Pro?Glu?Pro?Ile?Gln?Leu?Leu?Asn?Ala?Lys?Gln?Ile?Leu?Gly
65 70 75 80
Gln?Leu?Asp?Gly?Gly?Ser?Val?Ala?Val?Leu?Pro?Val?Ile?Asp?Ser?Thr
85 90 95
Asn?Gln?Tyr?Leu?Leu?Asp?Arg?Ile?Gly?Glu?Leu?Lys?Ser?Gly?Asp?Ala
100 105 110
Cys?Ile?Ala?Glu?Tyr?Gln?Gln?Ala?Gly?Arg?Gly?Arg?Arg?Gly?Arg?Lys
115 120 125
Trp?Phe?Ser?Pro?Phe?Gly?Ala?Asn?Leu?Tyr?Leu?Ser?Met?Phe?Trp?Arg
130 135 140
Leu?Glu?Gln?Gly?Pro?Ala?Ala?Ala?Ile?Gly?Leu?Ser?Leu?Val?Ile?Gly
145 150 155 160
Ile?Val?Met?Ala?Glu?Val?Leu?Arg?Lys?Leu?Gly?Ala?Asp?Lys?Val?Arg
165 170 175
Val?Lys?Trp?Pro?Asn?Asp?Leu?Tyr?Leu?Gln?Asp?Arg?Lys?Leu?Ala?Gly
180 185 190
Ile?Leu?Val?Glu?Leu?Thr?Gly?Lys?Thr?Gly?Asp?Ala?Ala?Gln?Ile?Val
195 200 205
Ile?Gly?Ala?Gly?Ile?Asn?Met?Ala?Met?Arg?Arg?Val?Glu?Glu?Ser?Val
210 215 220
Val?Asn?Gln?Gly?Trp?Ile?Thr?Leu?Gln?Glu?Ala?Gly?Ile?Asn?Leu?Asp
225 230 235 240
Arg?Asn?Thr?Leu?Ala?Ala?Met?Leu?Ile?Arg?Glu?Leu?Arg?Ala?Ala?Leu
245 250 255
Glu?Leu?Phe?Glu?Gln?Glu?Gly?Leu?Ala?Pro?Tyr?Leu?Ser?Arg?Trp?Glu
260 265 270
Lys?Leu?Asp?Asn?Phe?Ile?Asn?Arg?Pro?Val?Lys?Leu?Ile?Ile?Gly?Asp
275 280 285
Lys?Glu?Ile?Phe?Gly?Ile?Ser?Arg?Gly?Ile?Asp?Lys?Gln?Gly?Ala?Leu
290 295 300
Leu?Leu?Glu?Gln?Asp?Gly?Ile?Ile?Lys?Pro?Trp?Met?Gly?Gly?Glu?Ile
305 310 315 320
Ser?Leu?Arg?Ser?Ala?Glu?Lys
325
Claims (12)
1. one kind following (a) or biotin protein ligase enzyme fusion rotein (b):
(a) its aminoacid sequence comprises the described aminoacid sequence of SEQ ID NO.1, and its N end is the albumen of poly basic aminoacids;
(b) be the poly basic aminoacids and have the active albumen of biotin protein ligase enzyme with described aminoacid sequence 90% homology of SEQ ID NO.1, N end at least.
2. biotin protein ligase enzyme fusion rotein as claimed in claim 1 is characterized in that described poly basic aminoacids is the poly Histidine.
3. biotin protein ligase enzyme fusion rotein as claimed in claim 2 is characterized in that described poly Histidine is 6 polyhistidyls.
4. biotin protein ligase enzyme fusion rotein as claimed in claim 1 is characterized in that described biotin protein ligase enzyme fusion rotein is the described aminoacid sequence of SEQ ID NO.2.
5. coding claim 1 described biotin protein ligase enzyme fusion rotein polynucleotide molecule.
6. recombinant expression vector that comprises the described polynucleotide molecule of claim 5.
7. transformant that comprises the described recombinant expression vector of claim 6.
8. transformant as claimed in claim 7 is characterized in that described transformant is intestinal bacteria.
9. transformant as claimed in claim 8 is characterized in that described intestinal bacteria are e. coli bl21.
10. the preparation method of the described biotin protein ligase enzyme of claim 1 fusion rotein comprises the steps:
1. the structure of biotin protein ligase enzyme fusion protein expression vector;
2. the preparation of biotin protein ligase enzyme fusion rotein transformant;
3. biotin protein ligase enzyme Expression of Fusion Protein;
4. the purifying of biotin protein ligase enzyme fusion rotein.
11. preparation method as claimed in claim 10 is characterized in that 4. described step take the metal-chelating column purification.
12. preparation method as claimed in claim 11 is characterized in that described metal chelating column is the nickel ion metal chelating column.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101466602A CN102190730A (en) | 2010-03-15 | 2010-03-15 | Biotin protein ligase fusion protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101466602A CN102190730A (en) | 2010-03-15 | 2010-03-15 | Biotin protein ligase fusion protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102190730A true CN102190730A (en) | 2011-09-21 |
Family
ID=44599683
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101466602A Pending CN102190730A (en) | 2010-03-15 | 2010-03-15 | Biotin protein ligase fusion protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102190730A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108129571A (en) * | 2017-12-25 | 2018-06-08 | 上海捷瑞生物工程有限公司 | Taq DNA ligase fusion proteins |
| CN109880840A (en) * | 2019-03-18 | 2019-06-14 | 福建农林大学 | A kind of recombinant protein Escherichia coli vivo biodistribution element tagging system |
| CN114457048A (en) * | 2022-02-11 | 2022-05-10 | 中山大学 | Protein biotin ligase and adjacent protein labeling system and application thereof |
-
2010
- 2010-03-15 CN CN2010101466602A patent/CN102190730A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108129571A (en) * | 2017-12-25 | 2018-06-08 | 上海捷瑞生物工程有限公司 | Taq DNA ligase fusion proteins |
| CN109880840A (en) * | 2019-03-18 | 2019-06-14 | 福建农林大学 | A kind of recombinant protein Escherichia coli vivo biodistribution element tagging system |
| CN109880840B (en) * | 2019-03-18 | 2023-01-10 | 福建农林大学 | In vivo biotinylation labeling system for recombinant protein escherichia coli |
| CN114457048A (en) * | 2022-02-11 | 2022-05-10 | 中山大学 | Protein biotin ligase and adjacent protein labeling system and application thereof |
| CN114457048B (en) * | 2022-02-11 | 2024-04-16 | 中山大学 | Protein biotin ligase and adjacent protein marking system and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593126B (en) | Polypeptide, its production method and purposes | |
| CN110845603B (en) | Human collagen 17-type polypeptide, production method and use thereof | |
| Wong et al. | Characterization and structure of an endoglucanase gene cenA of Cellulomonas fimi | |
| Shapiro et al. | Expression of Met-(− 1) angiogenin in Escherichia coli: conversion to the authentic< Glu-1 protein | |
| Ko et al. | Targeting of proteins to the thylakoid lumen by the bipartite transit peptide of the 33 kd oxygen‐evolving protein. | |
| Howe et al. | Nucleotide sequences of the genes for the alpha, beta and epsilon subunits of wheat chloroplast ATP synthase | |
| CN110373404B (en) | Enzyme mutant | |
| CN108822209A (en) | Polypeptide, its production method and purposes | |
| NO301487B1 (en) | Isolated nucleic acid molecule encoding a thermally stable cytosine deaminase, recombinant expression vector, host cell and method for producing recombinant thermally stable cytosine deaminase | |
| EP1220933B1 (en) | Purification of recombinant proteins fused to multiple epitopes | |
| CN113736763B (en) | Myrosinase Rmmr and application thereof in preparation of sulforaphane and sulforaphane | |
| CN112209995A (en) | Preparation method of novel coronavirus surface protein receptor binding region | |
| JPH06303987A (en) | Method of carrying nucleic acid to cell | |
| KR20130020206A (en) | Recombinant e. coli producing soluble bmp-2 and method for producing soluble bmp-2 using the same | |
| CN102190730A (en) | Biotin protein ligase fusion protein | |
| CN113087804A (en) | Bivalent plant immune fusion protein and production method and application thereof | |
| WO2022109058A1 (en) | Nucleases comprising cell penetrating peptide sequences | |
| US6133034A (en) | Methods and compositions related to the production of trehalose | |
| CN111410695B (en) | Chimeric molecule based on autophagy mechanism mediated Tau protein degradation and application thereof | |
| CN107903307A (en) | A kind of high-affinity EDB FN targeting proteins peptides and its application | |
| CN110845625A (en) | Cell-penetrating peptide-pre-B cell leukemia transcription factor 1 fusion protein and preparation method and application thereof | |
| CN114045276B (en) | Neutral zearalenone degrading enzyme mutant with specific activity improved | |
| CN112877309B (en) | N-terminal extended PTEN subtype PTEN zeta protein and coding gene and application thereof | |
| KR20070006094A (en) | S-adonosylmethionine-6-n-lysine-methyltransferase from neurospora crassa, a gene encoding the same, a vector and host cell containing the same, and method for producing trimethyllysine using the host cell | |
| CN101955969A (en) | Construction and application for general efficient and soluble pronucleus fusion expression vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110921 |