CN105669856A

CN105669856A - Gene recombination long-acting adrenocorticotropic hormone and preparation method thereof

Info

Publication number: CN105669856A
Application number: CN201610083772.5A
Authority: CN
Inventors: 王大勇; 黄永林; 裴业春
Original assignee: Individual
Current assignee: Individual
Priority date: 2016-02-13
Filing date: 2016-02-13
Publication date: 2016-06-15

Abstract

The invention discloses mutant adrenocorticotropic hormone (ACTH (E5D) for short) with N-terminal fifth glutamic acid (E) mutated into aspartic acid (D) and a preparation technology thereof. After ACTH (E5D) histidine tag fusion protein is expressed in escherichia coli, Ni column primary purification is performed, unnecessary amino acid sequences are cut through enterokinase, and a gel filtration method is used for preparation. In vitro and vitro experiments show that stability of ACTH (E5D) is high than that of wild type ACTH, and physiological activity of ACTH (E5D) is equivalent to that of the wild type ACTH under the conditions of the same dosage and the same dust administration time.

Description

A kind of long-acting people's thyroliberin of gene recombinaton and preparation method thereof

Art

The present invention adopts the method such as genetic engineering, molecular biology, prepares and remains the effect that people's thyroliberin (ACTH) promotes glucocorticoid to produce and the long-acting ACTH of gene recombinaton being not easily metabolized in blood.

Background technology

There is the enzyme of multiple protein degradation matter in the middle of blood, the Half-life in vivo of naturally occurring wild type human ACTH is very short, only about 15 minutes. ACTH degraded in blood is mainly caused by the protease in blood, we are on the basis of the blood protease degradation site analyzed in the middle of ACTH structure, construct the multiple ACTH-pET30a prokaryotic expression plasmid of wild type and rite-directed mutagenesis, therefrom filter out the ACTH Point mutont being not easily easily degraded by proteases. ACTH is a peptide species, and molecular weight only has 4.5kD, not easily single expression purification in engineering bacteria; So we connect one section of histidine-tagged (HisTag) encoding 6 histidine and one section of polypeptide linker (abbreviation Linker at the 5 ' ends of ACTHcDNA, nucleotide sequence amounts to 144bp, express 5.3kD polypeptide) nucleotide sequence, the fusion protein expressed not only can suppress fermentation stage to degrade, improve ACTH dissolubility in lysate, it is also possible to Ni post preliminary purification with histidine-tagged albumen simultaneously. Histidine-tagged in order to remove after expression of polypeptides, we add the coding nucleotide sequence (being called for short EKst) of one section of enterokinase (EK) substrate " Asp-Asp-Asp-aspartic acid-lysine (DDDDK) " between HisTag-Linker and ACTH sequence. The fusion sequence so obtained is referred to as " HisTag-Linker-EKst-ACTH (fusion nucleus nucleotide sequence amounts to 285bp, and the fusion protein of expression is about 10.6kD) ". Because the cleavage site of enterokinase is just after DDDDK aminoacid sequence, that expresses in engineering bacteria can remove whole HisTag-Linker peptide chains and DDDDK sequence with histidine-tagged ACTH fusion protein under the effect of gene recombinaton enterokinase (recombinantEK), obtains the ACTH polypeptide without additional amino acid residues.

After adopting column chromatography method to separate the ACTH polypeptide being purified into wild type and various point mutation, tested by animal experiment in vivo and Adrenal Cortex tumor Y1 cells in vitro, filter out the long-acting people ACTH of gene recombinaton retaining ACTH promotion glucocorticoid generation effect and being not easily metabolized in blood.Through contrasting with wild type human ACTH, it has been observed that the 5th of ACTH the glutamic acid mutation is the biologic activity that aspartic acid (E5D) not only can retain natural A CTH, and more stable than wild type in blood, it is possible to apply as long-acting ACTH.

Patent specification describes a kind of natural A CTH that remains and promotes the saltant type ACTH (E5D) being not easily metabolized in blood and the preparation technology thereof of glucocorticoid generation effect.

Summary of the invention

1. the purpose of invention

Prepare highly purified, the to remain natural A CTH promotion glucocorticoid generation long-acting people's thyroliberin (ACTH) of gene recombinaton bioactive, that be not easily degraded in blood.

2. the technical scheme of invention

See accompanying drawing 1.

3. the beneficial effect of the invention

The long-acting people ACTH of gene recombinaton prepared by the present invention, not only possesses the biologic activity of Natural wild-type ACTH but also degrades slower in blood because of it, it is possible to reduces patient and accepts dosage and the number of times of ACTH drug administration by injection, reduces cost.

It addition, the ACTH of existing circulation extracts from the hypophysis cerebri of pig on medical market, it is possible to carry animal virus. Gene engineering preparation method of the present invention, not only can obtain the long-acting people ACTH of highly purified gene recombinaton, and not use animal material in the middle of preparation process, so substantially eliminating the hidden danger propagating animal virus.

Detailed description of the invention

The design of 1.ACTH mutant, prokaryotic expression system build and and expression and purification

The design of 1.1ACTH mutant

The active region of ACTH is the 1-24 peptide fragment that amino (N) is held, even if the 25-39 peptide fragment of carboxyl terminal is removed or metabolism is fallen still active, so we are for the 1-24 peptide fragment design point mutational site of ACTH, not only to make it not easily by the proteasome degradation in blood, also to retain the activity of ACTH. We utilize CutDB protease database to analyze restriction enzyme site (see table 1) possible in people ACTH, devise several amino acids point mutation ACTH polypeptide on this basis, including the ACTH (E5D) that the 5th glutamic acid mutation is aspartic acid described by patent of the present invention. (referring to " description nucleotide and aminoacid sequence table ")

Blood protein cleavage sites in table 1.ACTH

The structure of 1.2ACTH prokaryotic expression system and expression and purification thereof

We have expressed the ACTH (E5D) of wild type (WT) ACTH, ACTH24 (active amino terminal 1-24 peptide fragment) and engineer, the latter and wild type differ only by 1 aminoacid, same expression and isolation and purification method is adopted to be prepared, specific as follows:

1.2.1 construction of expression vector

On the one hand, the pET30a empty plasmid of histidine-tagged (HisTag) is carried with BamH1, Sal1 double digestion; On the other hand with ACTH for masterplate, design comprises above-mentioned two restriction enzyme site and the primer of EKst nucleotide sequence respectively, pcr amplification goes out the fusion fragment that structure is " BamH1 restriction enzyme site-EKst-ACTH-Sal1 restriction enzyme site ", then with BamH1, Sal1 double digestion. With T4 ligase by cut fragment EKst-ACTH is connected on the pET30a plasmid of aforementioned incision, (Linker therein is the catenation sequence between HisTag and ACTH to construct HisTag-Linker-EKst-ACTH-pET30A plasmid, nucleotide sequence length is 123bp, and the Linker peptide chain given expression to comprises 41 aminoacid). The structure of ACTH (E5D) expression plasmid, be ACTH (WT) plasmid to build it is template, utilize the primer introducing mutational site, amplify E5D sudden change purpose fragment by the method for over-lap PCR, be connected on pET30a carrier according still further to preceding method.The full plasmid annular signal spectrogram of HisTag-Linker-EKst-ACTH-pET30A built is as depicted in figure 2; BamH1 and Sal1 double digestion qualification result is referring to accompanying drawing 2b. The ACTH (WT) built and the sequencing result of ACTH (E5D) are referring to accompanying drawing 3 and accompanying drawing 4. Amplimer used in above-mentioned experiment is as shown in table 2.

Table 2.PCR amplimer table

1.2.2 abduction delivering

The method (42 DEG C, 45 seconds) that the carrier built adopts thermal transition is imported BL21-DE3 engineered strain. It is inoculated on LB culture plate after 37 DEG C of recovery 1h, picking monoclonal bacterium colony after 37 DEG C of overnight incubation, it is inoculated in 250mLLB culture medium, when 37 DEG C of shaken cultivation to OD values are between 0.4～0.6, add the IPTG of 1mM, and cool the temperature to 25 DEG C of abduction delivering 8h.

1.2.3 bacterial cell disruption

Bacterium solution is at 10000rpm, and centrifugal 15min, supernatant discarded at 4 DEG C, addition thalline rinsing liquid (10mMTris-HCl, 10mMEDTA, 100mMNaCl) washs three times. Add the ratio of 10ml lysate according to every gram of wet bacterium, add cellular lysate liquid (50mMTris-Cl, 300mMNaCl, 10mM imidazoles, 1mMPMSF, pH8.0).

Because the HisTag-Linker of N-terminal improves the dissolubility of ACTH, the ACTH of expression is primarily present in the middle of the supernatant of lysate, so after the centrifugal 15min of 12000rpm, discarding inclusion body precipitation, retaining supernatant and separating for next step.

1.2.4 purification is separated

1.2.4.1Ni column purification

Ni post is with 2 times of column volume 20% ethanol purge, then with 2 times of column volume deionized water rinsings. Replacing mobile phase is level pad (50mMTris-HCl, 300mMNaCl, 10mM imidazoles, pH8.0), balances 5 column volumes. After application of sample, replacing mobile phase is rinsing liquid (50mMTris-Cl, 300mMNaCl, 30mM imidazoles, pH8.0), rinses 20 column volumes. Replacing mobile phase is eluent (50mMTris-Cl, 300MmNaCl, 250mM imidazoles, pH8.0), after discarding initial 3mL eluent, collect elution fraction, often pipe 1mL, collects 10 pipes, and the ACTH fusion protein band in the middle of elution fraction is as shown in Figure 5.

1.2.4.2 desalination

Elution fraction after 10mL merging cuts buffer (20mMTris-HCl, 50mMNaCl, 2mMCaCl at the enterokinase of 1 times of column volume₂, pH6.0) in dialysis equilibrium.

1.2.4.3 enterokinase enzyme action

Gene recombinaton enterokinase (every 0.5mg destination protein adds 1U enterokinase) is added in the sample dialysed, 37 DEG C, (20mMTris-Cl in enterokinase enzyme cutting buffering liquid, 50mMNaCl, 2mMCaCl2, pH6.0) cutting 16h, the ACTH cut identifies through Western-Blot, as shown in Figure 6.

1.2.4.4 it is concentrated by ultrafiltration

10mL sample molecular weight retains the super filter tube (AmiconUltra-153K) into 3kD at 25 DEG C, and 4000g is centrifuged 30min, sample volume about 600 μ L after concentration.

(note: the alternative method of this step is to be dialysed in polyglycol solution by sample can be used for technique and amplifies. )

1.2.4.5CM weak cation column chromatography purification

CM-cellulose (Sigma-Aldrich) ion exchange column (40 × 1cm), with 0.05M Acetic acid-sodium acetate Equilibration buffer wash CM-cellulose chromatographic column (Sigma-Aldrich) of the pH3.5 of 5 column volumes, coutroi velocity is 1ml/min.

Sample level pad after concentration is diluted to 1ml, application of sample after filtering with 0.4 micron membrane filter, and coutroi velocity is 1ml/min, with the 0.5M Acetic acid-sodium acetate buffer solution elution of pH6.0, coutroi velocity 1ml/min after 1.5 column volumes.Start to collect sample component after 22.5mL to be passed through, often pipe 0.5mL, collect 12 pipes. The sample collected is after SDS-polyacrylamide gel electrophoresis (SDS-PAGE) separates, and a part of gel coomassie brilliant blue staining identifies purity (accompanying drawing 7a). Another part gel is made Western-Blot and is transferred on nitrocellulose filter by albumen, and the protein sample that result display purification obtains can by specificity ACTH antibody recognition (accompanying drawing 7b).

2. there is the screening of long-acting efficient ACTH mutant

2.1 various ACTH polypeptide extent of metabolism in mouse blood and Biological acdtivity in vivo measure

2.1.1 after administration, in blood, ACTH extent of metabolism measures

The Kunming mouse (Hainan Province's Experimental Animal Center) selecting 4 week old body weight to be 20g, is divided into 4 groups, respectively blank group (Con), ACTH24, ACTH (WT), ACTH (E5D); The administration corresponding ACTH polypeptide of treated animal intravenous injection, drug level is 45.5ng/g, blank group injection equal-volume normal saline. Pluck side eyeball blood sampling after 15min, separate serum; Pluck the blood sampling of opposite side eyeball after 45min, separate serum. The ACTH content of adopted serum sample is detected with ACTHELISA test kit (Nanjing Sen Beijia). (accompanying drawing 8a)

2.1.2 different ACTH polypeptide Biological acdtivity in vivos measure

ACTH can stimulate the synthesis of glucocorticoid (GC), can detect ACTH activity in Mice Body by detecting the concentration change of GC in Mice Body. Selecting 4 week old body weight is the Kunming mouse of 20g, packet ibid, respectively Con, ACTH24, ACTH (WT), ACTH (E5D), be administered the corresponding ACTH polypeptide of treated animal intravenous injection, drug level is 32.5ng/g, Con group injection equal-volume normal saline. Pluck side eyeball blood sampling after 15min, separate serum; Pluck the blood sampling of opposite side eyeball after 45min, separate serum. GC level in adopted serum sample is detected by Adrenal Cortex hormone ELISA kit (Nanjing Sen Beijia). (accompanying drawing 8b)

2.2 different ACTH polypeptide stimulate adrenocortical tumor Y1 emiocytosis GC level determination

37 DEG C, in 5% CO2 gas incubator, in 6 orifice plates, cultivate Adrenal Cortex tumor Y1 cell by the F12 culture medium (Gibco) containing 10%FBS (Gibco), until adherent cover with cell monolayer after. Rinse 3 times with the phosphate buffer of calcium-magnesium-containing ion, add serum-free F12 culture medium (Gibco) afterwards and cultivate 2h. Stimulate Y1 cell with the different ACTH polypeptide (ACTH, ACTH24, E5D) of 200ng/ml, set up blank, stimulate 6h, 12h, 24h, 48h respectively. Take culture supernatant, detect, by adrenocortical hormone ELISA kit (Nanjing Sen Beijia), G/C content originally of being sampled. (see Fig. 8)

Above inside and outside pharmacological experiment shows, ACTH (E5D) and wild type ACTH (WT), ACTH24 promote that the biological activity that glucocorticoid produces is suitable. And after ACTH (E5D) intravenously administrable 15min and 45min, blood drug level is significantly higher than ACTH (WT) and ACTH24. So, ACTH (E5D) is a kind of long-acting people's thyroliberin of gene recombinaton.

Accompanying drawing explanation

Fig. 1. technical scheme.

Fig. 2 .HisTag-Linker-EKst-ACTH-pET30a plasmid vector collection of illustrative plates and digestion verification. A.HisTag-Linker-EKst-ACTH-pET30a plasmid map. Red curved arrow display HisTag-Linker-EKst-ACTH open reading frame (CDS) and transcriptional orientation. B.HisTag-Linker-EKst-ACTH-pET30a plasmid BamH1 and Sal1 double digestion are identified.M: molecular weight marker. Swimming lane 1: pET30a empty plasmid vector BamH1 without HisTag-Linker-EKst-ACTH sequence and Sal1 double digestion. Swimming lane 2:HisTag-Linker-EKst-ACTH-pET30aBamH1 and Sal1 double digestion, small fragment is EKst-ACTH, and large fragment is carrier pET30a. HisTag:His label; Fragment is linked between His label and EKst-ACTH that Linker:123 base is constituted; Enterokinasesite (EKst): enterokinase substrate nucleoside acid sequence.

Fig. 3 .ACTH wild type (WT) sequencing result figure. Note: in figure, the base arrangement numerical value of the 1 to 1000 of labelling starts counting up from the order-checking original position that can detect.

Fig. 4 .ACTH saltant type (E5D) sequencing result figure. ACTH sequence Glutamic Acid (E) codon GAA has changed codes for aspartate (D) codon GAC into. Note: in figure, the base arrangement numerical value of the 1 to 1000 of labelling starts counting up from the order-checking original position that can detect.

Fig. 5. the NI column purification result of recombiant protein HisTag-Linker-EKst-ACTH. After HisTag-Linker-EKst-ACTH-pET30a plasmid is expressed in BL-21-DE3 engineering bacteria, through ultrasonication, after supernatant ni-sepharose purification, after SDS-PAGE (15%Tris-Glycine polyacrylamide gel) separates, coomassie brilliant blue R_250 native staining. M: molecular weight marker. The separation component of the HisTag-Linker-EKst-ACTH fusion protein after swimming lane 1-8:NI column purification, in component 2,3,4,5, HisTag-Linker-EKst-ACTH fusion protein content is higher.

The WesternBlot detection that Fig. 6 .HisTag-Linker-EKst-ACTH fusion protein cuts through enterokinase enzyme action. M:marker; Swimming lane 1: albumen HisTag-Linker-EKst-ACTH is after enterokinase enzyme action, the ACTH cut is detected with WesternBlotting (16.5%Tris-Tricine polyacrylamide gel), primary antibodie is mouse-anti people ACTH (Santacruz) specific antibody, two resist for Alexa488 fluorescent labeling sheep anti-mouse antibody (Abcam), detect fluorescent bands with TyphoonFLA9500 (GEHealthcare).

Fig. 7. the result figure after CM-cellulose cation exchange column (Sigma-Aldrich) purification of the sample after cutting. A. the sample after purification is after 12%Bis-Tris polyacrylamide gel electrophoresis separates, and uses coomassie brilliant blue R_250 coloration result. ACTH24: only comprise the amino acid whose ACTH active fragment of 24, N end. ACTH (WT): comprise whole 39 amino acid whose wild type ACTH. ACTH (E5D): be the saltant type ACTH of aspartic acid by the 5th of wild type ACTH the glutamic acid mutation. B. purification ACTH (E5D) component is through WesternBlotting (12%Bis-Tris polyacrylamide gel) testing result. Primary antibodie is mouse-anti people ACTH (SantaCruz) specific antibody, and two resist for Alexa488 fluorescent labeling sheep anti-mouse antibody (Abcam), detect fluorescent bands with TyphoonFLA9500 (GEHealthcare).

Fig. 8. internal blood drug level and short glucocorticoid nucleus formation after intravenous injection ACTH. A. ACTH level in 15 and 45 minutes blood after mouse tail vein injection wild type (WT) or saltant type (E5D) ACTH. * P < 0.01, compares with blank group (Con);^##P < 0.01, compares with wild type ACTH (WT); N=12. Result prompting ACTH (E5D) is less susceptible to be metabolized than wild type ACTH. B.ACTH (WT) and ACTH (E5D) improves glucocorticoid levels effect in Mice Body.* P < 0.01, compares with blank group (Con);^##P < 0.01, compares with wild type ACTH (WT); N=12. Compared with ACTH (WT) and ACTH24, ACTH (E5D) has higher activity in Mice Body. Con: blank group. WT: wild type ACTH; ACTH24: only comprise the amino acid whose ACTH active fragment of N-terminal 24; The 5th glutamic acid mutation of E5D:N end is the ACTH mutant of aspartic acid.

Fig. 9 .ACTH (WT) and ACTH (E5D) stimulates adrenal cortex Y1 cell strain secretion glucocorticoid experimental result. * P < 0.01, compares with blank group (Con); N=3. The effect that result display ACTH (E5D) stimulated in vitro adrenal cortical cell produces glucocorticoid is suitable with wild type ACTH and ACTH24. WT: wild type ACTH; ACTH24: only comprise the amino acid whose ACTH active fragment of N-terminal 24; The 5th glutamic acid mutation of E5D:N end is the ACTH mutant of aspartic acid.

1.DNASEQUENCELISTING

<110>Wang great Yong

<120>preparation method of a kind of long-acting thyroliberin of gene recombinaton (ACTH)

<130>ACTH(nucleotide sequence)

<160>3

<170>PatentInversion3.3

<210>1

<211>117

<212>DNA

<213>artificial sequence (ACTH(E5D))

<400>1

tcttactctatggaccacttccgttggggtaaaccggttggtaaaaaacgtcgtccggtt60

aaagtttacccgaacggtgctgaagacgaatctgctgaagctttcccgctggaattc117

<210>2

<211>117

<212>DNA

<213>artificial sequence (ACTH(WT))

<400>2

tcttactctatggaacacttccgttggggtaaaccggttggtaaaaaacgtcgtccggtt60

aaagtttacccgaacggtgctgaagacgaatctgctgaagctttcccgctggaattc117

<210>3

<211>72

<212>DNA

<213>artificial sequence (ACTH24)

<400>3

tcttactctatggaacacttccgttggggtaaaccggttggtaaaaaacgtcgtccggtt60

aaagtttacccg72

2.PROTEINSEQUENCELISTING

<110>Wang great Yong

<130>ACTH(protein sequence)

<160>3

<170>PatentInversion3.3

<210>1

<211>39

<212>PRT

<213>artificial sequence (ACTH(E5D))

<400>1

SerTyrSerMetAspHisPheArgTrpGlyLysProValGlyLysLys

151015

ArgArgProValLysValTyrProAsnGlyAlaGluAspGluSerAla

202530

GluAlaPheProLeuGluPhe

35

<210>2

<211>39

<212>PRT

<213>artificial sequence (ACTH(WT))

<400>2

SerTyrSerMetGluHisPheArgTrpGlyLysProValGlyLysLys

151015

ArgArgProValLysValTyrProAsnGlyAlaGluAspGluSerAla

202530

GluAlaPheProLeuGluPhe

35

<210>3

<211>24

<212>PRT

<213>artificial sequence (ACTH24)

<400>3

SerTyrSerMetGluHisPheArgTrpGlyLysProValGlyLysLys

151015

ArgArgProValLysValTyrPro

20

Claims

1. adopt the gene engineering method that this patent is applied to prepare thyroliberin (ACTH), including wild type and saltant type.

2. adopt Amino Acid-Induced Site-Directed Mutation described by this patent, it is thus achieved that there is bioactive ACTH mutant.

3. adopt Amino Acid-Induced Site-Directed Mutation described by this patent, it is thus achieved that the ACTH mutant being not easily metabolized in blood.

The ACTH of 4.N end the 5th amino acids sudden change.

5. this patent adopts wild type ACTH and the preparation technology of point mutation type ACTH.

6., by the fusion protein described by construction expression this patent, namely in polypeptide chain side plus the polypeptide linker (this patent is called Linker) described by this patent, improve polypeptide expression in engineering bacteria.