CN104530212A - Immunoregulation peptide, and preparation method and application thereof - Google Patents

Abstract

The invention belongs to the fields of medicine and bioengineering, and discloses an immunoregulation peptide, and a preparation method and application thereof. The amino acid sequence of the immunoregulation is disclosed as SEQ ID NO:1. The immunoregulation peptide has high T lymphopoiesis promoting function, and can be used for preparing T lymphopoiesis promoting drugs.

Description

A kind of immunomodulatory peptides and its preparation method and application

Technical field

The invention belongs to medicine and bioengineering field, relate to a kind of immunomodulatory peptides and its preparation method and application.

Background technology

Modern nutriology research finds: the mankind ingest protein after gastral enzyme effect, digest and assimilate with little peptide form mostly, very little with the ratio that total free aminoacids form absorbs, further test the absorption that also disclosed the specific absorption total free aminoacids of little peptide more rapid.Another new knowledge of peptide trophism is the biologically active peptides that protein can produce that in enzymolysis process some have special physiological regulatory function.These biologically active peptidess play an important role in adjustment gastrointestinal movement, immunity moderation system, hypertension, antibacterial, antithrombotic, antiviral, anticancer, scavenging free radicals and the absorption of promotion mineral element etc.These biologically active peptidess itself are present among protein amino acid sequence with inactive state, when carrying out extracorporeal hydrolysis with suitable proteolytic enzyme or in pipe intestinal digesting process and in food processing process, their activity is just released.Although also comprise bioactive peptides sequence in other animal and plant protein, milk-protein is the main source of current biologically active peptides, the most deep to its research.

Immune-active peptides has can stimulate multinuclear lymphocyte, promotes lymphocyte differentiation and maturation, transfer immunity information, a series of biological functions such as enhancing body immunity function.A large number of experiments show that in milk-protein and be implied with many immunomodulatory peptide sequences, these immunomodulatory peptides have important regulatory function to immunity system.We isolate in breast milk the polypeptide moiety being less than 10KDa by ultra-filtration technique, carry out identification and analysis further by tandem mass spectrum technology to its concrete composition.Found that these polypeptide mainly from the fragment that people's beta-casein (Homo sapiens beta casein, gene No. Bank: NM_001891) Fracture gets off, to be naturally present in breast milk.The report do not studied further these segments and function thereof in prior art, for this reason, we have screened some polypeptide and have carried out deep research.

Summary of the invention

The object of this invention is to provide a kind of immunomodulatory peptides.

Another object of the present invention is to provide the preparation method of above-mentioned immunomodulatory peptides.

A further object of the invention is to provide the application of above-mentioned immunomodulatory peptides.

The object of the invention is to be realized by following technical proposal:

A kind of immunomodulatory peptides, its aminoacid sequence is as shown in SEQ ID NO:1.Called after Casein111.

Express the gene of above-mentioned immunomodulatory peptides, its nucleotide sequence is as shown in SEQ ID NO:2.

The amplimer of described polypeptide, wherein the nucleotide sequence of upstream primer is as shown in SEQ ID NO:3, and the nucleotide sequence of downstream primer is as shown in SEQ ID NO:4.

The preparation method of described immunomodulatory peptides, the method comprises the following steps:

A. the expression vector pSUMO of aforementioned polypeptides is built;

The abduction delivering of b.pSUMO fusion rotein;

The purifying of c.pSUMO fusion rotein, collection;

D. the purifying of recombinant antibacterial peptide, collection.

Described preparation method, the method comprises the following steps:

A. the expression vector pSUMO of aforementioned polypeptides (SEQ ID NO:1) is built:

This polypeptide-nucleic acid sequence of synthetic, this polypeptide-nucleic acid fragment utilizing above-mentioned upstream and downstream primer to be amplified containing BsaI, HindIII restriction enzyme site by round pcr carries out glue recovery, is loaded into pSUMO carrier after reclaiming product double digestion;

The abduction delivering of b.pSUMO fusion rotein:

1) the correct plasmid that checks order proceeds to intestinal bacteria (BL21), and the LB nutrient solution be inoculated in containing kantlex is cultivated;

2) collect thalline, add IPTG after resuspended and induce pSUMO expressing fusion protein;

The purifying of c.pSUMO fusion rotein:

After bacterium liquid precipitate Ni-NTA Binding-Buffer after abduction delivering is resuspended, ultrasonication, centrifugal, get supernatant, supernatant liquor loading is to Ni-NTA affinity column, and wash-out pSUMO fusion rotein, collects elutriant, SDS-PAGE electrophoretic analysis;

D. the purifying of recombinant antibacterial peptide, collection:

Adopt SUMO enzyme to carry out enzyme to pSUMO fusion rotein to cut, utilize Ni-NTA-Sepharose CL-6B affinity column remove SUMO label or there is no cut SUMO fusion rotein, wash-out recombinant antibacterial peptide, electrophoretic analysis, collect recombinant antibacterial peptide.

The application of described immunomodulatory peptides in the short lymphopoietic medicine of T of preparation.

Described immunomodulatory peptides is preparing the application in milk preparation additive.

Beneficial effect of the present invention:

Immunomodulatory peptides provided by the invention has very strong short T Proliferation of lymphocytes, can be used in preparing the lymphopoietic medicine of short T.This adjustment peptide is breast milk source, and breast milk, as the most important food of newborn infant, has very high security.In addition, neonatal immunity power and resistibility are all relatively lower, and this peptide can also for the preparation of milk preparation additive.

Polypeptide provided by the invention can be obtained by chemosynthesis, but the cost of synthesis is high, and therefore, present invention also offers the gene recombination technology preparation method of this polypeptide, this preparation method is simple, and cost is low, is easy to commercial application.

Because SUMO is except the characteristic of promotion solubility with traditional fusion tag, also there is molecular chaperone function, the feature such as correct folding of target protein can be promoted, have very strong resistance to heat and proteolytic enzyme simultaneously, be conducive to the stability keeping target protein.In this research, we successfully construct polypeptide and SUMO fusion expression vector, cutting, can obtaining soluble polypeptide in a large number, with chemosynthesis than greatly reducing the cost obtaining polypeptide after purifying through abduction delivering, enzyme.

Accompanying drawing explanation

Fig. 1 is that the immunomodulatory peptides of chemosynthesis promotes the lymphocytic MTT proliferation experiment of T.

Fig. 2 is the recombinant polypeptide Tricine/SDS-PAGE electrophoresis after cutting after purifying.

Wherein: 1: albumen Marker; 2: the recombinant polypeptide after cutting

Fig. 3 is that immunomodulatory peptides promotes the lymphopoietic FCM analysis figure of T.

Wherein: PBS as control, 10ug/ml immunomodulatory peptides action effect, 5ug/ml immunomodulatory peptides action effect.(upper row is peak figure, and lower row is scatter diagram)

Embodiment

The invention will be further elaborated by the following examples.

Embodiment 1

1. this polypeptide has sequence signature:

Aminoacid sequence: GRVMPVLKSPTIPFFDPQIPK (SEQ ID NO:1)

Nucleotide sequence:

GGCAGAGTGATGCCTGTCCTTAAATCTCCAACGATACCCTTTTTTGACCCTCAAATCCCAAAA(SEQ ID NO：2)

There is iso-electric point (pI): 9.99, molecular weight (Mw): 2367.88.

2., after this polypeptide of chemosynthesis, MTT experiment finds that this peptide has the very strong lymphopoietic effect of short T (see Fig. 1).

Adopt t separation of lymphocytes reagent (ONE LAMBDA, US) is separated human blood T lymphocyte, and RPMI 1640 (containing 10%FCS, 100U/ml penicillin/streptomycin) nutrient solution adjustment cell concn is to about 4 × 10 ⁶individual/ml.Traditional mtt assay is adopted to detect this immunomodulatory peptides (chemical synthesising peptide) of chemosynthesis to the effect of T lymphocyte proliferation.In 96 orifice plates, every hole adds 50 μ l cells, 150 μ l RPMI RPMI-1640s.Divide into groups to add this chemical synthesising peptide successively, final concentration is respectively 2,4,6 μ g/ml again, to add PBS for blank.At 37 DEG C, 5%CO ₂after cultivating 48h under concentration conditions, every hole adds 50 μ l 2mg/mL MTT, 37 DEG C, 5%CO ₂continue to cultivate 4h, centrifugal, remove supernatant, add the upper concussion of 150 μ l DMSO microwell plate concussion 10 minutes, crystallisate is dissolved, measures each hole OD ₅₇₀value.Three wells is established in experiment, gets its mean value, and calculates standard error.

3. the foundation of recombination and preparation

3.1 vector constructions:

This polypeptide-nucleic acid sequence of synthetic, utilizes primer below by round pcr:

NO1-F：CATATC GGTCTCGGCAGAGTGATGCCTGT(SEQ ID NO：3)

BsaI

NO1-R：CCC AAGCTTTTTTGGGATTTGAGGGTCA(SEQ ID NO：4)

HindIII

This polypeptide-nucleic acid fragment amplified containing above-mentioned restriction enzyme site carries out glue recovery, is loaded into pSUMO carrier (Lifesensors, USA), proceeds to DH5a competent cell after reclaiming product double digestion, extracts the order-checking of plasmid Hou Song company.

The abduction delivering of 3.2pSUMO fusion rotein

1. the correct plasmid that checks order proceeds to e. coli bl21 (DE3) coated plate, and the mono-clonal on picking transformation plate is inoculated in the test tube containing the 3ml LB nutrient solution of 30 μ g/ml Kan, and 37 DEG C of 200rpm joltings are spent the night;

2. be inoculated in by 1:100 in the 50ml LB nutrient solution of 30 μ g/ml Kan next day, 37 DEG C of 200rpm joltings are 0.6 (about 2.5h) to thalline OD600;

3. take out 200 μ l cultures, the centrifugal 2min of 12000g room temperature, abandons supernatant, with 20 μ l 2 × sample-loading buffers (0.5MNaCl, 20mM Tris, 20mM imidazoles) resuspended bacterial sediment;

4. in remaining culture, add IPTG is 0.2mmol/l to final concentration, 25 DEG C of 220rpm jolting 6h, induction SUMO expressing fusion protein;

5. take out 200 μ l cultures, the centrifugal 3min of 12000g room temperature, abandons supernatant, with the resuspended bacterial sediment of 20 μ l 2 × sample-loading buffer, remains culture 4 DEG C of centrifugal 20min of 5000g, abandons supernatant, put-80 DEG C frozen.

The purifying of 3.3SUMO fusion rotein

Ni-NTA-Sepharose CL-6B affinity column and supporting damping fluid are purchased from Sepharose company.

1. by the bacterium liquid precipitate of 500mL abduction delivering 20ml Ni-NTA Binding-Buffer (20mM Tris, 500mM NaCl, and 20mM imidazole, pH 8.0) resuspended after, ultrasonication (power 200W, work 4sec, interval 8sec, 20min altogether), 4 DEG C of centrifugal 20min of 12000g, get supernatant;

2. with the Ni-NTA-Sepharose CL-6B affinity column of Ni-NTA Binding-Buffer pre-equilibration, supernatant liquor with 0.6ml/min flow velocity loading to affinity column;

3. rinse with 1.0ml/min flow velocity with Ni-NTA Binding-Buffer, arrive baseline to effluent liquid OD280 value;

4. rinse with 1.0ml/min flow velocity with Ni-NTA Washing-Buffer (20mM Tris, 500mM NaCl, and 50mM imidazole, pH7.0), arrive baseline to effluent liquid OD280 value;

5. use Ni-NTA Elution-Buffer (20mM Tris, 500mM NaCl, and 250mM imidazole, pH7.0) with 1.0ml/min flow velocity wash-out target protein, collect effluent liquid; Obtain pSUMO-protein1 fusion rotein.

3.4 fusion rotein cutting and target protein purifying

PSUMO-protein1 fusion rotein is loaded in dialysis tubing, dialysed overnight in PBS (pH7.0); According to SUMO enzyme (GeneCopoeia, the U.S.) enzyme cuts handbook and carries out enzyme to pSUMO-protein1 fusion rotein and cut, actual conditions is as follows: survey pSUMO-protein1 fusion rotein concentration, add 1U SUMO enzyme by 50ug fusion rotein, 30 DEG C of enzymes cut 60min.Due to SUMO label and fusion protein S UMO containing 6 histidine protein labels (these His labels are that pSUMO plasmid inherently contains), so continue to utilize Ni ²⁺-NTA affinity chromatography is to remove SUMO label or not have cut SUMO fusion rotein, specific as follows:

1. with the Ni-NTA-Sepharose CL-6B affinity column of PBS (pH7.0) pre-equilibration), enzyme cut after sample mix liquid with 0.6ml/min flow velocity loading to Ni-NTA, collect effluent liquid;

2. rinse with 0.6ml/min flow velocity with Elution-Buffer (20mM Tris, 500mM NaCl, and 250mM imidazole, pH 7.0), collect elutriant.

3. pair enzyme cut after elutriant carry out Tricine/SDS-PAGE electrophoretic analysis.

The results are shown in Figure 2.Result shows, through SUMO enzyme enzyme cut with column purification after can obtain highly purified recombinant immune and regulate PEPC asein111.

4, collect recombinant immune and regulate PEPC asein111.

3.5 recombinant immunes regulate the activation analysis of peptide

Adopt t separation of lymphocytes reagent (ONE LAMBDA, US) is separated human blood T lymphocyte, and RPMI 1640 (containing 10%FCS, 100U/ml penicillin/streptomycin) nutrient solution adjustment cell concn is to about 4 × 10 ⁶individual/ml.Add recombinant immune successively and regulate peptide, recombinant immune regulates the final concentration of PEPC asein111 to be respectively 5 and 10 μ g/ml, to add PBS for blank.In order to detect recombinant polypeptide activity further, 37 DEG C, cultivate 48h under 5%CO2 concentration conditions after every hole add and carry out list dye detection cell survival and death condition afterwards with the PI (propidium iodide) of 2.5 μ g/ml.Instrument used is FACScan (Becton Dickinson, Heidelberg, Germany), analyzes with CellQuest software.Flow cytometry experiments result shows this recombinant immune and regulates peptide to have the activity of very strong promotion human T lymphocyte propagation.

The results are shown in Figure 3.

Result shows, and compared with PBS control group (48.02%), after recombinant immune regulates polypeptide process, T lymphopoiesis ability significantly strengthens (82.31% and 78.50%).

Claims (7)

1. an immunomodulatory peptides, its aminoacid sequence is as shown in SEQ ID NO:1.

2. express the gene of immunomodulatory peptides described in claim 1, its nucleotide sequence is as shown in SEQ ID NO:2.

3. the amplimer of polypeptide described in claim 1, is characterized in that the nucleotide sequence of upstream primer is as shown in SEQ IDNO:3, and the nucleotide sequence of downstream primer is as shown in SEQ ID NO:4.

4. the preparation method of immunomodulatory peptides described in claim 1, is characterized in that the method comprises the following steps:

A. the expression vector pSUMO of polypeptide described in claim 1 is built;

The abduction delivering of b.pSUMO fusion rotein;

The purifying of c.pSUMO fusion rotein, collection;

D. the purifying of recombinant antibacterial peptide, collection.

5. preparation method according to claim 4, is characterized in that the method comprises the following steps:

A. the expression vector pSUMO of polypeptide described in claim 1 is built:

This polypeptide-nucleic acid sequence of synthetic, this polypeptide-nucleic acid fragment utilizing the upstream and downstream primer described in claim 3 to be amplified containing BsaI, HindIII restriction enzyme site by round pcr carries out glue recovery, is loaded into pSUMO carrier after reclaiming product double digestion;

The abduction delivering of b.pSUMO fusion rotein:

1) the correct plasmid that checks order proceeds to intestinal bacteria, and the LB nutrient solution be inoculated in containing kantlex is cultivated;

2) collect thalline, add IPTG after resuspended and induce pSUMO expressing fusion protein;

The purifying of c.pSUMO fusion rotein:

After bacterium liquid precipitate Ni-NTA Binding-Buffer after abduction delivering is resuspended, ultrasonication, centrifugal, get supernatant, supernatant liquor loading is to Ni-NTA affinity column, and wash-out pSUMO fusion rotein, collects elutriant, SDS-PAGE electrophoretic analysis;

D. the purifying of recombinant antibacterial peptide, collection:

Adopt SUMO enzyme to carry out enzyme to pSUMO fusion rotein to cut, utilize Ni-NTA-Sepharose CL-6B affinity column remove SUMO label or there is no cut SUMO fusion rotein, wash-out recombinant antibacterial peptide, electrophoretic analysis, collect recombinant antibacterial peptide.

6. the application of immunomodulatory peptides according to claim 1 in the short lymphopoietic medicine of T of preparation.

7. immunomodulatory peptides according to claim 1 is preparing the application in milk preparation additive.