CN103694330B - Go the preparation method of the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label - Google Patents
Go the preparation method of the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label Download PDFInfo
- Publication number
- CN103694330B CN103694330B CN201310600092.2A CN201310600092A CN103694330B CN 103694330 B CN103694330 B CN 103694330B CN 201310600092 A CN201310600092 A CN 201310600092A CN 103694330 B CN103694330 B CN 103694330B
- Authority
- CN
- China
- Prior art keywords
- albumen
- rgd3
- column volumes
- recombinant
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention discloses a kind of simple to operate, recombinant lamprey Lj-RGD3 albumen rLj-RGD3(Tag removing affinitive layer purification label that purifying rate is high
-) preparation method, construct the recombinant expression vector pET23b-RGD3(Tag without any purification tag
-), and enter to express to carry out in bacterium the expression of gene recombinant protein by this recombinant plasmid transformed, utilize metal chelate ions affinity chromatography, cationic exchange, dialysis etc., prepare the Lampetra japonica (Martens). Lj-RGD3 gene recombinant protein without any affinitive layer purification label, called after rLj-RGD3(Tag
-) albumen, its purity of protein reaches>=and 99%.
Description
Technical field
The present invention relates to a kind of method for purifying proteins, especially a kind of simple to operate, recombinant lamprey Lj-RGD3 albumen rLj-RGD3(Tag removing affinitive layer purification label that purifying rate is high
-) preparation method.
Background technology
Lj-RGD3 is the RGD toxin protein deriving from Japanese lamprey oral gland secretory product, be made up of 117 amino-acid residues, the primary structure of Lj-RGD3 is except having three RGD die bodys and a pair this typical RGD toxin protein feature of halfcystine, also containing 17 Histidines, 17 arginine, it is the basic protein of a class HRG, being disclosed in the patent No. is 200510083437.7, name is called in the Chinese invention patent document of " gene cloning and expression of the Japanese lamprey oral gland RGD die body albumen of tool antitumor action ", the i.e. albumen of called after Lampetrin3, there is anti-angiogenic rebirth, antitumor propagation, the effects such as antithrombotic.
Conventional purification albumen is very complicated, not only need according to molecular weight of albumen to be purified or the charged difference of institute and select salting-out process, molecular sieve chromatography, ion exchange chromatography, affinity chromatography and hydrophobic chromatography etc., also to carry out corresponding selection in numerous reagent or filler and determine the concrete purification step of case, nonetheless, the purifying rate of albumen is also lower.Therefore, the purifying of conveniently gene recombinant protein at present, will introduce affinitive layer purification label (GST label and HIS) to obtain the gene recombinant fusion protein with purification tag for albumen when vector construction usually.Affinity tag has become post-genomic science epoch purification of recombinant proteins conventional means, this method is without the need to understanding biochemical characteristic or the physiologically active of protein, just by tape label recombination fusion protein optionally with the ligand binding on chromatography substrate, thus be able to any protein of purifying.But for the application of the structural research of protein, medicine or diagnostic reagent, affinity tag also exists potential interference.Preparation high purity is without the gene recombinant protein rLj-RGD3(Tag of any affinitive layer purification label
-) be the necessary step being applied to drug research its future, now also without any about rLj-RGD3(Tag
-) remove the report of affinity chromatography label protein purifying process.
Summary of the invention
The present invention is the above-mentioned technical problem in order to solve existing for prior art, provides a kind of simple to operate, recombinant lamprey Lj-RGD3 albumen rLj-RGD3(Tag removing affinitive layer purification label that purifying rate is high
-) preparation method.
Technical solution of the present invention is: a kind of preparation method removing the Lampetra japonica (Martens). Lj-RGD3 gene recombinant protein of affinitive layer purification label, is characterized in that carrying out in accordance with the following steps:
A. introduce terminator codon at Lj-RGD3 gene order 3 ' end, be connected with NdeI with HindIII restriction enzyme site with carrier, be transformed into the Screening and Identification of carrying out positive transformant after expressing bacterium;
B. IPTG abduction delivering is carried out to positive recombinant;
C. the recombinant protein of expressing is extracted;
D. as follows purifying is carried out successively to the albumen extracted:
D-1. protein purification is carried out by metal chelate ions affinity column HiTrapIMACHP:
Be connected to by HiTrapIMACHP post on the BIO-RAD instrument using 20% alcohol flushing good, carry out rinse, keep UV value stabilization in the process of rinse with the distilled water of 10 times of column volumes to pillar, initial value is 0; Walk post with the copper-bath of the 0.1M concentration of 2.5 times of column volumes, then use the distilled water flushing pillar of 10 times of column volumes; Balance pillar with the Bindingbuffer of 10 times of column volumes, keep pillar UV value stabilization, UV baseline value is 0; The albumen of extraction is crossed post, and balance pillar with the Bindingbuffer of 15 times of column volumes more afterwards, then use Elutionbuffer wash-out target protein, flow velocity is 1ml/min; Collecting elutriant is 1ml/ pipe, reclaims the sample of 42nd ~ 54 pipes, is stored in-20 DEG C; Described Bindingbuffer solution composition is made up of (PH:7.4 ± 0.02) 20mM sodium phosphate, 0.5M sodium-chlor, 5mM imidazoles; Elutionbuffer solution composition used is made up of (PH:4 ± 0.02) 20mM sodium phosphate, 0.5M sodium-chlor, 500mM imidazoles;
D-2. SP post is adopted to carry out cation-exchange chromatography to collected albumen:
Be connected in BIO-RAD instrument by cationic exchange coloum SP post, clean pillar with aqua sterilisa, flow velocity is 1ml/min, washes 10 column volumes; With the low salt buffer balance pillar of 10 times of column volumes, flow velocity is 1ml/min, until UV baseline remains in stable level, initial value is 0; The albumen collected is crossed SP post, then uses the high-salt buffer wash-out target protein of 10 times of column volumes, flow velocity is 1ml/min; Collecting elutriant is 1ml/ pipe, reclaims the sample retention of 26th ~ 34 pipes in-20 DEG C; Low salt buffer composition used is made up of 50mMTris-HCl and 50mMNaCl, and high-salt buffer composition used is made up of 50mMTris-HCl and 1MNaCl;
D-3. dialyse:
Employing molecular weight cut-off is that the dialysis tubing of 10kDa carries out 4 DEG C of dialyzed overnights to the above-mentioned albumen through steps d-2 purifying, and dialysis buffer liquid is deionized water.
D-4. lyophilize:
By the albumen of dialysing through steps d-3 through lyophilize, preparation rLj-RGD3(Tag-) protein freeze-dried powder.
Described a step Lj-RGD3 gene order 3 ' end introduce terminator codon, the primer sequence be connected with NdeI with HindIII restriction enzyme site with carrier is:
P1：5’-XXcatatgtcaacgttcatcaacggaacc-3’
P2：5’-XXaagctttcactccccaacacattcact-3’。
The present invention constructs the recombinant expression vector pET23b-RGD3(Tag without any purification tag
-), and enter to express to carry out in bacterium the expression of gene recombinant protein by this recombinant plasmid transformed, utilize the methods such as metal chelate ions affinity chromatography, cationic exchange, dialysis and lyophilize, prepare the Lampetra japonica (Martens). Lj-RGD3 gene recombinant protein without any affinitive layer purification label, called after rLj-RGD3(Tag
-) albumen, simple to operate, purifying rate is high, its purity of protein reaches>=and 99%.
Accompanying drawing explanation
Fig. 1 is that BIO-RAD detects the embodiment of the present invention through metal chelate ions affinity chromatography column purification rLj-RGD3(Tag
-) result figure.
Fig. 2 is that TricineSDS-PAGE detects the embodiment of the present invention through metal chelate ions affinity chromatography column purification rLj-RGD3(Tag
-) result figure.
Fig. 3 is that BIO-RAD detects the embodiment of the present invention through cationic exchange coloum SP column purification rLj-RGD3(Tag
-) result figure.
Fig. 4 is that TricineSDS-PAGE detects the embodiment of the present invention through cationic exchange coloum SP column purification rLj-RGD3(Tag
-) result figure.
Embodiment
Carry out in accordance with the following steps:
A. introduce terminator codon at Lj-RGD3 gene order 3 ' end, be connected with carrier with NdeI with HindIII restriction enzyme site, be transformed into the Screening and Identification of carrying out positive transformant after expressing bacterium, concrete steps are as follows:
A.1 precious biological plasmid extraction kit is adopted to extract pET23b plasmid;
A.2 with the DNA of Lj-RGD3 for substrate, react through PCR with primer P1, P2, obtain goal gene, then react with primer P1, P2 and pET23b plasmid, connection goal gene DNA fragmentation and carrier pET23b; Because primer P1, P2 are respectively with NdeI and HindIII restriction enzyme site, and these two restriction enzyme sites are also the multiple clone site of pET23b, and this makes goal gene DNA fragmentation and carrier pET23b be connected to become possibility; And terminator codon is in the introducing of Lj-RGD3 gene order 3 ' end, the HIS label on pET23b plasmid can not be expressed, the sequence of constructed expression of recombinant plasmid albumen is the rLj-RGD3(Tag without affinitive layer purification label
-) albumen.Primer P1, P2 sequence is as follows:
P1:5’-XXcatatgtcaacgttcatcaacggaacc-3’
P2:5’-XXaagctttcactccccaacacattcact-3’；
A.3 by connected product CaCl
2method is converted in clone bacterium E.coliBL21;
A.4 T is utilized
7universal primer method and double digestion method carry out the Screening and Identification of positive transformant.
B. IPTG abduction delivering is carried out to positive recombinant:
Carry out to positive recombinant the IPTG abduction delivering that final concentration is 1mmol/L, abduction delivering condition is 30 DEG C of inductions of spending the night.
C. the recombinant protein of expressing is extracted;
C.15000g centrifugal 15min gathers in the crops thalline, abandons supernatant, and raffinate is flowed out as far as possible.The ratio re-suspended cell of the ice-cold Bindingbuffer of 4ml is added with the original fluid of every 100ml; Described Bindingbuffer solution pH value is 7.4 ± 0.02, and composition is made up of 20mM sodium phosphate, 0.5M sodium-chlor, 5mM imidazoles;
C.2 re-suspended cell liquid is placed in ultrasonic degradation cell on ice, broken power 30%, broken 10s, stop 5s, the time is 30min, and solution is thickness no longer;
C.312000g centrifugal 20min is to remove cell debris;
C.4 supernatant is collected, with the membrane filtration of 0.45 μm.
D. as follows purifying is carried out successively to the albumen (supernatant liquor after filtration) extracted:
D-1. protein purification is carried out by metal chelate ions affinity column HiTrapIMACHP:
Be connected to by HiTrapIMACHP post on the BIO-RAD instrument using 20% alcohol flushing good, carry out rinse with the distilled water of 10 times of column volumes to pillar, monitor the UV value of whole system in the process of rinse at any time, keep UV value stabilization, initial value is 0; Walk post with the copper-bath of the 0.1M concentration of 2.5 times of column volumes, then use the distilled water flushing pillar of 10 times of column volumes, remove the metal ion failing to be combined with pillar, and pillar is combined fully with metal ion; Balance pillar with the Bindingbuffer of 10 times of column volumes, keep pillar UV value stabilization, UV baseline value is 0; The albumen of extraction is crossed post, and balance pillar with the Bindingbuffer of 15 times of column volumes more afterwards, albumen and pillar are combined closely and uses Elutionbuffer wash-out target protein again, flow velocity is 1ml/min; Collecting elutriant is 1ml/ pipe, and collection tube is numbered 1-55, reclaims the sample of 42nd ~ 54 pipes, is stored in-20 DEG C; Described Bindingbuffer solution pH value is 7.4 ± 0.02, and composition is made up of 20mM sodium phosphate, 0.5M sodium-chlor, 5mM imidazoles; Elutionbuffer solution PH used is 4 ± 0.02, and composition is made up of 20mM sodium phosphate, 0.5M sodium-chlor, 500mM imidazoles;
Collected elutriant is detected through BIO-RAD, result as shown in Figure 1: X-coordinate is collection time (minute), and ordinate zou is 280nm absorbance value A
280.Peak A: foreign protein stream wears peak; Peak B:rLj-RGD3(Tag
-) albumen elution peak.Show: peak B from application of sample with regard to albumen for the purpose of 42nd ~ 54 pipe samples of initial collection.
Collected elutriant is detected through TricineSDS-PAGE, result as shown in Figure 2: 1, be with HIS label rLj-RGD3 contrast; 2, marker(molecular weight is respectively 42kDa from top to bottom, 26kDa, 17kDa, 10kDa, 4.6kDa); 3, No. 48 pipe samples; 4, No. 49 pipe samples; 5, No. 50 pipe samples; 6, No. 51 pipe samples; 7, No. 52 pipe samples; 8, No. 53 pipe samples; 9, No. 54 pipe samples.Due to rLj-RGD3(Tag
-) albumen is basic protein, its electrophoretic mobility is less than normal protein, object band than desired location closer to well direction.Show: peak B from application of sample with regard to albumen for the purpose of 42nd ~ 54 pipe samples of initial collection, but containing an assorted band.
D-2. SP post is adopted to carry out cation-exchange chromatography to collected albumen:
The English full name of SP is Saturatedpolyesterplastic, and Chinese is translated into saturated polyester plastics, the present invention
Middle finger resin material, i.e. SP resin.
Be connected in BIO-RAD instrument by cationic exchange coloum SP post, clean pillar with aqua sterilisa (0.22um membrane filtration), flow velocity is 1ml/min, washes 10 column volumes; With the low salt buffer balance pillar of 10 times of column volumes, flow velocity is 1ml/min, until UV baseline remains in stable level, initial value is 0; The albumen collected is crossed SP post, then uses the high-salt buffer wash-out target protein of 10 times of column volumes, flow velocity is 1ml/min; Collecting elutriant is 1ml/ pipe, reclaims the sample retention of 26th ~ 34 pipes in-20 DEG C; Low salt buffer composition used is made up of 50mMTris-HCl and 50mMNaCl, and high-salt buffer composition used is made up of 50mMTris-HCl and 1MNaCl;
Collected elutriant is detected through BIO-RAD, result as shown in Figure 1: X-coordinate is collection time (minute), and ordinate zou is 280nm absorbance value A
280.Peak A: foreign protein stream wears peak; Peak B:rLj-RGD3(Tag
-) albumen elution peak.Show: peak A from application of sample with regard to albumen for the purpose of 26th ~ 34 pipe samples of initial collection.
26th ~ 34 pipe elutriants of collected peak B are detected through TricineSDS-PAGE, result as shown in Figure 2: 1, marker(molecular weight is respectively 42kDa from top to bottom, 26kDa, 17kDa, 10kDa, 4.6kDa); 2, HIS label rLj-RGD3 contrast is with; ; 3,27 pipe samples; 4,28 pipe samples; 5,29 pipe samples; 6,30 pipe samples; 7,31 pipe samples; 8,32 pipe samples; 9,33 pipe samples; 10,34 pipe samples.Due to rLj-RGD3(Tag
-) albumen is basic protein, its electrophoretic mobility is less than normal protein, object band than desired location closer to well direction.Show: for the purpose of 26th ~ 34 pipe samples, albumen is pure, and be single slice, purity can reach more than 99%.
D-3. dialyse:
Employing molecular weight cut-off is that the dialysis tubing of 10kDa carries out 4 DEG C of dialyzed overnights to the above-mentioned albumen through steps d-2 purifying, and dialysis buffer liquid is deionized water.
E. by dry for the protein frozen through steps d purifying, preparation rLj-RGD3(Tag-) protein freeze-dried powder.
Sequence table
<110> Liaoning Normal University
<120> goes the preparation method of the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label
<160>2
<210>1
<211>27
<212>DNA
<213> artificial sequence
<220>
<223> primer
<400>1
catatgtcaacgttcatcaacggaacc27
<210>2
<211>27
<212>DNA
<213> artificial sequence
<220>
<223> primer
<400>2
aagctttcactccccaacacattcact27
Claims (2)
1. go a preparation method for the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label, it is characterized in that carrying out in accordance with the following steps:
A. introduce terminator codon at Lj-RGD3 gene order 3 ' end, be connected with NdeI with HindIII restriction enzyme site with carrier, be transformed into the Screening and Identification of carrying out positive transformant after expressing bacterium;
B. IPTG abduction delivering is carried out to positive recombinant;
C. the recombinant protein of expressing is extracted;
D. as follows purifying is carried out successively to the albumen extracted:
D-1. protein purification is carried out by metal chelate ions affinity column HiTrapIMACHP:
HiTrapIMACHP post is connected on the BIO-RAD instrument using 20% alcohol flushing good,
Carry out rinse with the distilled water of 10 times of column volumes to pillar, keep UV value stabilization in the process of rinse, initial value is 0; Walk post with the copper-bath of the 0.1M concentration of 2.5 times of column volumes, then use the distilled water flushing pillar of 10 times of column volumes; Balance pillar with the Bindingbuffer of 10 times of column volumes, keep pillar UV value stabilization, UV baseline value is 0; The albumen of extraction is crossed post, and balance pillar with the Bindingbuffer of 15 times of column volumes more afterwards, then use Elutionbuffer wash-out target protein, flow velocity is 1ml/min; Collecting elutriant is 1ml/ pipe, reclaims the sample of 42nd ~ 54 pipes, is stored in-20 DEG C; Described Bindingbuffer solution composition is made up of 20mM sodium phosphate, 0.5M sodium-chlor, 5mM imidazoles; Elutionbuffer solution composition used is made up of 20mM sodium phosphate, 0.5M sodium-chlor, 500mM imidazoles;
D-2. SP post is adopted to carry out cation-exchange chromatography to collected albumen:
Be connected in BIO-RAD instrument by cationic exchange coloum SP post, clean pillar with aqua sterilisa, flow velocity is 1ml/min, washes 10 column volumes; With the low salt buffer balance pillar of 10 times of column volumes, flow velocity is 1ml/min, until UV baseline remains in stable level, initial value is 0; The albumen collected is crossed SP post, then uses the high-salt buffer wash-out target protein of 10 times of column volumes, flow velocity is 1ml/min; Collecting elutriant is 1ml/ pipe, reclaims the sample retention of 26th ~ 34 pipes in-20 DEG C; Low salt buffer composition used is made up of 50mMTris-HCl and 50mMNaCl, and high-salt buffer composition used is made up of 50mMTris-HCl and 1MNaCl;
D-3. dialyse:
Employing molecular weight cut-off is that the dialysis tubing of 10kDa carries out 4 DEG C of dialyzed overnights to the above-mentioned albumen through steps d-2 purifying, and dialysis buffer liquid is deionized water;
D-4. lyophilize:
By the albumen of dialysing through steps d-3 through lyophilize, preparation rLj-RGD3Tag-protein freeze-dried powder.
2. the preparation method removing the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label according to claim 1, it is characterized in that: described a step Lj-RGD3 gene order 3 ' end introduce terminator codon, the primer sequence be connected with NdeI with HindIII restriction enzyme site with carrier is:
P1：5’-XXcatatgtcaacgttcatcaacggaacc-3’
P2：5’-XXaagctttcactccccaacacattcact-3’。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310600092.2A CN103694330B (en) | 2013-11-25 | 2013-11-25 | Go the preparation method of the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310600092.2A CN103694330B (en) | 2013-11-25 | 2013-11-25 | Go the preparation method of the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103694330A CN103694330A (en) | 2014-04-02 |
| CN103694330B true CN103694330B (en) | 2016-01-06 |
Family
ID=50356014
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310600092.2A Expired - Fee Related CN103694330B (en) | 2013-11-25 | 2013-11-25 | Go the preparation method of the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103694330B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312809A (en) * | 2016-04-27 | 2017-11-03 | 辽宁师范大学 | The rLj-RGD3 protein preparation methods of endotoxin-free |
| CN107760744B (en) * | 2017-09-30 | 2021-06-11 | 辽宁师范大学 | Preparation method of high-yield and high-stability gene recombinant lamprey Lj-RGD3 protein |
| CN107703309A (en) * | 2017-10-12 | 2018-02-16 | 辽宁师范大学 | ELISA kit for the detection of rLj RGD3 immunogenicities |
| CN107875372A (en) * | 2017-12-20 | 2018-04-06 | 辽宁师范大学 | Recombinant peptide rLj 112 is preparing the application in cooperateing with anticoagulant heparin medicine |
| CN107973848B (en) * | 2017-12-28 | 2020-10-16 | 未名生物医药有限公司 | Method for separating natural sequence nerve growth factor from mixture |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1757727A (en) * | 2005-07-13 | 2006-04-12 | 辽宁师范大学 | Gene clone of and expression Japan lamprey oral cavity gland KGD model protein possessing anti thrombotic action |
| CN1760362A (en) * | 2005-07-13 | 2006-04-19 | 辽宁师范大学 | Gene clone and expression of RGD die body protein of oral gland in Japan lamprey possessing function for anti tumour |
| CN102732524A (en) * | 2011-04-11 | 2012-10-17 | 辽宁师范大学 | Use of histidine-rich glycoprotein (HRG)-like lampetra japonica Lj-RGD3 all RGD deletion mutant Lj-112 in antitumor drug |
| CN103520704A (en) * | 2013-09-10 | 2014-01-22 | 辽宁师范大学 | Application of lampetra japonica genetic recombinant protein rLj-RGD3 in preparation of cerebral ischemia reperfusion protective medicament |
-
2013
- 2013-11-25 CN CN201310600092.2A patent/CN103694330B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1757727A (en) * | 2005-07-13 | 2006-04-12 | 辽宁师范大学 | Gene clone of and expression Japan lamprey oral cavity gland KGD model protein possessing anti thrombotic action |
| CN1760362A (en) * | 2005-07-13 | 2006-04-19 | 辽宁师范大学 | Gene clone and expression of RGD die body protein of oral gland in Japan lamprey possessing function for anti tumour |
| CN102732524A (en) * | 2011-04-11 | 2012-10-17 | 辽宁师范大学 | Use of histidine-rich glycoprotein (HRG)-like lampetra japonica Lj-RGD3 all RGD deletion mutant Lj-112 in antitumor drug |
| CN103520704A (en) * | 2013-09-10 | 2014-01-22 | 辽宁师范大学 | Application of lampetra japonica genetic recombinant protein rLj-RGD3 in preparation of cerebral ischemia reperfusion protective medicament |
Non-Patent Citations (1)
| Title |
|---|
| 去纯化标签的重组七鳃鳗rLj-RGD3(H-)的中试纯化工艺研究;孙琳;《CNKI数据库》;20140301;1-69 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103694330A (en) | 2014-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103694330B (en) | Go the preparation method of the recombinant lamprey Lj-RGD3 albumen of affinitive layer purification label | |
| RU2596408C2 (en) | Method of purifying human granulocyte-colony stimulating factor from recombinant e.coli | |
| CN103555729B (en) | Trail dna sequence, expression and the application of a kind of transformation | |
| CN101092618B (en) | Method for preparing enzyme of dissolving staphylococcal bacteria, its derivative, and method for preparing the derivative | |
| CN101050464B (en) | Method for preparing A gene of recombined protein, and expressed products and application | |
| CN106868025A (en) | The method that tripolymer Ebola virus glycoproteins mutant is prepared with yeast | |
| CN101747409B (en) | Cobra-venom factor and cobra-venom neurotoxin combined separation and purification method | |
| CN103111270B (en) | Adsorbing material of hepatitis B antigen protein and preparation method of material | |
| CN103159824B (en) | A kind of protein purification system of totally-enclosed pipeline and the application in aseptic pyrogen-free pharmaceutical grade protein preparation thereof | |
| CN105669856A (en) | Gene recombination long-acting adrenocorticotropic hormone and preparation method thereof | |
| CN103103209B (en) | Expression and purification method for bombyx mori odorant binding protein (BmOBP2) | |
| CN104292341B (en) | A kind of eight factor fusion protein of blood coagulation and its preparation method and application | |
| CN104031134B (en) | Vector protein for gene therapy as well as preparation method and application of vector protein | |
| CN101225113B (en) | Thymosin alpha1-thymopentin fusion peptide and preparation method thereof | |
| CN101280001A (en) | Preparation of human SDF-1 alpha, human SDF-1 alpha obtained therefrom and use thereof | |
| CN108570118B (en) | Affinity chromatography purification method of placenta-like chondroitin sulfate A or derivative thereof | |
| CN102212513B (en) | Proteolytic enzyme separated from cordyceps sinensis and purification method thereof | |
| CN102153646A (en) | Optimal design and application of novel double-action target spot recombinant hirudin mutant | |
| CN104311656B (en) | 21 albumen of cFGF and its application in treatment rheumatoid arthritis | |
| CN102174068A (en) | Method for purifying fusion protein containing His Tag and formic acid hydrolysis site on large scale | |
| CN105734097B (en) | A kind of MIM-I-BAR protein extraction purification process | |
| CN110003321A (en) | A kind of soluble recombination NGAL Argine Monohydrochloride, gene order and protein preparation method | |
| CN102718846B (en) | Activity-increased SEC 2 mutant protein, coding gene, preparation and application | |
| CN105693841A (en) | Method for extracting and purifying vimentin | |
| CN104047061A (en) | Schistosoma japonicum thioredoxin glutathione reductase Sj TGR single-domain antibody and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160106 Termination date: 20211125 |