CN114045276B

CN114045276B - Neutral zearalenone degrading enzyme mutant with specific activity improved

Info

Publication number: CN114045276B
Application number: CN202111322894.2A
Authority: CN
Inventors: 张桂敏; 王美星; 李佳维; 李晓迪; 巫攀; 袁其朋
Original assignee: Beijing University of Chemical Technology
Current assignee: Beijing University of Chemical Technology
Priority date: 2021-11-09
Filing date: 2021-11-09
Publication date: 2023-08-29
Anticipated expiration: 2041-11-09
Also published as: CN114045276A

Abstract

The invention belongs to the technical field of enzyme engineering, and discloses a neutral zearalenone degrading enzyme mutant with improved specific enzyme activity. The mutant has an amino acid sequence shown as SEQ ID NO.1, or the mutant is a conservative variant obtained by deleting, replacing, inserting or/and adding one to a plurality of amino acids based on the amino acid sequence shown as SEQ ID NO. 1. The specific enzyme activity of the neutral zearalenone degrading enzyme mutant provided by the invention is 3.3 times that of the wild type mutant, and the neutral zearalenone degrading enzyme mutant can be widely applied to the enzymatic degradation of mycotoxin zearalenone.

Description

Neutral zearalenone degrading enzyme mutant with specific activity improved

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a neutral zearalenone degrading enzyme mutant with improved specific enzyme activity, a coding gene thereof and application thereof in hydrolysis of zearalenone.

Background

Zearalenone (ZEN for short), also known as F-2 toxin, was originally isolated from corn with scab and is a nonsteroidal estrogen mycotoxin that can be produced by many fusarium species, both before and after harvest. Zearalenone is always found in many crops and cereal byproducts including corn, barley, wheat, and the like, especially in environments suitable for fungal growth.

ZEN is one of the most widely used mycotoxins in grains contaminated in the world, and is detected in grains and by-products around the world. ZEN has the characteristics of wide distribution, rapid propagation, high toxicity and the like, and can further harm the life health of people and animals by polluting crops. ZEN has a chemical structure similar to natural estrogens and is therefore able to competitively bind to estrogen receptors, causing external and internal genital alterations and reproductive disorders, leading to hyperestrogenic and infertility, and such toxins also stimulate the growth of breast cancer cell lines and are oncogenic in mice.

In view of the hazards of such toxins, most countries have established strict standards for ZEN content in food or feed. Due to the high stability of ZEN, the removal of such toxins using conventional physical and chemical methods is extremely inefficient. To address this problem, enzymatic degradation has become a promising strategy to reduce contamination by such toxins. The enzyme degradation can not only efficiently convert toxins into non-toxic products, is safe and environment-friendly, but also has strong specificity of enzyme catalytic reaction and high degradation efficiency, and does not destroy nutrient substances of grains.

To date, some studies have been conducted on zearalenone degrading enzymes, resulting in some enzymes that can degrade ZEN toxin, which are able to specifically bind ZEN and degrade it. Three zearalenone degrading enzymes were obtained by the present inventors, for example, CN107099520A discloses a zearalenone degrading enzyme Zhd 518.518, CN108085306A discloses a zearalenone degrading enzyme ZhdAY3 and mutants thereof, and the paper published by the present inventors (Wang M, yin L, hu H, nimal S J, zhou Y, & Zhang G.expression, functional analysis and mutation of a novel neutral zearalenone-degradation enzyme [ J ]. International Journal of Biological Macromolecules,2018, 118:1284-1292.), mutant Zhd (N156H), abbreviated as mutant 1M, was obtained by structural analysis, and the enzyme activity for the substrate zearalenone was 1.18 times that of the wild type. However, the specific enzyme activity of the zearalenone degrading enzyme obtained above is still not ideal.

Disclosure of Invention

In view of the shortcomings of the prior art, the invention aims to provide a mutation site which is obviously related to the improvement of the specific enzyme activity of neutral zearalenone degrading enzyme, a neutral zearalenone degrading enzyme mutant with the improved specific enzyme activity, a coding gene thereof and application thereof in hydrolyzing zearalenone.

In order to achieve the aim of the invention, the inventor has diligently studied through a large number of experiments, finally, on the basis of the zearalenone degrading enzyme mutant 1M, a gene for encoding the mutant is obtained by adopting a site-directed mutagenesis technology, and then, the gene locus for encoding the mutant is subjected to recombinant expression, so that the neutral zearalenone degrading enzyme mutant with improved specific enzyme activity is obtained. Specifically, the technical scheme of the invention is as follows:

the application of a mutation site in improving the specific enzyme activity of a zearalenone degrading enzyme mutant 1M is characterized in that the amino acid sequence of the zearalenone degrading enzyme mutant 1M is shown as SEQ ID NO.6, the mutation site is positioned at 144 amino acids of the zearalenone degrading enzyme mutant 1M, and valine at 144 sites is mutated into glycine.

In addition, the invention can also carry out two site-directed mutations of N156H and V144G on the basis of wild type zearalenone degrading enzyme, thereby obtaining a neutral zearalenone degrading enzyme mutant with improved specific enzyme activity. Therefore, the invention also protects the application of a mutation site in improving the specific enzyme activity of the wild type zearalenone degrading enzyme, wherein the amino acid sequence of the wild type zearalenone degrading enzyme is shown as SEQ ID NO.5, the mutation site is positioned at 144 and 156 amino acids of the wild type zearalenone degrading enzyme, and valine at 144 sites is mutated into glycine and asparagine at 156 sites is mutated into histidine.

A neutral zearalenone degrading enzyme mutant with improved specific enzyme activity, which has an amino acid sequence shown as SEQ ID NO.1 in a sequence table; or the degrading enzyme is a conservative variant obtained by deleting, replacing, inserting or/and adding one to several amino acids based on the amino acid sequence shown in SEQ ID NO. 1.

The neutral zearalenone degrading enzyme mutant provided by the invention is a lactone hydrolase. The amino acid sequence shown in SEQ ID NO.1 consists of 266 amino acid residues, and is mainly characterized in that valine VAL at position 144 of a mutant 1M of neutral zearalenone degrading enzyme Zhd is mutated into glycine GLY, and the obtained mutant is Zhd518 (N156H/V144G) and is named as 2M.

In order to facilitate purification of the above-mentioned degradative enzyme mutant protein, a tag as shown in Table 1 may be attached to the amino-terminal or carboxyl-terminal of the protein composed of the above-mentioned amino acid sequences.

TABLE 1 sequence of tags

The degrading enzyme mutant protein can be synthesized artificially, or can be obtained by a method of site-directed mutagenesis based on wild neutral zearalenone degrading enzyme Zhd (CN 107099520A) or mutant 1M to obtain a vector containing a coding gene, and then performing biological expression. The coding gene of the neutral zearalenone degrading enzyme mutant can be obtained by deleting, replacing, inserting or adding one or more amino acid sequences shown in SEQ ID NO.1, maintaining the original enzyme activity, or connecting the coding sequences of the tags shown in the table 1.

In addition, the invention also provides a coding gene of the neutral corn gibberellin-degrading enzyme mutant with improved specific enzyme activity, which codes:

(a) A protein having an amino acid sequence shown in SEQ ID NO. 1;

(b) A protein having an amino acid sequence shown in SEQ ID NO.1 derived from deletion, substitution, insertion or/and addition of one to several amino acids and having zearalenone degrading activity.

Further, the coding gene of the zearalenone degrading enzyme mutant is a DNA molecule of (i), (ii) or (iii):

(i) A DNA molecule having the nucleotide sequence shown in SEQ ID No. 2;

(ii) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence of (i) and which encodes a protein having zearalenone degrading activity;

(iii) A DNA molecule having a nucleotide sequence having a homology of 90% or more with the nucleotide sequence of (i) or (ii).

Further, the stringent conditions are a reaction temperature of 50 to 68℃in a solution having a sodium concentration of 50 to 300 mM.

The invention also provides a recombinant vector which comprises the coding gene of the zearalenone degrading enzyme mutant. Specifically, the recombinant vector is a recombinant expression vector obtained by inserting any one of the encoding genes into a multiple cloning site of a starting vector (for example, pET28 a). Recombinant expression vectors containing the genes can be constructed using existing expression vectors. When the gene is used for constructing a recombinant expression vector, any one of an enhanced promoter or a constitutive promoter can be added before the transcription initiation nucleotide, and the enhanced promoter or the constitutive promoter can be used alone or in combination with other promoters; in addition, when the recombinant expression vector is constructed using the gene of the present invention, enhancers including translational enhancers or transcriptional enhancers may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

The invention also provides a transformant which comprises the recombinant vector. The transformant may be a recombinant bacterium, for example, a recombinant expression vector obtained by inserting any of the above-mentioned coding genes into a multiple cloning site of a starting vector (for example, pET28a vector) is transformed into E.coli BL21 (DE 3) to obtain a recombinant bacterium.

The invention also provides a primer pair, which is used for obtaining the recombinant vector containing the full length of the coding gene of the neutral zearalenone degrading enzyme mutant by using the mutant 1M as a template and performing reverse polymerase chain reaction amplification when the recombinant expression vector is constructed. For example: the sequences of the primer pairs are shown as SEQ ID NO.3 and SEQ ID NO. 4.

The use of any of the proteins described above, any of the encoding genes described above, any of the recombinant expression vectors described above, the expression cassette, transgenic cell lines or in the degradation of zearalenone falls within the scope of the invention.

In the course of a specific application, the following method may be employed: the zearalenone is taken as a substrate, and is subjected to enzymolysis by using a zearalenone degrading enzyme mutant under the conditions of optimal pH of 8.0 and optimal temperature of 40 ℃. It should be noted that the enzymolysis conditions of the invention are pH8.0 and the temperature of 40 ℃ are the optimal pH and the optimal temperature, but all the enzymolysis conditions include: the temperature of the reaction system is 30-50 ℃, preferably 40 ℃, and the pH value of the reaction system is 6.0-9.0, preferably 8.0, which belong to the protection scope of the invention.

The present invention also provides a method for producing a zearalenone degrading enzyme mutant, comprising culturing the transformant as described above and collecting the zearalenone degrading enzyme mutant from the culture product. The collected zearalenone degrading enzyme mutants may be further purified.

The protein provided by the invention has zearalenone degrading activity and is called zearalenone degrading enzyme. The neutral zearalenone degrading enzyme mutant provided by the invention is the most suitable natural substrate zearalenone and shows higher specific enzyme activity under the conditions of the most suitable pH value of 8.0 and the most suitable temperature of 40 ℃.

Compared with the prior art, the neutral zearalenone degrading enzyme mutant provided by the invention has the following advantages and remarkable progress:

in the paper published before the present invention, the inventors obtained mutant Zhd518 (N156H), abbreviated as mutant 1M, which had 1.18 times higher enzymatic activity for the substrate zearalenone than the wild type. Based on the above, the inventor analyzes the 3D structure of wild neutral zearalenone degrading enzyme Zhd, finds some sites which possibly influence specific enzyme activity, reforms neutral zearalenone degrading enzyme genes by a site-directed mutagenesis method, and finally obtains mutant 2M, so that the specific enzyme activity of the coded neutral zearalenone degrading enzyme mutant 2M is obviously enhanced. Therefore, the neutral zearalenone degrading enzyme mutant 2M provided by the invention is subjected to two site-directed (N156H and V144G) mutation on the basis of zearalenone degrading enzyme Zhd (CN 107099520A), and specific test data show that the specific enzyme activity of the mutant 2M to a substrate zearalenone is 481.8U/mg and is 3.3 times of that of a wild type enzyme activity. This is a completely new property, which means that the mutation involved in the invention is unique and has great potential for industrial production and application.

Drawings

FIG. 1 is an SDS-PAGE electrophoresis of zearalenone degrading enzyme mutant 2M protein after purification.

FIG. 2 shows the results of the improvement of the enzyme activity of zearalenone degrading enzyme mutant 2M relative to the wild type.

FIG. 3 shows comparison results of enzyme activities of zearalenone degrading enzyme mutants 1M-V30I, 1M-Y187R, 1M-V207R, 1M-S216Y and 1M-T238Y relative to wild type.

Detailed Description

The principles and features of the present invention are described below with reference to the drawings, the examples are illustrated for the purpose of illustrating the invention and are not to be construed as limiting the scope of the invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1 preparation and purification of proteins and genes

1. Construction of recombinant expression vectors

The neutral zearalenone degrading enzyme mutant 2M is obtained by site-directed mutagenesis on the basis of a recombinant expression vector pET28a-zhd518 (N156H) of a mutant 1M of neutral zearalenone degrading enzyme Zhd (CN 107099520A), so that the construction of the recombinant expression vector in the invention is mutated by reverse polymerase chain reaction amplification of the whole circular plasmid pET28a-zhd518 (N156H). The mutagenesis primer for V144G was: V144G-F (5 'ccacgaggcgcgcctgccac 3') as shown in SEQ ID NO. 3; V144G-R (5 'gggtcgccctctcgtatgcag 3') as shown in SEQ ID NO. 4.

PCR reaction system of inverse polymerase chain reaction amplified gene:

PCR reaction conditions: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 72℃for 7min,15 cycles, and extension at 72℃for 10min.

The PCR products were checked for yield and specificity by 0.7% agarose gel electrophoresis and purified using DNA purification kit. The purified PCR product was recovered by agarose electrophoresis, followed by treatment with DpnI enzyme to remove template strands, transformation of E.coli DH 5. Alpha. Competent cells by electric shock, plating on LB plates containing 50. Mu.g/mL kanamycin, overnight culture at 37℃and sequencing verification of the resulting transformants. The result shows that V at 144 is mutated to G, but no mutation occurs at other positions, the recombinant vector carries a nucleotide sequence shown as SEQ ID NO.2, the nucleotide sequence shown as SEQ ID NO.2 codes for a mutant shown as SEQ ID NO.1, and the recombinant plasmid is named pET28a-2M.

It is worth noting that the present inventors analyzed the 3D structure of wild-type neutral zearalenone degrading enzyme Zhd, found several sites that may affect specific enzyme activity, and modified the neutral zearalenone degrading enzyme gene by site-directed mutagenesis, the best mutant obtained was 2M. In addition, the experimental sites which can influence specific enzyme activity and are found by the inventor also comprise V30I, Y187R, V207R, S216Y, T238Y, which are respectively obtained by a site-directed mutagenesis method based on the mutant 1M and are respectively named as 1M-V30I, 1M-Y187R, 1M-V207R, 1M-S216Y and 1M-T238Y.

2. Preparation of engineering bacteria

E.coli BL21 (DE 3) (Cat.N0CD 601, full-size gold Co.) was transformed with plasmid pET28a-2M by electric shock, and the transformed product was plated on LB plates containing 50. Mu.g/mL kanamycin, and cultured overnight at 37℃to give engineering bacteria containing plasmid pET28a-2M, designated BL21/pET28a-2M.

E.coli BL21 (DE 3) was transformed with pET28a instead of pET28a-2M, and the recombinant strain containing pET28a was obtained as a control strain in the same manner as above. The positive recombinant strain transferred into BL21 (DE 3) was designated BL21/pET28a.

3. Expression and purification of target proteins

His60 Ni Superflow resin purification cartridge was purchased from TaKaRa under the product catalog number 635660.

GE HiTrap Desalting purification columns were purchased from GE Healthcare under the product catalog number 17-1408-01, respectively.

Culturing the positive recombinant bacterium BL21/pET28a-2M prepared in the step 2 in LB medium containing 50 mug/mL kanamycin, and culturing at 37 ℃ for 3 hours; OD (optical density) ₆₀₀ At=0.7, IPTG was added to its final concentration of 0.8mM in LB medium and the incubation was continued for 16h at 18 ℃.

Centrifuging at 3800rpm for 15min to collect thallus, suspending in buffer A (50 mM Tris-HCl buffer, pH 8.0), ultrasonic crushing in ice bath (60 w,10min; ultrasonic treatment for 1s, stopping for 2 s), centrifuging at 12000rpm for 10min to remove cell debris, and collecting supernatant; the supernatant was passed through His60 Ni Superflow resi n purification column, rinsed with 5mL of ultrapure water, rinsed with 10mL of solution B (50 mM Tris-HCl buffer, pH8.0, 25mM imidazole, 150mM NaCl), finally eluted with 5mL of solution C (50 mM Tris-HCl buffer, pH8.0, 500mM imidazole, 150mM NaCl), and the eluate was collected. The eluate was then desalted by a desalting column GE HiTrap Desalting, and eluted with solution A (50 mM Tris-HCl buffer, pH 8.0) to give a 2M pure enzyme solution.

Culturing and purifying the control bacteria prepared in the step 2 by adopting the same steps, and taking the obtained solution as a control enzyme solution.

SDS-PAGE electrophoresis showed that the molecular weight of the purified 2M protein was about 30kDa, which corresponds to the theoretical deduced 29.3kDa. The results are shown in FIG. 1, where lane M represents the protein molecular weight standard (250,150, 100,75,50,37,25, 15,10 kDa); lane 1 shows the 2M protein obtained after purification of the supernatant from E.coli BL21/pET28a-2M by Ni-NTA column and GE Desantng Desalting column, indicating that the 2M protein was obtained. A control experiment was performed at the same time, but the target protein was not obtained by the control bacteria.

It is worth noting that the mutants obtained according to the experimental site (V30I, Y187R, V207R, S216Y, T238Y) are 1M-V30I, 1M-Y187R, 1M-V207R, 1M-S216Y, 1M-T238Y, respectively. The same recombinant expression vector construction, engineering bacteria preparation, target protein expression and purification are implemented.

Example 2 comparison of specific enzymatic Activity of neutral zearalenone degrading enzyme mutant 2M with wild-type neutral zearalenone degrading enzyme protein

1. Method for measuring activity of zearalenone degrading enzyme

The enzyme activity unit is defined as the amount of enzyme required to degrade 1. Mu.g of substrate zearalenone within 1min as one enzyme activity unit U.

The 2M pure enzyme solution in step 5 of example 1 was diluted with 50mM Tris-HCl buffer at pH8.0, and the enzyme activity was measured using the diluted enzyme solution. The diluted enzyme solution was designated as diluted enzyme solution.

Solution a consisted of: consists of 50mM Tris-HCl buffer solution with pH of 8.0 and zearalenone solution; the final concentration of the substrate zearalenone in 0.5mL of the reaction system was 20.0. Mu.g/mL.

Experimental group: the activity measurement reaction system is 0.5mL, and the enzyme solution is diluted by 0.45mL of solution A and 0.05mL of solution A; the pH value of the reaction system is 8.0; after incubation of the reaction system at 40℃for 10min, 0.5mL of chromatographic grade methanol was used to terminate the reaction, and after cooling, the degradation amount of the substrate was measured by using a High Performance Liquid Chromatograph (HPLC).

2. Protein concentration determination method

According to the instructions of BIO-RAD Quick StartTM Bradford Protein Assay Kit (available from BIO-RAD company, cat No.: 5000201), pure BSA calf serum protein was taken and a 0.5mg/mL protein solution was prepared according to its purity with 50mM Tris-HCl buffer, pH 8.0. Pipetting 0,1, 2, 4, 8, 12, 16 and 20. Mu.L of standard protein solution, and sizing to 20. Mu.L with 50mM Tris-HCl buffer pH 8.0; the sample proteins were mixed with 50mM Tris-HCl buffer, pH8.0, in a proportion and in a total volume of 20. Mu.L. mu.L of the protein solution was reacted with 200. Mu.L of 1 Xdye reagent for 5min, the absorbance OD value was measured at 595nm, and a standard curve of protein concentration and OD595 was drawn.

3. Comparison of specific enzyme activities

The specific enzyme activity is obtained by dividing the enzyme activity by the protein concentration through experiments, the experimental results are shown in figure 2, and figure 2 shows that the zearalenone degrading enzyme mutant 2M has the activity of degrading zearalenone. At the pH of 8.0 and at the temperature of 40 ℃, the degradation amount of the wild-type zearalenone degrading enzyme protein Zhd and the degradation amount of the mutant 2M and the degradation amount of the wild-type zearalenone are taken as the relative activity, wherein the relative activity is 100%, and the ratio of the degradation amount of the wild-type zearalenone degrading enzyme protein and the degradation amount of the mutant 2M is taken as the relative activity. The results show that: at pH8.0, 40℃the enzymatic activity of zearalenone degrading enzyme mutant 2M was 3.3 times that of the wild-type for the substrate zearalenone (FIG. 2).

Control group: the above experiment was performed with the protein obtained by the control bacterium BL21/pET28a (designated as control enzyme solution), and the result shows that the control enzyme solution does not degrade the activity of zearalenone.

Experiments were repeated 3 times and the results were consistent.

The zearalenone degrading enzyme mutants obtained at the experimental site (V30I, Y187R, V207R, S216Y, T238Y) were 1M-V30I, 1M-Y187R, 1M-V207R, 1M-S216Y, 1M-T238Y, respectively. The results of the above comparison of the enzyme activities at these sites show that the specific enzyme activities are not significantly improved, or even reduced, compared to the wild-type or mutant 1M. The specific results show that: the specific enzyme activities of zearalenone degrading enzyme mutants 1M-V30I, 1M-Y187R, 1M-V207R, 1M-S216Y, 1M-T238Y for the substrate zearalenone were 90%, 63%, 66%, 89%, 64% of the wild type at pH8.0, 40 ℃ (FIG. 3).

The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.

Sequence listing

<110> university of Beijing chemical industry

<120> a neutral zearalenone degrading enzyme mutant with improved specific enzyme activity

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 266

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Ala Ala Thr Arg Thr Arg Gly Tyr Val Thr Thr Lys Asp Gly Ile

1 5 10 15

Lys Trp Tyr Tyr Glu Gln Glu Gly Ser Gly Pro Asp Val Val Leu Ile

20 25 30

Pro Asp Gly Leu Gly Glu Cys Gln Met Phe Asp Lys Pro Met Ser Leu

35 40 45

Ile Ala Ser Asn Gly Phe Arg Val Thr Thr Phe Asp Met Pro Gly Met

50 55 60

Ser Arg Ser Ser Asp Ala Pro Pro Glu Thr Tyr Gln Asp Ile Thr Gly

65 70 75 80

Arg Lys Leu Ala Gly Tyr Ile Ile Thr Leu Leu Asp Thr Leu Asp Ile

85 90 95

Lys Ile Ala Ser Val Trp Gly Cys Ser Ser Gly Ala Ser Thr Val Leu

100 105 110

Ala Leu Cys Ser Asp Tyr Pro Glu Arg Val Arg Asn Gly Met Pro His

115 120 125

Glu Val Pro Thr Glu Asn Pro Asp Ile Leu Leu His Ile His Glu Gly

130 135 140

Asp Pro Ala Thr Ile Ser Gln Glu Met Ala Ala His Ser Arg Ala Tyr

145 150 155 160

Ser Gly Asn Val Glu Ala Trp Asp Ala Leu Gly Pro Glu Val His Ala

165 170 175

Arg Leu His Asp Asn Tyr Pro Arg Trp Ala Tyr Gly Tyr Pro Arg Thr

180 185 190

Ile Pro Pro Ser Ala Pro Val Lys Thr Glu Asp Leu His Lys Val Pro

195 200 205

Ile Asp Trp Thr Val Gly Ala Ser Thr Pro Thr Lys Leu Phe Phe Glu

210 215 220

Asn Ile Val Ile Ala Ala Arg Glu Gly Ile Asn Ile Gly Thr Leu Pro

225 230 235 240

Gly Asn His Phe Pro Tyr Val Ser His Pro Glu Glu Phe Ala Lys Tyr

245 250 255

Val Val Glu Thr Ser Arg Lys Tyr Leu Lys

260 265

<210> 2

<211> 801

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atggccgcta cacgtacacg aggatatgtt accactaaag acggaataaa atggtactat 60

gagcaagagg gttccgggcc tgatgttgtc ttgattccag acggcctagg cgaatgtcag 120

atgtttgata agccaatgtc tctaattgcc agcaacggct tcagagtaac gacattcgac 180

atgcctggaa tgtcaagatc atccgatgca ccaccagaaa cgtatcagga cattacaggt 240

cgaaaattag ctggctacat tatcacactg ttggacacac tggacatcaa aatcgcttcg 300

gtctggggct gtagctcagg agcctcgacc gtccttgcac tctgctcaga ctacccagag 360

cgagtccgca atggaatgcc ccacgaggtc ccgacagaaa acccagacat tcttctgcat 420

atccacgagg gcgaccctgc cacaatctcg caagaaatgg cagcccattc gagggcctac 480

tcaggaaatg tagaggcatg ggacgctctc gggccagaag tccacgcaag gcttcatgac 540

aactacccgc gatgggcata tggctatcca cgtaccatac ccccgtccgc gccggtgaaa 600

actgaagatc tacacaaggt tccaatagat tggaccgttg gcgcttcaac tcccaccaag 660

ttgttcttcg aaaacatcgt catcgcggcc agggagggca tcaatattgg aactctgccg 720

ggcaatcatt tcccatatgt ctcgcacccg gaagagtttg cgaagtatgt cgttgagacg 780

agtcggaagt atttgaaata g 801

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ccacgagggc gaccctgcca c 21

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gggtcgccct cgtggatatg cag 23

<210> 5

<211> 266

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 5

Met Ala Ala Thr Arg Thr Arg Gly Tyr Val Thr Thr Lys Asp Gly Ile

1 5 10 15

Lys Trp Tyr Tyr Glu Gln Glu Gly Ser Gly Pro Asp Val Val Leu Ile

20 25 30

Pro Asp Gly Leu Gly Glu Cys Gln Met Phe Asp Lys Pro Met Ser Leu

35 40 45

Ile Ala Ser Asn Gly Phe Arg Val Thr Thr Phe Asp Met Pro Gly Met

50 55 60

Ser Arg Ser Ser Asp Ala Pro Pro Glu Thr Tyr Gln Asp Ile Thr Gly

65 70 75 80

Arg Lys Leu Ala Gly Tyr Ile Ile Thr Leu Leu Asp Thr Leu Asp Ile

85 90 95

Lys Ile Ala Ser Val Trp Gly Cys Ser Ser Gly Ala Ser Thr Val Leu

100 105 110

Ala Leu Cys Ser Asp Tyr Pro Glu Arg Val Arg Asn Gly Met Pro His

115 120 125

Glu Val Pro Thr Glu Asn Pro Asp Ile Leu Leu His Ile His Glu Val

130 135 140

Asp Pro Ala Thr Ile Ser Gln Glu Met Ala Ala Asn Ser Arg Ala Tyr

145 150 155 160

Ser Gly Asn Val Glu Ala Trp Asp Ala Leu Gly Pro Glu Val His Ala

165 170 175

Arg Leu His Asp Asn Tyr Pro Arg Trp Ala Tyr Gly Tyr Pro Arg Thr

180 185 190

Ile Pro Pro Ser Ala Pro Val Lys Thr Glu Asp Leu His Lys Val Pro

195 200 205

Ile Asp Trp Thr Val Gly Ala Ser Thr Pro Thr Lys Leu Phe Phe Glu

210 215 220

Asn Ile Val Ile Ala Ala Arg Glu Gly Ile Asn Ile Gly Thr Leu Pro

225 230 235 240

Gly Asn His Phe Pro Tyr Val Ser His Pro Glu Glu Phe Ala Lys Tyr

245 250 255

Val Val Glu Thr Ser Arg Lys Tyr Leu Lys

260 265

<210> 6

<211> 266

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 6

Met Ala Ala Thr Arg Thr Arg Gly Tyr Val Thr Thr Lys Asp Gly Ile

1 5 10 15

Lys Trp Tyr Tyr Glu Gln Glu Gly Ser Gly Pro Asp Val Val Leu Ile

20 25 30

Pro Asp Gly Leu Gly Glu Cys Gln Met Phe Asp Lys Pro Met Ser Leu

35 40 45

Ile Ala Ser Asn Gly Phe Arg Val Thr Thr Phe Asp Met Pro Gly Met

50 55 60

Ser Arg Ser Ser Asp Ala Pro Pro Glu Thr Tyr Gln Asp Ile Thr Gly

65 70 75 80

Arg Lys Leu Ala Gly Tyr Ile Ile Thr Leu Leu Asp Thr Leu Asp Ile

85 90 95

Lys Ile Ala Ser Val Trp Gly Cys Ser Ser Gly Ala Ser Thr Val Leu

100 105 110

Ala Leu Cys Ser Asp Tyr Pro Glu Arg Val Arg Asn Gly Met Pro His

115 120 125

Glu Val Pro Thr Glu Asn Pro Asp Ile Leu Leu His Ile His Glu Val

130 135 140

Asp Pro Ala Thr Ile Ser Gln Glu Met Ala Ala His Ser Arg Ala Tyr

145 150 155 160

Ser Gly Asn Val Glu Ala Trp Asp Ala Leu Gly Pro Glu Val His Ala

165 170 175

Arg Leu His Asp Asn Tyr Pro Arg Trp Ala Tyr Gly Tyr Pro Arg Thr

180 185 190

Ile Pro Pro Ser Ala Pro Val Lys Thr Glu Asp Leu His Lys Val Pro

195 200 205

Ile Asp Trp Thr Val Gly Ala Ser Thr Pro Thr Lys Leu Phe Phe Glu

210 215 220

Asn Ile Val Ile Ala Ala Arg Glu Gly Ile Asn Ile Gly Thr Leu Pro

225 230 235 240

Gly Asn His Phe Pro Tyr Val Ser His Pro Glu Glu Phe Ala Lys Tyr

245 250 255

Val Val Glu Thr Ser Arg Lys Tyr Leu Lys

260 265

Claims

1. A method for improving specific enzyme activity of a zearalenone degrading enzyme mutant 1M is characterized by comprising the step of mutating valine at position 144 of the zearalenone degrading enzyme mutant 1M into glycine, wherein the amino acid sequence of the zearalenone degrading enzyme mutant 1M is shown as SEQ ID No. 6.

2. A method for improving the specific enzyme activity of a wild-type zearalenone degrading enzyme is characterized by comprising the steps of mutating valine at position 144 of the wild-type zearalenone degrading enzyme into glycine, mutating asparagine at position 156 into histidine, and enabling the amino acid sequence of the wild-type zearalenone degrading enzyme to be shown as SEQ ID NO. 5.

3. A neutral zearalenone degrading enzyme mutant with improved specific enzyme activity is characterized in that the amino acid sequence of the degrading enzyme mutant is shown as SEQ ID NO. 1.

4. A coding gene of a neutral zearalenone degrading enzyme mutant with improved specific enzyme activity, which is characterized in that the gene codes for protein with an amino acid sequence shown as SEQ ID NO. 1.

5. The coding gene of the neutral zearalenone degrading enzyme mutant with improved specific activity according to claim 4, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 2.

6. A recombinant vector comprising a gene encoding the zearalenone degrading enzyme mutant according to claim 4 or 5.

7. Use of the neutral zearalenone degrading enzyme mutant according to claim 3 for enzymatic hydrolysis of zearalenone.

8. The use according to claim 7, characterized in that the enzymatic hydrolysis conditions comprise: the temperature of the reaction system is 30-50 ℃, and the pH value of the reaction system is 6.0-9.0.