CN104047061A - Schistosoma japonicum thioredoxin glutathione reductase Sj TGR single-domain antibody and preparation method thereof - Google Patents

Schistosoma japonicum thioredoxin glutathione reductase Sj TGR single-domain antibody and preparation method thereof Download PDF

Info

Publication number
CN104047061A
CN104047061A CN201410285116.4A CN201410285116A CN104047061A CN 104047061 A CN104047061 A CN 104047061A CN 201410285116 A CN201410285116 A CN 201410285116A CN 104047061 A CN104047061 A CN 104047061A
Authority
CN
China
Prior art keywords
tgr
jipdyyna
single domain
domain antibodies
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410285116.4A
Other languages
Chinese (zh)
Other versions
CN104047061B (en
Inventor
宋丽君
姚媛
余传信
殷旭仁
沈双
高玒
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Institute of Parasitic Diseases
Original Assignee
Jiangsu Institute of Parasitic Diseases
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Institute of Parasitic Diseases filed Critical Jiangsu Institute of Parasitic Diseases
Priority to CN201410285116.4A priority Critical patent/CN104047061B/en
Publication of CN104047061A publication Critical patent/CN104047061A/en
Application granted granted Critical
Publication of CN104047061B publication Critical patent/CN104047061B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

The invention relates to a schistosoma japonicum thioredoxin glutathione reductase Sj TGR single-domain antibody and a preparation method thereof, and belongs to the technical field of molecular biology, immunology and pharmacy of a pharmaceutical technology. The invention provides a recombinant phage display library for displaying an Sj TGR protein single-domain antibody, the Sj TGR protein resistant single-domain antibody and a preparation method thereof. The Sj TGR resistant single-domain antibody disclosed by the invention can be specifically combined with an Sj TGR protein and/or has Sj TGR inhibition activity and can be used for preparing a new drug for curing schistosomiasis or a targeting vector of the drug for cure. The schistosoma japonicum thioredoxin glutathione reductase Sj TGR single-domain antibody disclosed by the invention lays a good foundation for developing the new drug for curing the schistosomiasis and a new curing method and has important significance on controlling schistosomiasis prevalence.

Description

Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof
Technical field
The present invention relates to adopt immunological technique and display technique of bacteriophage structure can show the recombinant phage displaying storehouse of anti-Sj TGR albumen single domain antibodies, and therefrom screening can show can with the protein bound recombinant phage of Sj TGR, adopt the single domain antibodies of genetic engineering technique preparation and the anti-Sj TGR of purification of Recombinant albumen, this antibody can and/or suppress Sj TGR enzymic activity with Sj TGR protein binding, can destroy the redox equilibrium in schistosomicide physiological metabolism process, cause schistosomicide death.This antibody also can be used as the targeting vector of Sj TGR enzymic activity chemical inhibitor, is applicable to new schistosomicide medicine and the development research of targeted therapy method, belongs to the technical fields such as molecular biology, immunology and the pharmacy of biotechnology.
Background technology
Schistosomicide is a kind of zoonosis of serious harm human health, and the whole world has 76 countries to have schistosomiasis endemic, and 600,000,000 populations of having an appointment are subject to the threat of schistosomicide, has Schistosomiasis patients more than 2,000 ten thousand.Through unremitting effort in 60 years, China's 2.4 hundred million populations of still having an appointment were threatened by schistosomicide, have Schistosomiasis patients more than 20 ten thousand people, and the natural condition of schistosomiasis endemic still exist.Owing to not preventing the vaccine of schistosomicide, the control of schistosomicide is main dependence pharmacological agent at present.Praziquantel is current unique schistosomicide medicine, due to long-term large-scale Reusability, there is the persister of anti-praziquantel in Schistosoma mansoni, Schistosoma haematobium, and also there is the phenomenon that praziquantel susceptibility is declined the popular Schistosoma japonicum of China, bring serious challenge to following schistosomiasis control.Therefore, developing new schistosomicide medicine and methods for the treatment of is current urgent scientific research mission.
Vital process is made up of a series of biochemical metabolism process, and in this process, in body, many protein moleculars are oxidized, and produce a large amount of toxicity oxygen molecules.Oxidized material must could recover its biological function through reduction, and toxicity oxygen molecule must be decomposed and could remove toxicity, and the redox in organism reaches balance again like this, and vital movement process just can continue.Will cause biological death once this balance is destroyed.Therefore, disturb the function of some important protein moleculars in schistosomicide vital process, it is lost activity, may destroy bilharzial a certain important biochemical metabolism process, causing schistosomicide death, reach the object for the treatment of schistosomicide, is the available strategy of new drug development.These important protein moleculars (being also called the necessary protein molecular of vital process, essential molecules) in vital process are the important potential target molecules of new drug development.
Existing achievement in research shows that schistosomicide Trx glutathione reductase (TGR) is a necessary protein molecular in schistosomicide redox equilibrium metabolic process, suppress expression or the function of schistosomicide TGR, can cause polypide death, be that a very potential schistosomicide infects new drug development target, the inhibitor of exploitation schistosomicide TGR molecule enzymic activity has become the focus of schistosomicide treatment new drug research.
Proteinase inhibitor has comprised chemical inhibitor, peptide inhibitor and antibody inhibition.TGR is present in intracellular protein molecular, and therefore, medicine must be introduced into could be combined with TGR molecule in cell and bring into play drug action.If medicine orientation is passed to intracellular target molecule by entering intracellular targeting vector, can effectively improve the result for the treatment of of medicine, reduce drug dose and Side effects of pharmaceutical drugs.Targeted therapy, due to high degree of specificity and the selectivity of its action effect, has obtained application widely in anti-pathogen infection and antineoplaston.According to the constitutional features for the treatment of target, can select can be with the antibody molecule of target molecule specific binding or ligand molecular as targeting vector, and specific antibody is in targeted therapy, to use maximum targeting vectors.Utilize antibody prepared by various technology to be widely used in the fields such as medical diagnosis on disease, treatment, immunologic intervention, scientific research and suitability for industrialized production, demonstrate huge development prospect.In vertebrates body, antibody is that armour is avoided the natural molecule that cause of disease, malignant cell and toxic molecule are invaded, and it has specificity and avidity highly to target molecules.Therefore, selecting antibody is very reasonably to select as the targeting vector of medicine or medicine.But, conventional mouse monoclonal antibody there will be serious human antimouse antibody reaction (HAMA) in clinical treatment, and have that molecular weight is large, immunogenicity is strong, penetration power is weak and the shortcoming such as poor stability, cause antibody to be restricted as the application of medicine and targeting vector.Single domain antibodies (Single domain antibody), functional heavy chain antibody IgG (the Heavy chain antibodies that derives from a kind of natural disappearance light chain in camel, alpaca and shark serum, HCAb) variable region (variable domain of the heavy chain of HCAb, VHH), claim again nano antibody (Nanobody).Compared with traditional antibody, the feature of single domain antibodies is: molecular weight is little, approximately only has 1/10 of common antibody, about 15kDa, and tissue penetration is strong, can enter in cell; Single domain antibodies is similar to traditional antibody VH district, but its structure and sequence all have unique distinction, the CDR3 of single domain antibodies is long compared with the VH CDR3 of conventional I gG, can form special large-scale bulge loop structure, make it more easily be attached to the crack at enzyme active center place, or in depression, be natural activity inhibitor; In addition, it also has good water solubility, be easy to express in prokaryotic organism and produce, stable in properties, can be high temperature resistant and acid or alkali environment, immunogenicity low, be difficult for causing the advantages such as rejection.Therefore, single domain antibodies has possessed the potential as therapeutic antibodies of new generation and targeting vector.
If prepare the specificity single domain antibodies of anti-SjTGR albumen, this antibody will possess suppresses the function of Sj TGR activity, and can enter and in cell, kill schistosomicide.Theoretically, the specificity single domain antibodies of anti-Sj TGR has the treatment pharmacy of schistosomicide and the dual-use function of target.If taking anti-Sj TGR single domain antibodies as carrier, the chemical inhibitor of anti-Sj TGR is sent and is entered in bilharzial cell, can reach dual insecticidal effect, can also reduce the therapeutic dose of chemical inhibitor, thereby alleviate the side effect of chemicals simultaneously.Therefore, prepare the specificity single domain antibodies of anti-Sj TGR, there is important using value to developing new schistosomicide infection medicine and treatment means.
Phage display single domain antibodies storehouse is the gene fragment of a group coding single domain antibodies to be inserted into and the opening between beginning signal sequence and its amber terminator codon of the coat protein g III gene of phage M13, because Host Strains TG1 can produce a kind of tRNA that suppresses type, suppress to insert the amber terminator codon between allogenic gene and gene3 protein gene sequence on phage, make to insert between allogenic gene and gene3 protein gene and can read in the time translating, thereby make to insert between the g III albumen of extrinsic protein and phage amalgamation and expression occurs, and be together illustrated in phage surface.If whole heavy chain antibody genes of SjTGR immunity camel are inserted in phasmid pCANTab5E, just can be built into the phage display library that may show anti-SjTGR antibody heavy chain variable regions whole in immune camel body, be referred to as again anti-SjTGR nano antibody phage display library.If by SjTGR proteopexy on solid-phase media (as enzyme plate), make it to react with whole phages of phage display library, phage library shows that the recombinant phage of anti-Sj TGR specific nano antibody just can combine with the SjTGR albumen being fixed on solid-phase media so, remove the phage a little less than unconjugated or bonding force by washing, just can obtain the recombinant phage of showing anti-Sj TGR protein-specific nano antibody, afterwards obtain the gene of the anti-Sj TGR protein-specific nano antibody of coding, thereby can adopt in vitro genetic engineering technique to produce in a large number, the nano antibody of the anti-Sj TGR of preparation specificity albumen, and make nano antibody immortalization as the monoclonal antibody, the application can be subsequently provides antibody sources endlessly.Display technique of bacteriophage is combined genotype and active is combined with the amplification property of phage with phenotype, molecule, realized the conversion to phenotype by genotype, is the revolutionary new technology that antibody drug is developed.
At present about the research of anti-SjTGR single domain antibodies at home, the outer report that all there is not yet.The present invention is with purification of Recombinant Sj TGR protein immunization Xinjiang two-humped camel, collect immune hunchbacked white corpuscle, prepare leukocytic cDNA, adopt single domain antibodies gene-specific primer, by PCR method, amplify the gene fragment of coding camel antibody variable region (single domain antibodies).This gene fragment is inserted in phasmid carrier, builds restructuring phasmid storehouse, save by phage, finally form SjTGR immunity camel antibody heavy chain variable region phage display library (claiming again single domain antibodies phage display library).Utilize the SjTGR protein screening phage display library of purifying, obtain the recombinant phage of showing anti-Sj TGR specificity single domain antibodies, finally prepare the anti-Sj TGR single domain antibodies of purifying by the mode of prokaryotic expression, for the schistosomicide treatment new drug and the treatment measure that further develop based on anti-Sj TGR single domain antibodies are laid a good foundation.
Summary of the invention
The present invention seeks to build the phage display library of a displaying anti schistosoma Trx glutathione reductase SjTGR single domain antibodies, screen anti-Sj TGR protein-specific single domain antibodies, these single domain antibodieses can be combined with SjTGR protein-specific, and/or the function of inhibition Sj TGR enzymic activity, can be used for the research of schistosomicide treatment new drug and medicine targeting vector.
Technical scheme of the present invention: a kind of phage display library of single domain antibodies, the gene that it contains the whole coding single domain antibodies of SjTGR immunity Xinjiang two-humped camel, can be used for screening and prepare anti-Sj TGR albumen single domain antibodies, and screening and the preparation of the specificity single domain antibodies of anti-any other antigen molecule or epi-position.
With single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and the JIPDYYNA-3 of the phage display library screening of described single domain antibodies and the anti-SjTGR of three strains of preparation, it can be used for the schistosomicide treatment exploitation of new drug and the application of the immunology of schistosomicide targeted therapeutic carrier, method or other immunodetection, immunologic intervention and immunotherapy based on this three strains single domain antibodies.
The phage display library of anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies, be made up of one group of recombinant phage that contains the whole single domain antibodies genes of coding Sj TGR immunity Xinjiang two-humped camel, each recombinant phage wherein all can be at the single domain antibodies of a kind of antibody SjTGR of its surface expression.
The anti-SjTGR single domain antibodies of described coding gene source is in the Xinjiang two-humped camel that adopts restructuring Sj TGR immunity, and the immunity system of Xinjiang two-humped camel is subject to after external Sj TGR stimulates forming the blood leukocytes that produces the anti-SjTGR single domain antibodies mRNA of coding.Encode anti-Sj TGR single domain antibodies gene DNA fragment after SjTGR immunity two-humped camel blood leukocytes mRNA reverse transcription is cDNA, obtain by PCR amplification.
Described anti-SjTGR single domain antibodies phage display library is that the full gene of the single domain antibodies of encoding in the two-humped camel blood leukocytes of Sj TGR immunity Xinjiang is inserted in phasmid carrier pCANTab5E by gene recombination technology, build restructuring phasmid storehouse, the full gene that has the anti-Sj TGR single domain antibodies of coding is forgiven in this restructuring phasmid storehouse.Then, this restructuring phasmid group is transformed in e. coli tg1, under the assistance of helper phage M13KO7, is packaged into complete phage, form the phage display library of an energy at the whole single domain antibodieses of the anti-SjTGR of surface display.
The described preferred phasmid carrier for building phage display library is pCANTab5E, includes but not limited to carrier pCANTab5E.
The application in the displaying storehouse of described anti-Sj TGR single domain antibodies phage, including, but not limited to for screening the phage of showing anti-Sj TGR specificity single domain antibodies, can also be used for the screening of the specificity single domain antibodies of anti-other antigen, ligand molecular.Described other antigen, ligand molecular are including, but not limited to macromolecular organic compound, mineral compound and binding substances thereof.
The title of the described anti-Sj TGR of three strains protein-specific single domain antibodies is respectively JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3.
Aminoacid sequence and the SEQ ID NO.1 of described single domain antibodies JIPDYYNA-1 molecule maintain at least 90% homology.
Described single domain antibodies JIPDYYNA-1 molecule, its gene nucleotide series is encoded to SEQ ID NO:4.
Aminoacid sequence and the SEQ ID NO.2 of described single domain antibodies JIPDYYNA-2 molecule maintain at least 90% homology.
Described single domain antibodies JIPDYYNA-2 molecule, its gene nucleotide series is encoded to SEQ ID NO:5.
Aminoacid sequence and the SEQ ID NO.3 of described single domain antibodies JIPDYYNA-3 molecule maintain at least 90% homology.
Described single domain antibodies JIPDYYNA-3 molecule, its gene nucleotide series is encoded to SEQ ID NO:6.
The having of other that the single domain antibodies of described anti-Sj TGR produces including, but not limited to the aminoacid sequence differentiation by the present invention three strain single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 is combined with SjTGR, and/or suppresses the single domain antibodies of Sj TGR activity.
The present invention is restructuring thioredoxin of Schistosoma japonicum glutathione reductase (SjTGR) seleno-protein for screening the albumen of above-mentioned three strain single domain antibodieses.
The aminoacid sequence SEQ ID NO:7 of described SjTGR protein molecular, maintains at least 90% homology.
Described SjTGR protein molecular, its gene nucleotide series is encoded to SEQ ID NO:8.
The invention provides a kind of phage display method of showing anti-Sj TGR specificity single domain antibodies of screening.Particularly, with the restructuring SjTGR coated elisa plate of purifying, the recombinant phage of single domain antibodies phage display library building with the present invention again carries out combination, with washings wash out not in conjunction with or in conjunction with weak phage, then use the phage of 0.1M glycine solution (pH2.2) wash-out and restructuring SjTGR specific binding.By wash-out bacteriophage ehec infection TG1, the phage of the wash-out that increases under the assistance of helper phage.Re-start screening with same method, so repeat to screen three times, finally obtain the recombinant phage that can express the single domain antibodies of being combined with restructuring Sj TGR protein-specific.
The present invention also provides a kind of allogenic gene DNA sequence dna of identifying the anti-Sj TGR protein-specific single-chain antibody of encoding in recombinant phage, and the authentication method of single domain antibodies aminoacid sequence.
Particularly, preparation can be combined with restructuring Sj TGR protein-specific phage DNA, determines the allogenic gene sequence of single domain antibodies of encoding in phage, then deduce into peptide ammino acid sequence by DNA sequence analysis.By with Genbank in the protein that existed or the aminoacid sequence of polypeptide compare, determine the character of the single domain antibodies of this phage expression.
The invention provides expression plasmid construction process and the engineering bacteria construction process of a kind of prokaryotic expression single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3.
Particularly, first the gene-specific primer for amplification coding single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 is synthesized in design, then adopts PCR method from recombinant phage genomic dna, to amplify the DNA fragmentation SEQ ID NO:4,5 and 6 of coding single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3.Then SEQ ID NO:4,5 and 6 is inserted into a kind of expression vector pET-28a(+) middle recombinant expression plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a and the JIPDYYNA-3-pET28a of forming, then recombinant expression plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a and JIPDYYNA-3-pET28a are transformed into respectively to expression restructuring single domain antibodies albumen JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 in a kind of host cell e. coli bl21 (DE3).
The preferred expression plasmid of the present invention is pET28a(+) (Novagen company of U.S. product), be adapted at expressing in colibacillus engineering.But three strain single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 albumen in the present invention also can be selected to utilize other plasmid to express, these expression plasmids include, but are not limited to protokaryon, plasmid that eukaryotic expression system is conventional.
Particularly, this recombinant expression plasmid contains suitable promotor, in order to control the expression of fusion rotein.These promotors include, but are not limited to the tac promotor of the following stated, and preferred promotor is T7.
Described restructuring single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and the preparation method of JIPDYYNA-3 albumen, comprise transcribe, translation, albumen sepn and purifying, and authentication step.
The expression of restructuring single domain antibodies, can detect by the biochemical means of general albumen, including, but not limited to: enzymatic analysis, SDS-PAGE, Western Blotting etc.
The invention provides a kind of restructuring single domain antibodies JIPDYYNA-1, JIPDYYNA-2 of purifying prokaryotic expression and the method for JIPDYYNA-3 albumen.
Particularly, building when recombinant expression vector 5 ' end and expression vector pET28a(+ of this three strains single domain antibodies encoding gene) upper gene order of encoding 6 Histidines (6 × his) merges mutually, make the aminoterminal of expressing the single domain antibodies JIPDYYNA-1, the JIPDYYNA-2 that draw and JIPDYYNA-3 all with a label being formed by 6 Histidines, then utilize these 6 the histidine-tagged features that can be combined with metal ion, adopt method purifying and the preparation three strain single domain antibodieses of nickel ion affinity chromatograph.
The invention provides a kind of authentication method of prokaryotic expression single domain antibodies camel source property.
Particularly, single domain antibodies is expressed to bacterial lysate point on nitrocellulose filter, then with anti-reaction of anti-hunchbacked IgG bis-of HRP mark, whether with DAB colour developing, observing recombinant expressed single domain antibodies can be by anti-hunchbacked two anti-identification.
The invention provides a kind of method of identifying prokaryotic expression single domain antibodies and restructuring Sj TGR protein binding ability.
Particularly, by SDS-PAGE and electrotransfer method respectively by recombinant expressed single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 protein band are transferred on nitrocellulose (NC) film, again by the Sj TGR albumen test of the NC film that contains single domain antibodies protein band and purifying, wash away after unconjugated Sj TGR albumen, again with mouse-anti Sj TGR sero-reaction, with the anti-detection of the anti-mouse IgG bis-of HRP mark, develop the color through chemoluminescence, observe the response situation of recombinant expressed single domain antibodies and restructuring Sj TGR albumen, to judge single domain antibodies and the protein bound ability of Sj TGR.
The invention provides a kind of analytical procedure of restructuring single domain antibodies to the active inhibition of the thioredoxin reductase of Sj TGR albumen of measuring.
Particularly, the active measuring method of thioredoxin reductase (TrxR) is 5-to be joined to sulfo--bis--2-nitrobenzoic acid (DTNB) mix with DPNH (NADPH), in the situation that having TGR to exist, DTNB can be reduced to 5-sulfydryl-2-nitrobenzoic acid (TNB), and the increased value that is 412 nm place absorption values at wavelength by TNB in assaying reaction system is determined the activity of the TrxR of Sj TGR.In above-mentioned system, add the purifying single domain antibodies of some amount, observe its restraining effect to SjTGR albumen thioredoxin reductase activity.
Beneficial effect of the present invention: the anti-Sj TGR single domain antibodies phage display library that the present invention builds is forgiven the encoding gene that has the whole single domain antibodieses of Xinjiang two-humped camel, can be used for screening and the preparation of the specificity single domain antibodies of anti-any antigen molecule.Three strain single domain antibodieses of screening and preparation can be specifically with Schistosoma japonicum existence must protein molecular-Trx glutathione reductase (SjTGR) combination, wherein single domain antibodies JIPDYYNA-3 is inhibited to the thioredoxin reductase of Sj TGR, for the targeting vector of developing new schistosomicide medicine and schistosomicide medicine is had laid a good foundation, there is important meaning to controlling schistosomiasis endemic.
Brief description of the drawings
The SDS-PAGE of the anti-Sj TGR of Fig. 1 purifying camel IgG antibody analyzes, M molecular weight of albumen mark; 1 healthy camel serum; 2 40% saturated ammonium sulphate camel immunoglobulin (Ig)s.
Fig. 2 pcr amplification encoding heavy chain IgG antibody 2, IgG3 variable region gene, M, 1kb standard DNA molecular weight marker; 1, the PCR product of IgG2 variable region gene; 2, the PCR product of IgG3 variable region gene.
Fig. 3 phasmid VHHn-pCANTab5E double digestion analysis of recombinating, M, 1kb standard DNA molecular weight marker; The Sfi1/Not1 double digestion product of 1-20,20 restructuring phasmids.
The anti-Sj TGR of Fig. 4 nano antibody phage library screening phage is eluriated the rate of recovery.
Fig. 5 third round is eluriated the restricted enzyme cutting analysis of wash-out bacteriophage DNA, M, 1 kb standard DNA molecular weight marker; The Sfi1/Not1 double digestion product of 1-10,10 phasmid DNA.
The aminoacid sequence comparison of Fig. 6 tri-strain nano antibodies
The encode amplification of nano antibody gene of Fig. 7, M, 100 bp DNA molecular amount marks; 1, JIPDYYNA-1 amplified production; 2, JIPDYYNA-2 amplified production; 3, JIPDYYNA-3 amplified production.
Fig. 8 recombinant plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a, the restriction analysis of JIPDYYNA-3-pET28a, M, 100 bp DNA molecular amount marks;
1, the JIPDYYNA-1-pET28a plasmid of restructuring is through Nde1/Not1 double digestion product;
2, the JIPDYYNA-2-pET28a plasmid of restructuring is through Nde1/Not1 double digestion product;
3, the JIPDYYNA-3-pET28a plasmid of restructuring is through Nde1/Not1 double digestion product.
The recombinate analysis of nano antibody expression product of Fig. 9, A:M, molecular weight of albumen standard; 1, do not contain the e. coli bl21 expression product of plasmid; 2, contain the e. coli bl21 expression product of empty plasmid pET28a (+); 3, contain the full bacterium of the e. coli bl21 expression product of JIPDYYNA-1-pET28a plasmid; 4, contain the supernatant of the e. coli bl21 expression product of JIPDYYNA-1-pET28a plasmid; 5, contain the precipitation of the e. coli bl21 expression product of JIPDYYNA-1-pET28a plasmid; 6, contain the full bacterium of the e. coli bl21 expression product of JIPDYYNA-2-pET28a plasmid; 7, contain the supernatant of the e. coli bl21 expression product of JIPDYYNA-2-pET28a plasmid; 8, contain the precipitation of the e. coli bl21 expression product of JIPDYYNA-2-pET28a plasmid.
B:M molecular weight of albumen standard; 1, do not contain the e. coli bl21 expression product of plasmid; 2, contain the e. coli bl21 expression product of empty plasmid pET28a; 3, contain the full bacterium of the e. coli bl21 expression product of JIPDYYNA-3-pET28a plasmid; 4, contain the supernatant of the e. coli bl21 expression product of JIPDYYNA-3-pET28a plasmid; 5, contain the precipitation of the e. coli bl21 expression product of JIPDYYNA-3-pET28a plasmid.
The recombinate purifying of nano antibody albumen of Figure 10, M, protein molecular weight mark; 1, the restructuring JIPDYYNA-1 albumen of purifying; 2, the restructuring JIPDYYNA-2 albumen of purifying; 3, the restructuring JIPDYYNA-3 albumen of purifying.
The recombinate hunchbacked source property checking of VHH of Figure 11,1, restructuring JIPDYYNA-1 expresses bacterium lysate; 2, restructuring JIPDYYNA-2 expresses bacterium lysate; 3, restructuring JIPDYYNA-3 expresses bacterium lysate; 4, BL21 bacterium lysate; 5, camel serum.
The interaction of Figure 12 immunoblotting assay restructuring nano antibody and Sj TGR, M, protein molecular weight mark; Restructuring JIPDYYNA-1 albumen, JIPDYYNA-2 albumen and the JIPDYYNA-3 albumen of 1-3, purifying react with Sj TGR, with mouse-anti Sj TGR antibody and the two anti-detections of HRP mark goat-anti mouse; 4, the restructuring JIPDYYNA-1 albumen of purifying does not react with S jTGR, with mouse-anti Sj TGR antibody and the anti-detection of goat-anti mouse two.
The restraining effect of the mixture of Figure 13 JIPDYYNA-1 and Sj TGR different ratios to Sj TGR enzymic activity.
The restraining effect of the mixture of Figure 14 JIPDYYNA-2 and Sj TGR different ratios to Sj TGR enzymic activity.
The restraining effect of the mixture of Figure 15 JIPDYYNA-3 and Sj TGR different ratios to Sj TGR enzymic activity.
The embodiment providing below can at length explain main contents of the present invention, but is not limited to following these contents.
Embodiment 1: the preparation of restructuring Sj TGR protein immunization Xinjiang two-humped camel and serum antibody
Before immunity, take a blood sample through hunchbacked jugular vein, separation of serum, cryopreservation is for subsequent use.(500 μ are complete freund adjuvant antigen g), through the skin of neck of subcutaneous multi-point injection Xinjiang two-humped camel, uses subsequently same dosage Freund's incomplete adjuvant antigen to carry out booster immunization, and immunity is spaced apart 2 weeks, altogether booster immunization 4 times with restructuring purifying Sj TGR albumen for first immunisation.Time after immunity 2 weeks, through camel jugular vein 50 mL that take a blood sample, separation of serum.With carbonic acid buffer (the 10 μ g/mL) coated elisa plate of restructuring Sj TGR albumen, 4 DEG C are spent the night, within second day, seal with 5% skim-milk PBS, 37 DEG C of 2h, again with the immunity camel sero-reaction of doubling dilution, with anti-reaction of the anti-camel IgG bis-of rabbit of HRP mark, with substrate TMB colour developing, measure tiring of Sj TGR immunity Xinjiang two-humped camel serum Sj TGR protein antibodies again.
Carry out by the following method the purifying of camel serum antibody IgG.Before using medical blood-sampling needle to gather immunity, young female Xinjiang is bimodal, and 4 DEG C are spent the night and separate out serum.Use 40% saturated ammonium sulphate to go out the total IgG antibody of camel according to Hanan M. EL-Hewairy method, purge process is as follows:
1) get camel serum 5 mL normal saline dilution to 50 mL, add 33.3 mL saturated ammonium sulphates, dropwise add and stir.
2) beaker is placed to 4 DEG C of hold over night and separate out immunoglobulin (Ig).
3) with 3500 rpm, 4 DEG C of centrifugal 20 min, abandon supernatant, 20 mL physiological saline solutions for precipitation.
4) protein solution of dissolving is put into dialysis tubing, dialyse with 1 × PBS, 4 DEG C of magnetic agitation, every 2 h change a dialyzate, in dialyzate, drip 1% barium chloride solution, whether detect in dialyzate and have ammonium sulfate to exist, until add bariumchloride not produce white spray in dialyzate, expression ammonium sulfate has been dialysed totally.
6) take a morsel dialysis after sample carry out 12% SDS-PAG electrophoresis, observe purification effect.
Result: the effect through anti-Sj TGR protein antibodies in 5 immune camel serum reaches 1 ︰ 12800, shows that immunity succeeds.Through saturated ammonium sulphate, prepare the anti-Sj TGR of the camel IgG antibody of purifying.As shown in Figure 1.
Embodiment 2: the preparation of the anti-Sj TGR of coding camel nano antibody gene fragment
With the centrifugal Sj TGR immunity of 1000 rpm camel anticoagulation 10 min, separated plasma and hemocyte.Adopt the camel white corpuscle parting liquid that percoll (GE Health product) preparation proportion is 1.07, anticoagulation cell is added on to the upper strata of white corpuscle parting liquid, with the rotating speed of 3000 g, at 4 DEG C of centrifugal 30 min, the white cellular layer of collecting interface, in a new aseptic centrifuge tube, adds aseptic PBS to suspend and washed cell, centrifugal 10 min of 1000 rpm, remove supernatant, then add PBS, so repetitive scrubbing cell 3 times, collecting cell precipitation, and counting.
Adopt the total RNA of Trizol extracting Sj TGR immunity camel peripheral blood leucocyte, method is as follows:
1) get approximately 1 × 10 7individual Sj TGR immunity Xinjiang two-humped camel peripheral blood leucocyte, adds the Trizol of respective volume by the ratio of Trizol specification sheets requirements, mix several with aseptic rifle head;
2) room temperature is placed 5 min, allows Nuclear extract complex body dissociate completely;
3) add the ratio of 0.2 mL chloroform to add chloroform in lysate in 1 mL Trizol reagent, cover tightly lid;
4) acutely rock test tube 15 Sec, incubated at room 2-3 min;
5) by 4 DEG C, sample, centrifugal 15 min of 12000 g, centrifugal rear liquid is divided into 3 layers, and bottom is red phenol-chloroform layer, middle layer and colourless upper phase, and RNA is present in the water of upper strata completely;
6) upper strata liquid is carefully transferred in a new centrifuge tube;
7) add glycogen and the Potassium ethanoate (3M) of 10 μ g without RNA enzyme, mix, then add the cold dehydrated alcohol of 2 times of volumes, after mixing ,-20 DEG C of precipitations are spent the night;
8), with 4 DEG C, centrifugal 10 min of 12000 g, remove supernatant (now visible RNA white precipitate);
9) precipitate 2 times by 75% washing with alcohol, then with 4 DEG C, centrifugal 10 min of 12000 g.Remove supernatant as far as possible;
10) by precipitation at room temperature dry 5-10 min fade to translucently to precipitation, can add 50 μ L RNase-free water dissolution RNA precipitations.
Adopt magnetic bead affinity chromatography to prepare Sj TGR immunity camel peripheral blood leucocyte mRNA, method is pressed the specification sheets of the Dynabeads mRNA purification kit of Invitrogen company.
1) will obtain total RNA in add the Lysis/Binding Buffer in test kit, mend to cumulative volume be 1 mL;
2) Oligo (dT) the 25 magnetic bead liquid in abundant resuspended test kit, draw in the 15 mL centrifuge tubes of 1mL magnetic bead to RNase-free, then centrifuge tube are placed on magnetic apparatus;
3) leave standstill to liquid in pipe and become clear, with the liquid in transfer pipet draft tube, centrifuge tube is taken out from magnetic apparatus, add the Binding Buffer that 1 mL is fresh, resuspended washing magnetic bead;
4) centrifuge tube is relay on magnetic apparatus, leave standstill to liquid in pipe and become clear, then sucking liquid;
5) take out and in centrifuge tube, add the resuspended magnetic bead of 1 mL sample lysate from magnetic apparatus, then the sample that contains total RNA is added in magnetic bead, mix;
6) at room temperature continue softly to mix liquid 10 min in pipe, Oligo (dT) 25 combinations on " the A tail " that makes mRNA and magnetic bead;
7) centrifuge tube is placed on magnetic apparatus and leaves standstill 2 min, after the liquid in pipe becomes clearly, sucking liquid;
8) under room temperature, wash 2 magnetic bead/mRNA mixtures with 2 mL Washing Buffer A.Magnetic bead is separated from washings with magnetic apparatus to sucking-off Washing Buffer A;
9) add the synthetic Buffer washing of 1 mL cDNA the first chain magnetic bead once, under magneticaction, separate magnetic bead, sucking-off supernatant liquor;
10) finally add 50 μ L Elution Buffer(10 mM Tris-HCl, pH7.5), and hatch 2 min at 80 DEG C, be positioned over immediately immediately and on magnetic apparatus, separate magnetic bead, and the supernatant that comprises mRNA is transferred in a new RNase-free pipe, and be positioned over preservation on ice;
11), using Elution Buffer as blank, measure concentration and the purity of the mRNA obtaining with Nanodrop 2000 ultraviolet nucleic acid-protein determinators.
Use Pusion tMthe synthetic Sj TGR immunity of RT-PCR kit camel white corpuscle the first chain cDNA, operates to specifications:
In an aseptic 0.5 mL centrifuge tube, add following composition:
mRNA 10 μL
Oligo(dT) Primer 1 μL
RNase-free H 2O 4 μL
Amount to 15 μ L
Mix rear 70 DEG C of water-bath 10 min, then place on ice immediately, add following reagent:
5×RT Buffer 5 μL
10mM dNTP Mix 1.25 μL
RNase-free H 2O 2.75 μL
Mix latter 37 DEG C and hatch 2 min, then add 1 μ L M-MLV reversed transcriptive enzyme, cumulative volume is totally 25 μ L.
Reaction tubes is placed in to 42 DEG C of insulation 60 min, with rearmounted 80 DEG C of heating 10 min, termination reaction.Synthetic cDNA puts 4 DEG C of preservations.
The design of primers of anti-Sj TGR single domain antibodies gene is compiled in amplification
According to the coding camel single domain antibodies gene order of bibliographical information, two subclass heavy chain antibody (IgG2 of design amplification two-humped camel, IgG3) variable region primer, using the leading peptide conserved sequence of camel heavy chain antibody (HCAb) variable region VHH as common upstream primer, and introduce Sfi1 restriction enzyme site, primer sequence is as follows:
VHH-P1:5'-CATGCCATGA CTCGC gGCCC AGCCGGCCgT CCTGGCTGCT CTTCTACAAG G-3'(line part is Sfi1 restriction enzyme site).
The special hinge area sequence of two kinds of hypotype HCAb is as downstream primer and introduce Not1 restriction enzyme site, and primer sequence is respectively:
VHH-P2-IgG2:5'-CGGCACCGGC GCACCT gCGG CCGCcGTGCA TTCTGGTTCA GGTTTTGGTT GTGG-3'(line part is Not 1 restriction enzyme site); VHH-P3-IgG3:5'-CGGCACCGGC GCACCT gCGG CCGCcTTGCA TACTTCATTC GTTCC-3'(line part is Not 1 restriction enzyme site).
Primer is synthetic by the handsome Bioisystech Co., Ltd in Shanghai.
The encode amplification of anti-Sj TGR single domain antibodies gene
Respectively with two couples of primer VHH-P1/VHH-P2(IgG2); VHH-P1/VHH-P3(IgG3) from TGR immunity camel blood leukocytes cDNA, amplify the gene fragment of coding IgG2, IgG3 variable region of heavy chain, and make it 5 ', 3 ' end is respectively with Sfi1, Not1 restriction enzyme site.Amplification system is as follows:
IgG2 amplification:
5×phusion HF buffer 20 μL
dNTPs(10 mM） 2 μL
VHH-P1 (50 μM） 2 μL
VHH-P2（IgG2）(50 μM） 2 μL
CDNA template 10 μ L
Phusion high-fidelity enzyme 1 μ L
ddH 2O 63 μL
Amount to 100 μ L
Amplification condition is as follows: 98 DEG C, denaturation 30 s; 98 DEG C, sex change 10 s, 50 DEG C, annealing 35 s, 72 DEG C, extension 40 s, carry out 35 circulations; 72 DEG C, 10 min, 4 DEG C of preservations.
IgG3 amplification:
5×phusion HF buffer 20 μL
dNTPs(10mM） 2 μL
VHH-P1 (50μM） 2 μL
VHH-P3(IgG3) (50μM） 2 μL
CDNA template 10 μ L
Phusion high-fidelity enzyme 1 μ L
ddH 2O 63 μL
Amount to 100 μ L
Amplification condition is as follows: 98 DEG C, denaturation 30 s; 98 DEG C, sex change 10 s, 55 DEG C, annealing 35 s, 72 DEG C, extension 40 s, carry out 35 circulations; 72 DEG C, 10 min; 4 DEG C of preservations.
Get 5 μ L amplified productions and carry out sepharose (1%) electrophoresis, observe amplified production situation.
The encode purifying of anti-Sj TGR albumen single domain antibodies gene DNA
The PCR product of coding IgG2, IgG3 antibody heavy chain variable region is carried out respectively to low melting-point agarose gel (NuSieve GTG agarose, 1%) electrophoresis, under ultraviolet lamp, extract and contain the big or small target DNA fragment blob of viscose of expection, be placed on ice.By 1 × β gelase I buffer immersion adhesive tape twice of two volumes, each 30 min, balance adhesive tape.After exhaustion damping fluid, blob of viscose is put to 65 DEG C of thawing 10 min that heat, be then cooled to 42 DEG C.To the β gelase I that adds 2 U in the agarose glue having melted, at 42 DEG C of digestion 1 h.Then at 65 DEG C of heating 15 min, inactivation β gelase I.High speed centrifugation 1 min, transfers to supernatant liquor in another clean centrifuge tube.
PCR product purification test kit (Wizard SV Gel and PCR clean-up System) the purifying coding single domain antibodies DNA fragmentation from agarose Digestive system that adopts Promega company, purge process is as follows:
1) in above-mentioned agarose Digestive system, add isopyknic Membrance Bingding Solution, mix; SV Minicolumn is placed in to Collection Tube;
2) mixture of sample liquid and Membrance Bingding Solution is joined in SV Mini column, room temperature leaves standstill 1 min;
3) centrifugal 1 min of 14,000 rpm, will pour out from the liquid going out, and again puts SV Mini column well;
Add the Membrane Wash Solution of 700 μ L, centrifugal 1 min of 14,000 rpm, will pour out from the liquid going out, and again puts SV Mini column well;
4) again to the Membrane Wash Solution that adds 500 μ L in post, centrifugal 1 min of 14 000 rpm, will pour out from the liquid going out, with centrifugal 1 min of identical rotating speed to remove remaining liquid;
5) SV Minicolumn is placed in to 1.5 clean mL centrifuge tubes, adds the Nuclease-Free Water of 50 μ L to the pellosil of SV Mini column post, under room temperature, place 1 min, centrifugal 1 min of 14,000 rpm; Collect the goal gene fragment of purifying, put-20 DEG C of preservations; Measure concentration and the purity of purifying DNA fragment with Nanodrop 2000 nucleic acid-protein determinators.
Result: use purification of Recombinant Sj TGR protein immunization Xinjiang two-humped camel, through 5 immunity, the level that ELISA method detects the anti-Sj TGR of camel serum IgG antibody has reached 1:12800, has obtained good immune effect.Collect the white corpuscle in immune camel peripheral blood, with total RNA of Trizol legal system detailed information born of the same parents, use the mRNA of Invitrogen company magnetic bead separating kit purified mRNA again, obtain the leukocytic mRNA of 4.456 μ g immunity camel, the ratio of its OD260/OD280 is 2.23.
Adopt the first chain cDNA synthesis system in the reverse transcription PCR test kit of NEB, synthesized the first chain cDNA of immune camel blood leukocytes.Utilize gene-specific primer, taking immune camel white corpuscle cDNA as template, increase respectively IgG2 and IgG3 heavy chain variable region gene fragment, all obtain the DNA fragmentation of molecular weight approximately 500 bp, as Fig. 2.
Embodiment 3: anti- sjthe structure of TGR single domain antibodies phage display library
The DNA fragmentation that adopts Sfi1 and Not1 double digestion method to prepare linearizing phasmid pCANTab5E DNA and enzyme to cut coding nano antibody, endonuclease reaction system is as follows:
PCANTab5E DNA fragmentation 30 μ L
10×Buffer4 5 μL
100×BSA 0.5 μL
Not1-HF 1 μL
ddH 2O 2.5 μL
Amount to 49 μ L
Mix centrifugal after, put 37 DEG C of water-bath 4 h.Add Sfi1 1 μ L mix centrifugal after, put 50 DEG C of water bath heat preservation 3 h.
Enzyme is cut the recovery of product: above-mentioned enzyme is cut to product and carry out 1% agarose gel electrophoresis, after 100 V voltage electrophoresis 60 min, observe enzyme and cut product situation.Cut and contain object fragment blob of viscose from agarose gel, reclaim purification kit with the DNA of Promega company glue and purify the linearizing phasmid pCANTab5E DNA fragmentation of double digestion.Enzyme is cut the rear nano antibody gene fragment Promega DNA of company glue recovery purification kit and is directly carried out purifying, and method is pressed process specifications.By the linearizing phasmid pCANTab5E DNA of Nanodrop 2000 nucleic acid-protein determinators mensuration purifying and concentration and the purity of nano antibody DNA fragmentation.
Connect: adopt the CloneDirect Rapid Ligation Kit of Lucigen company to connect.The nano antibody IgG2 of double digestion and IgG3 DNA fragment and linearizing phasmid pCANTab5E DNA are pressed to 3:1 mixed in molar ratio, under the effect of DNA ligase enzyme, connect, linked system is as follows:
10×ligase Buffer 1 μL
VHH DNA fragmentation 5 μ L
pCA NTab5E 3μL
Clone Smart DNA ligase 1 μL
Amount to 10 μ L
Reaction conditions: 2 h are hatched in 23 DEG C of water-baths, then 70 DEG C of heating 15 min termination reactions.
In order to expand the diversity in phasmid storehouse, 5 ligations have been carried out respectively in this research, obtain altogether 50 μ L and connect product.
Concentrated: 50 μ L to be connected to product and be diluted to 300 μ L with sterilized water, add 2 times of volume dehydrated alcohols, mix postposition-30 DEG C precipitation 3 h; With centrifugal 30 min of 12000 g, abandon supernatant, at drying at room temperature 5-10 min at 4 DEG C; Throw out dissolves 3 h with 10 μ L sterilized waters at 4 DEG C, finally obtains the connection product of approximately 10 μ L.
Transform: adopt impulse method will connect product and transform e. coli tg1 competent cell.Method is as follows:
1) be that 0.1 cm electric shock cup and 1.5 mL centrifuge tubes are placed on precooling on ice by slit;
2) from-80 DEG C of taking-up TG1 competent cells, put 10-15 min on ice and treat to thaw completely;
3) draw 25 μ L competent cells to (putting on ice) in the aseptic centrifuge tube of precooling, add 2 μ L to connect products, softly stir evenly with rifle head, place 30 min on ice;
4) TG1 competent cell/DNA mixture is carefully transferred to the slit of electric shock cup from centrifuge tube, does not produce bubble, place 5 min on ice;
5) electric impulser (BIO-RAD) pulse parameter is set: voltage 2.5 kV, electric capacity 25 μ F, resistance 200; The cup that will shock by electricity inserts in electric impulser electric shock tank, till pinning two pulsed electrodes simultaneously and being retained to electric discharge;
6) take out electric shock cup, add the SOC substratum of 37 DEG C of preheatings of 0.975 mL, after mixing, bacterium liquid is transferred in an aseptic glass test tube, 37 DEG C, 120 rpm shaking culture 1 h;
7) repeat to transform 5 times with identical method, all link products are carried out to electricity and transform; After being mixed, converted product is divided on 6 parts of 2 × YT flat boards that are applied to respectively 6 24 × 24cm (Amp 100 μ g/mL, Glucose 2%); Under room temperature, place, after the bacterium liquid on flat board absorbs completely, be inverted dull and stereotyped in 37 DEG C of incubator grow overnight;
8) preservation in nano antibody phasmid storehouse: with 10 mL 2 × YT substratum, the bacterium colony on 6 culture plates is all scraped to wash after lower and mix, adding final concentration is 20% aseptic glycerine, is distributed into 1 mL/ and props up, and-80 DEG C save backup.
The calculating of storage capacity:
1) get the phasmid storehouse bacterium liquid 10 μ L that scrape under washing, make after gradient dilution of 2 × YT substratum, get respectively 100 μ L and be coated with 2 × YT plates, after 37 DEG C of grow overnight, getting bacterium colony is all the single clone's number of monoclonal plate count;
2) be multiplied by extension rate with whole single clone's numbers on flat board, then be the storage capacity in restructuring phasmid storehouse divided by the volume (mL) that is coated with bacterium liquid on this flat board.
The qualification of phasmid storehouse recombination fraction
20 single bacterium colonies of random picking from flat board, transferred species is to 37 DEG C of overnight incubation in 3 mL LB liquid nutrient mediums, and with Promega company plasmid DNA purification kit (Promega plasmid Miniprep Kit) extracting plasmid, method is pressed process specifications.
Plasmid in 20 single bacterium colonies is carried out to double digestion with restriction enzyme Sfi1 and Not1, analyze its recombination fraction.Reaction system is as follows:
Plasmid DNA 10 μ L
10×NEB Buffer4 2 μL
100×BSA 0.2 μL
Not1-HF 1 μL
ddH2O 6.8 μL
Amount to 19 μ L
Mix centrifugal after, put 37 DEG C of water baths and react 4 h; Add again 1 μ L Sfi1 mix centrifugal after, put the reaction of 50 DEG C of water baths and spend the night.
Enzyme is cut to product and carry out 1% agarose gel electrophoresis, 100 V electrophoresis 40 min, the enzyme of observing restructuring phasmid DNA on gel imaging instrument is cut product and whether is contained similar to nano antibody gene fragment and linearizing pCANTab5E size respectively DNA band, and calculates recombination fraction.
Show anti- sjthe rescue of TGR nano antibody recombinant phage
1) the phasmid storehouse bacterium liquid of 10 times of storage capacities of inoculation is in 50 mL 2 × YTAG(ammonia benzyl 100 μ g/mL, glucose 20% w/v) in, 37 DEG C, 200 rpm shaking culture, survey OD at interval of 30 min 600nmonce, approach at 0.4 o'clock in OD value, more every 20 min survey once, until OD 600=0.4;
2) in bacterium liquid, add the helper phage M13KO7 of appropriate number in the ratio of infection multiplicity (MOI) 20:1 (being that every 20 helper phages infect intestinal bacteria), 37 DEG C, 200 rpm continue to cultivate 1 h;
3) with centrifugal 10 min of 4000 rpm, remove supernatant, bacterial precipitation is resuspended in 50 mL 2 × YTAK(ammonia benzyls: 100 μ g/mL, kantlex: 50 μ g/mL) in substratum, 30 DEG C, 200 rpm overnight incubation;
4) second day, nutrient solution is transferred in centrifuge tube, 4 DEG C with centrifugal 10 min of 8,000 g, then supernatant are transferred in a new pipe, abandon precipitation (now phage is in supernatant liquor);
5) centrifuged supernatant again, is carefully transferred to 80% supernatant liquor in a new pipe, and adds the 20%PEG/2.5M NaCl of 1/6 volume, and reversing mixes latter 4 DEG C and staticly settles and spend the night;
6) 4 DEG C of the liquid that precipitation spent the night, with centrifugal 15 min of 12,000 g, are abandoned supernatant, again of short durationly fast remaining liq are exhausted after centrifugal, and phage is the white deposits being adsorbed on tube wall;
7) dissolve phage throw out with TBS, room temperature is with centrifugal 5 min of 14,000 rpm;
8) supernatant liquor is transferred to a new centrifuge tube, adds 20% PEG/2.5 M NaCl of 1/6 volume, ice bath is placed 1 h, and 4 DEG C with centrifugal 10 min of 14,000 rpm, abandons supernatant, of short duration centrifugal rear exhaustion residue supernatant fast;
9) by TBS Eddy diffusion precipitation, room temperature, with centrifugal 1 min of 14,000 rpm, is drawn supernatant to another new pipe, and adding sterile glycerol to final concentration is 30%, mixes and be stored in 4 DEG C; This is anti- sjtGR single domain antibodies phage display library.
Anti- sjtGR single domain antibodies phage display library titer determination, method is as follows:
1), from 2 × YT plate in single colony inoculation to 5 mL of picking TG1 2 × YT substratum, 37 DEG C of shaking culture are to OD 600nm≈ 0.5;
2), in the time of bacterial growth, after top agar is melted with microwave oven, packing 9 mL, in sterile tube, and remain in 45 DEG C of water-baths;
3) with 2 × YT liquid nutrient medium serial dilution storehouse phagocytosis body fluid of pre-temperature, extent of dilution is respectively 1 ︰ 10 3, 10 5, 10 7, 10 9, 10 11, 10 12;
4) in the time that TG1 bacterium arrives logarithmic phase, get respectively 200 μ L and add in each centrifuge tube, in every pipe, add dilution phagocytosis body fluid of 10 μ L, mix, under room temperature, infect 5 min;
5) bacterium/phage mixture of infection is transferred in the top fat of 45 DEG C of pre-temperature, after putting upside down and mixing, 2 × YT flat board of toppling over fast 37 DEG C of preheatings, Rotating Plates makes top agar be uniformly distributed in dull and stereotyped surface;
After dull and stereotyped cooling 10 min, be inverted 37 DEG C of overnight incubation;
6) choose the dull and stereotyped above flat board of plaque independent distribution, count plaque number, and calculate the titre (pfu/mL) of phage.
Result: the heavy chain antibody IgG2 of amplification and IgG3 variable region (VHHn) gene fragment are connected to structure restructuring phasmid VHHn-pCANTab5E in phasmid carrier pCANTab5E.Forward in Host Strains TG1 intestinal bacteria by electricity repeatedly, be all coated with polylith 2 × YT flat board and obtain afterwards the VHHn-pCANTab5E phasmid storehouse being present in Host Strains.The storage capacity in phasmid storehouse is about 4.5 × 10 10cFU/mL.
Select 20 single bacterium colonies from connecting product conversion flat board at random, after extracting phasmid DNA, carry out Sfi1/Not1 double digestion, the electrophoresis result that enzyme is cut product shows that 20 single bacterium colony phasmid DNA are after double digestion, all can produce similar to camel antibody heavy chain variable region (VHH) size, the insertion DNA fragmentation of the about 400-500 bp of length, as Fig. 3.Point out the recombination fraction in this nano antibody phasmid storehouse of preparing to reach 100%.
Infect nano antibody phasmid storehouse with M13KO7 helper phage and carry out phage rescue, obtain the recombinant phage displaying storehouse of showing single domain antibodies, tiring of storehouse is 4 × 10 12pfu/mL, cumulative volume is 8 mL.
Embodiment 4: show anti- sjthe screening of TGR single domain antibodies recombinant phage
Method is as follows: the first round eluriates
1) the single bacterium colony of picking e. coli tg1, is inoculated in respectively in the LB substratum of 10 mL, 20 mL, and 37 DEG C of violent joltings, to logarithmic phase, are measured and amplification for phage titre;
2) by purifying sj0.1 M NaHCO for TGR albumen 3(pH 8 .6) solution is made into the solution that concentration is 1000 μ g/mL, gets g) the coated 12 porocyte culture plates of protein solution of 1 mL(1000 μ, and 4 DEG C are spent the night;
3) after coating buffer is outwelled, on clean paper, pat dry, remove remaining liquid, then in hole, fill it up with confining liquid (5% skim-milk PBS), put 37 DEG C of sealing 2 h;
4) pat dry with method after outwelling confining liquid, wash plate with TBST (TBS+0.1%[v/v] Tween-20), wash plate 6 times;
5) with TBST by phage display library phage (8 × 10 13pfu) be diluted to 1 mL, join in the plate hole being coated with, under room temperature, softly mix, in conjunction with 60 min;
6) outwell unconjugated phage, and then pat dry, remove residual liquid;
7) wash plate 10 times with TBST, then wash 5 times with TBS.(while blotting, the new paper handkerchief of each employing prevents crossed contamination);
8) in hole, add 900 μ L glycine liquid (0.1M, pH2.2) to shake gently at room temperature 10 min, the phage of elution of bound; Then rapidly elutriant is transferred in a new sterile tube, is added 100 μ L Tris-HCl (1 mol/L, pH8.0), in and pH to being about 7.0;
9) phage amplification: elutriant is inoculated into 10 mL logarithmic phase (OD 600nm=0.5) TG1 bacterium liquid in, after incubated at room 30 min, get 10 μ L bacterium liquid and carry out gradient dilution, after mixing with top agar, coat respectively 2 × YT planar surface, measure the titre (pfu/mL) of elutriant pnagus medius;
10) remaining bacterium liquid transferred species is in 2 × YTA nutrient solution of 50 mL, and 37 DEG C, 200 rpm are cultured to OD 600 nmafter being about 0.4, add 100 μ L M13KO7 helper phages (10 12pfu), after infection 30 min, adding kantlex to final concentration is 50 μ g/mL, 37 DEG C, 200 rpm overnight incubation;
11) according to the method for embodiment 3, the phage of incubated overnight is precipitated to collection with PEG/2.5M NaCl, supernatant liquor is the phage of amplification;
12) by the method for embodiment 3, the phage of first round elutriation, amplification is carried out to titer determination, the phage of amplification adds isopyknic aseptic glycerine, mixes 4 DEG C of storages.
Second takes turns elutriation
With 1 mL (g) purifying of 100 μ sjtGR albumen is coated with 12 porocyte culture plates, 4 DEG C of coated spending the night, after sealing, add the first round to eluriate after the phage of amplification, sieve and wash step 5 by the first round)-12) carry out second and take turns elutriation, phage used is the phagocytosis body fluid (10 of first round amplification 12pfu), in washing lotion, the concentration of tween is increased to 0.5%(v/v).
Measure second according to the method for the first round and take turns the phage quantity of wash-out, and carry out phage amplification, concentrated and titer determination.
Third round is eluriated
With 1 mL (g) purifying of 10 μ sjtGR albumen is coated with 12 porocyte culture plates, 4 DEG C of coated spending the night, after sealing, add the first round to eluriate after the phage of amplification, sieve and wash step 5 by the first round)-12) carry out third round elutriation, phage used is second to take turns the phagocytosis body fluid (10 of amplification 12pfu).
The qualification of recombinant phage
Restricted enzyme cutting analysis: the phage-infect TG1 bacterium that elutriation is for the third time obtained, dull and stereotyped upper 10 the single bacterium colonies of random choose, are inoculated into respectively in 10 3 mL 2 × YTA substratum.37 DEG C, 200 rpm shake bacterium and spend the night.Inferior daily Promega company's plasmid DNA purification kit (Promega plasmid Miniprep Kit) extracts the phasmid of 10 bacterium colonies.Carry out restriction analysis with restriction enzyme Sfi1 and Not1, reaction system is as follows simultaneously:
Plasmid DNA 10 μ L
Not1-HF 1 μL
100×BSA 0.2 μL
10×NEB Buffer 4 2 μL
ddH 2O 6.8 μL
Amount to 19 μ L
Mix centrifugal after, put 37 DEG C of water baths and react 4 h.Add again 1 μ L Sfi1 mix centrifugal after, put the reaction of 50 DEG C of water baths and spend the night.
Enzyme is cut to product and all carry out 1% agarose gel electrophoresis, 100 V electrophoresis 40 min, gel imaging instrument is observed two of the phasmid DNA whether digested one-tenth DNA band similar to expection nano antibody and linearizing pCANTab5E size respectively.
DNA sequence analysis: be inoculated into respectively in 100 3 mL 2 × YTA substratum from eluriating for the third time 100 single bacterium colonies of random choose the phage-infect TG1 bacterium flat board obtaining.37 DEG C, 200 rpm shake bacterium and spend the night.Inferior daily Promega company's plasmid DNA purification kit (Promega plasmid Miniprep Kit) extracts phasmid DNA.The phasmid sample obtaining is all sent to Shanghai invitrogen company, carries out unidirectional order-checking with phasmid pCANTab5E upstream primer (primer sequence: CCATGATTACGCCAAGCTTTGGAGCC), and sequencing result is analyzed.
Result: infect nano antibody phasmid storehouse with M13KO7 helper phage and carry out phage rescue, obtain nano antibody recombinant phage and show storehouse, tiring of storehouse is 4 × 10 12pfu/mL, cumulative volume is 8 mL.
With the restructuring of purifying sjtGR albumen coated elisa plate, then recombinant phage in nano antibody phage display library is combined, and carries out 3 and takes turns after elutriation, along with sjthe reduction of TGR package amount, the increase of eluriating number of times, and elutriation condition is rigorous gradually, and the phage of specific binding is significant enrichment trend, and the phage rate of recovery obviously increases.Each wheel is eluriated the data that obtain phage as table 1 and Fig. 4.
The each wheel of table 1 is eluriated the rate of recovery of phage
From the flat board of third round screening wash-out bacteriophage infection TG1 bacterium, select at random 10 single bacterium colonies, extracting phasmid DNA, carry out double digestion analysis with Sfi1/Not1, enzyme is cut product agarose electrophoresis result and is shown, wherein there is the exogenous insertion DNA fragmentation (Fig. 5) that contains 400-500 bp in the phasmid of 8 single bacterium colonies, show that the recombination percent of third round wash-out bacteriophage is about 80%.
By third round eluriate obtain phage-infect TG1 bacterium, random choose 100 single bacterium colonies, extracting phasmid carries out DNA sequencing, and sequencing result is analyzed with VectorNTI10 software.The successful phasmid that checks order has 93, has 69 containing the phasmid of the exogenous insertion DNA fragmentation of 500 bp size of having an appointment.These 69 exogenous insertion DNA sequence dnas are translated into aminoacid sequence, carry out amino acid sequence homology comparison.Result shows that No. 3 clone's single domain antibodies coding gene sequence length is 429 bp, and identical clone has 27; No. 67 clone's single domain antibodies coding gene sequence length is 441 bp, and identical clone has 8; And the coding gene sequence length of No. 54 clone's single domain antibodies is 441 bp, identical clone has 2; Remaining single domain antibodies sequence does not all repeat (table 2), and 3 strain nano antibodies are named as respectively: JIPDYYNA-1, JIPDYYNA-3 and JIPDYYNA-2, aminoacid sequence comparing result is as Fig. 6.
Table 2 sequence homology nano antibody clone's distribution
By 3 strain nano antibody aminoacid sequences are contrasted, according to IMGT method, sequence is carried out to structure division, this 3 strain nano antibody is the variable region of camel heavy chain antibody, all contain the significant cysteine residues in two of antibody heavy chain variable regions (C22, C97), VHH hydrophilic amino acid characteristic site F37 is contained in its skeleton district (FR2 district), E44, R45, G47, in carbonyl terminal amino acid sequence, all contain GTNEVCK territory, for the characteristic sequence of IgG3 hypotype hinge, show that this three strains nano antibody is all IgG3 hypotype antibody.The CDR3 length of JIPDYYNA-1 is 18 amino acid, and the CDR3 length of JIPDYYNA-2 is 20 amino acid, and the CDR3 length of JIPDYYNA-3 is 21 amino acid, is all greater than the length (9-12 amino acid) of conventional antibody IgG variable region of heavy chain CDR3.In addition, the login of JIPDYYNA-1 aminoacid sequence and ncbi database is carried out to Blast homologous sequence and compare, find that the originate homology of VHH sequence of JIPDYYNA-1 and dromedary and alpaca is 60%-62%.
Embodiment 5: the Construction and identification of the prokaryotic expression plasmid of single domain antibodies
The amplification of single domain antibodies gene
Design of primers: redesign the primer of amplification coding single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 gene fragment, make upstream primer 5 ' end bring Nde1 restriction enzyme site, downstream primer 5 ' end is brought Not1 site.Primer sequence is as follows:
P1：5'-CGCCATATGT CCTGGCTGCT-3'，
P2：5'-CGCCATATGT CCTGGCTTGC TCTT-3'，
P3：5'- ATTTGCGGCC GCCTACTTGC ATACTTCATT CGTTCC-3 '。
Primer is synthetic by the handsome Bioisystech Co., Ltd in Shanghai.
Gene amplification: respectively taking phasmid JIPDYYNA-1-pCANTab5E, JIPDYYNA-3-pCANTab5E DNA as template, P1 is as upstream primer, P3 is as downstream primer, the gene DNA fragment of amplification coding JIPDYYNA-1 and JIPDYYNA-3;
Taking phasmid JIPDYYNA-2-pCANTab5E as template, P2 is as upstream primer, and P3 amplifies the gene DNA fragment of coding JIPDYYNA-2 as downstream primer.Amplification system is as follows:
10×buffer 5 μL
25 mM MgCl 25μL
10 mM dNTP 1μL
JIPDYYNA/pCANTab5E 1μL
Upstream primer (50 mM) 1 μ L
Downstream primer (50 mM) 1 μ L
Taq enzyme 1 μ L
ddH 2O 35μL
Amount to 50 μ L
Amplification condition: 95 DEG C, 3 min; 95 DEG C, 20 s, 60 DEG C, 35 s, 72 DEG C, 60 s, 30 circulations; 72 DEG C, 10 min; 4 DEG C of preservations.
The pcr amplification product of getting 5-10 μ L JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 carries out 1% agarose gel electrophoresis, observes pcr amplification result under ultraviolet lamp.The gene fragment amplification product of three strain nano antibodies is monospecific DNA band.Adopt PCR product purification test kit (Wizard SV Gel and PCR clean-up System) directly to carry out DNA purifying.
The TA clone of coding single domain antibodies gene
Connect: the nano antibody DNA fragmentation after purifying is reclaimed mixes according to the ratio of molecule mole number 3 ︰ 1 with TA clone carrier pGEM T-Easy DNA, at T 4under the effect of DNA ligase, connect construction recombination plasmid JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3-pGEMT.Linked system is as follows:
2×Ligation buffer 5μL
pGEMT-Easy Vector 1μL
JIPDYYNA-1、2、3 DNA 3μL
T4 DNA Ligase 1μL
Amount to 10 μ L
4 DEG C of connections are spent the night
Electricity transforms
1) get 10 μ L connection products and join in 100 μ L bacillus coli DH 5 alpha competent cells, carefully mix, do not made Bubble formation, place 30 min on ice bath;
2) slit of the mixture that connects product and competent cell being transferred to precooling is on ice in the electric shock cup of 0.1 cm, has not made Bubble formation in transfer process, carefully wipes the water of condensation outside electric shock glass away;
3) electric impulser (BIO-RAD) pulse parameter is set: voltage 2.5 kV, electric capacity 25 μ F, resistance 200.The cup that will shock by electricity inserts in electric impulser electric shock tank, till pinning two pulsed electrodes simultaneously and being retained to electric discharge;
4) take out electric shock cup, add the SOC substratum of 37 DEG C of preheatings of 0.5 mL, after mixing, bacterium liquid is transferred in an aseptic glass test tube to 37 DEG C, 120 rpm shaking culture 40 min;
5) getting 200 μ L bacterium liquid evenly coats surface and scribbles in advance 40 μ L X-gal(40 mg/mL) LB flat board on (containing Amp 100 μ g/mL).Under room temperature, place, after the bacterium liquid on flat board absorbs completely, be inverted flat board and spend the night in 37 DEG C of incubators.
Positive colony qualification
1) blue/screen in vain and on LB flat board, occur that white colony can the positive clone of preliminary judgement, the negative clone of blue colonies;
2) Nde1/Not1 double digestion qualification: the single white colony of picking is inoculated in 37 DEG C of 3 mL LB substratum, 200 rpm overnight incubation from LB flat board.With plasmid DNA purification kit (Wizard Plus Minipreps DNA Purification System) extracting plasmid.Plasmid is done to double digestion with Nde1/Not1 restriction enzyme respectively, and endonuclease reaction process is as follows:
10×NEB buffer 4 2 μL
Plasmid DNA 13 μ L
Nde1 0.5 μL
Not1 0.5 μL
ddH 2O 4 μL
Amount to 20 μ L
37 DEG C of reactions are spent the night, 65 DEG C of 20 min inactivation
Enzyme is cut to product and carry out 1% agarose electrophoresis, under ultraviolet lamp, observe enzyme and cut result.
3) DNA sequence analysis is cut the positive bacterium colony of qualification by enzyme and is delivered to Shanghai Sheng Gong biotechnology company limited and carry out determined dna sequence.
The Construction and identification of recombinant expression plasmid
The preparation of double digestion single domain antibodies gene DNA fragment and linearization plasmid pET28a (+) DNA
By the JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3-pGEMT plasmid DNA of purifying and expression plasmid pET28a (+) DNA, carry out double digestion with Nde1 and Not1-HF respectively simultaneously.Reaction system is as follows: JIPDYYNA gene or plasmid pET28a (+) 30 μ L
100×BSA 0.5 μL
10×NEB Buffer4 5 μL
Nde1 2 μL
Not1-HF 2 μL
Amount to 50 μ L
Mix centrifugal after, put 37 DEG C of water-bath enzymes and cut and spend the night.
The recovery that JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3 gene and plasmid pET28a (+) enzyme are cut product
Above-mentioned enzyme is cut to product and carry out 1% agarose gel electrophoresis, after 100 V voltage electrophoresis 40 min, cut and contain object fragment blob of viscose from glue, reclaim purification kit with the DNA of Promega company glue and purify VHH fragment and linearization plasmid pET28a (+) DNA of double digestion.
Connect :the nano antibody DNA fragmentation of double digestion and linearization plasmid pET28a (+) DNA are mixed in 3 ︰ 1 ratios, at T 4under the effect of DNA ligase enzyme, connect, linked system is as follows:
10×T4 DNA ligase Buffer 1 μL
JIPDJIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3 7 μL
Linearizing pET28a (+) DNA 1 μ L
T4 DNA ligase 1 μL
Amount to 10 μ L
Reaction conditions: 16 DEG C of water-baths connect spends the night.
Electricity transforms: connection product is mixed with bacillus coli DH 5 alpha competent cell and carry out electricity conversion, method is the same.
Enzyme is cut qualification
1) from LB flat board the single colony inoculation of picking in 3 mL LB liquid nutrient mediums, 37 DEG C of overnight incubation.Press Promega plasmid extraction test kit extracting recombinant plasmid dna;
2) plasmid DNA of extraction is carried out to Nde1 and Not1-HF double digestion, reaction system is as follows:
Plasmid DNA 16 μ L
100×BSA 0.2μL
Nde1 0.5 μL
Not1-HF 0.5 μL
10×NEB Buffer4 2 μL
ddH 2O 0.8μL
Amount to 20 μ L
37 DEG C of water-baths digest 4 h, getting enzyme cuts product 10 μ L and carries out 1% agarose gel electrophoresis, simultaneously taking recombinant plasmid as contrast, 100 V electrophoresis 1 h, gel imaging instrument is observed two of the recombinant plasmid dna whether digested one-tenth DNA band similar to JIPDYYNA fragment and linearizing pET28a (+) size respectively.
Result: adopt single domain antibodies gene-specific primer respectively from plasmid JIPDYYNA1, in 2,3/pCANT ab5E, amplification is to the gene fragment of encoding heavy chain antibody variable region respectively, and size be about 500bp, with expect in the same size.As Fig. 7.
Above-mentioned three gene fragments are carried out to TA clone, plasmid JIPDYYNA-1-pGEMT, the JIPDYYNA-2-pGEMT, the JIPDYYNA-3-pGEMT that contain coding nano antibody gene are delivered to Shanghai Sheng Gong biotechnology company limited and carry out DNA sequence analysis, the gene order of result and expection is in full accord.
By nano antibody gene by Nde1 and Not1 restriction enzyme site directed cloning in expression vector pET28a, built recombinant expression plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a and JIPDYYNA-3-pET28a.With Nde1 and Not1 enzyme restricted enzyme cutting analysis, result confirms that nano antibody gene is all properly inserted in expression plasmid pET28a, recombinant plasmid JIPDYYNA-2-pET28a and JIPDYYNA-3-pET28a all can cut out the long goal gene band of treaty 500 bp, but because a Not1 restriction enzyme site is contained at 125 bp places in JIPDYYNA-1 gene order, be respectively 2 DNA bands (Fig. 8) of 125 bp and approximately 380 bp so JIPDYYNA-1 gene is cut into size, but its total length and expection is in the same size.Show three construction of recombinant expression plasmid successes.
Embodiment 6: anti- sjtGR single domain antibodies is expressed structure, protein expression and the purifying of engineering strain
By recombinant plasmid JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3-pET28a respectively electricity be transformed in expressive host bacterium BL21 (DE3) competent cell, containing screening on the LB flat board of kantlex (50 μ g/mL) containing the transformant bacterial strain of recombinant expression plasmid.
1) single colony inoculation (containing 50 μ g/mL kantlex) in 3 mL LB liquid nutrient mediums on picking LB flat board, 37 DEG C of shaking culture are spent the night;
2) with the ratio of 1 ︰ 100, incubated overnight bacterium is transferred (containing kantlex 50 μ g/mL) in 1 L LB nutrient solution next day, 37 DEG C, 200 rpm continuation shaking culture 4 h;
3) as bacterium liquid OD 600nmwhile reaching 0.6-0.8, then in culture, adding IPTG is 1 mM to final concentration, 37 DEG C, 200 rpm continuation shaking culture 4 h;
4) centrifugal collection bacterium, removes supernatant, with the resuspended bacterial precipitation of PBS of 50 mL;
5) in resuspended liquid, adding N,O-Diacetylmuramidase to final concentration is 1 mg/mL, reacts 1h on ice, lysing cell wall;
6) by bacterial lysate multigelation 2-3 time, until that bacterium liquid becomes is thick;
7) then bacterial lysate is carried out to ultrasonic degradation (program: ice bath, power: 200 W, ultrasonic 10 s, interval 10 s, ultrasonic 10 times repeatedly), then 4 DEG C with centrifugal 30 min of 12000 × g;
8) get respectively the each 200 μ L of supernatant, throw out of above-mentioned expression product, add equal-volume 2 × sample-loading buffer, mix, room temperature effect 30 min, boil 10 min, get 20 μ L expression products and carry out 15 % SDS-PAG electrophoresis.120 V voltages enter after separation gel sample, and 180 vvoltage continues electrophoresis 60 min.After electrophoresis finishes, take out gel, coomassie brilliant blue staining 30 min under room temperature, then with destainer decolour clear to background till, observe recombinant expression protein be in the supernatant of expression product lysate or in precipitation;
9 )prepare in a large number as stated above nano antibody expression product, centrifugal collection bacterial precipitation; With PBS suspend after ultrasonic degradation, lysate is carried out centrifugal, collecting precipitation thing;
10) expression product throw out is resuspended with 50 mL PBS, then remove supernatant with centrifugal 10 min of 12000 g, so repeat fully washing 3 times;
11) the LE Buffer that the throw out after washing is contained to 8 M urea with 100 mL dissolves, and 4 DEG C of stirring and dissolving are spent the night;
12) by 4 DEG C of centrifugal 30 min of high speed centrifugation 12000 g of liquid after dissolving;
13) carefully draw centrifugal supernatant, with the membrane filtration of 0.45 μ m, nickel chelating affinity chromatography column purification in preparation;
14) nickel post is prepared: the LE Buffer balance pillar that contains 8 M urea with 10 times of volumes;
15) by nickel affinity chromatography post on the expression product after filtering, get respectively the forward and backward solution of upper prop for subsequent analysis;
16) wash post with the LE Buffer of 20 times of volumes (20 mL), collect and wash post liquid;
17) wash post with the Wash Buffer of 20 times of volumes, collected post liquid;
18) respectively with the Elution Buffer gradient elution target protein that contains different concns (20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 200 mM, 250 mM) imidazoles;
19) getting respectively 10 μ L samples and equal-volume 2 × SDS loading buffer mixes and boils 10 min and carry out 15% SDS-PAG electrophoresis.120 V voltages enter after separation gel sample, and 180 V voltages continue electrophoresis 70 min.After electrophoresis finishes, take out gel, coomassie brilliant blue staining 30 min under room temperature, then with destainer decolour clear to background till, observations;
20) purifying protein of getting after wash-out carries out dialysis renaturation, and dialyzate is the PBS damping fluid that contains 50 mM L-arginines and different concns urea, and regulates pH of buffer to 8.0.Take the mode that reduces gradually urea concentration 4 DEG C of dialysis, finally use 1 × PBS dialysis.
Result: will be containing recombinant plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a, the engineering bacteria of JIPDYYNA-3 – pET 28a is inoculated into respectively in LB substratum to be cultivated, and carries out protein induce expression with IPTG.Through optimization to expression condition, induce with 1 mM IPTG, at 37 DEG C of induction 4 h, can give expression to the recombinant protein of a part amount approximately 20 kDa, with matching with the His label nano antibody molecular weight of recombinating of estimating.SDS-PAGE analyzes and shows that three recombinant expressed strain single domain antibodies albumen are insoluble inclusion body protein, is present in the precipitation of expression product lysate.As Fig. 9.
Adopt nickel ion metal chelate affinity chromatography glue recombinant expressed nano antibody to be carried out under Denaturing to purifying, all obtain purer restructuring single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 albumen.As Figure 10.
The recombinate hunchbacked source property analysis of nano antibody of embodiment 7
Adopt Dot-ELISA, the single domain antibodies of recombinating is expressed bacterium lysate and is put film as antigen, simultaneously with the negative contrast of negative bacterium lysate, and the positive contrast of camel serum, how anti-as two anti-reactions with it, DAB colour developing using HRP coupling goat-anti camel.Result: nano antibody JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 expression product lysate all can be by anti-identifications of anti-camel IgG bis-, have reaction more by force, and contrast bacterium does not react.Figure 11.
Embodiment 8: recombinant expressed single domain antibodies with sjthe binding ability analysis of TGR albumen
The single domain antibodies albumen of purifying is transferred on NC film after SDS-PAGE, respectively with sjafter TGR reaction, then with anti- sjthe anti-reaction of TGR mouse two, then with the anti-recognition reaction that carries out of HRP mark goat-anti mouse two.Result: recombinant expressed JIPDYYNA-1, JIPDYYNA-2, JIPDYYNA-3 albumen all can be with sjtGR protein binding, has obvious colour developing band at the about 18-20kDa of molecular weight place, and not with sjthe restructuring JIPDYYNA-1 protein band of TGR albumen test does not develop the color.Figure 12.Showing to recombinate JIPDYYNA-1, JIPDYYNA-2, JIPDYYNA-3 albumen all can be with sjtGR specific binding.
Embodiment 9: restructuring single domain antibodies pair sjtGR albumen thioredoxin reductase activity inhibition is analyzed
Principle: sjthe activity of the thioredoxin reductase (TR) of TGR can be reduced to TNB by substrate DTNB in the situation that reduzate NADPH exists, and shows as reaction system solution and raises in the absorption value of 412nm.The present invention will sjwhether recombinant expressed single domain antibodies JIPDYYNA-1, the JIPDYYNA-2 of TGR and different mol ratio and JIPDYYNA-3 carry out enzymatic reaction after being combined respectively again, utilize ultraviolet spectrophotometer to measure the variation of the 412nm absorption value of system after enzymatic reaction right to observe restructuring nano antibody sjthe TR enzymic activity of TGR is inhibited.
The reduction test of DTNB
1) reaction principle: 5-connection sulfo--bis--2-nitrobenzoic acid (DTNB) exists in situation at reduzate NADPH, can quilt sjtGR is reduced to 5-sulfydryl-2-nitrobenzoic acid (TNB), and TNB is that 412nm place has maximum absorption peak at wavelength, occurs after enzymatic reduction reaction, and reaction system can increase in the absorption value of 412nm.
TrxR
NADPH+H ++DTNB NADP ++2TNB
2) reaction system is as follows: EDTA 5 mM
Potassium phosphate buffer (pH 7.4) 100 mM
NADPH 50 μM
DTNB 1.5 mM
3) sample determination: this experiment is divided into blank group, control group and experimental group.The restructuring that blank group is got 5 μ L sjtGR albumen (0.08 mg/mL) mixes with 5 μ L potassium phosphate buffers (pH 7.4), under room temperature, after standing and reacting 15 min, join in the cuvette that volume is 100 μ L, add subsequently 90 μ L reaction system mix reagents to start reaction, the increased value of the inherent 412 nm place absorption peaks of initial rear front 1 min of Continuous Observation reaction.Continuously tested 3 times also calculates respectively enzymic activity, the conduct of averaging sjvalue when TGR 100% enzyme activity.
Control group is that the 0.08 mg/mL restructuring Sj TGR that gets 5 μ L mixes containing the JIPDYYNA diluted protein solution of 0.7 M urea with 5 μ L, under room temperature, after standing and reacting 15 min, join in the cuvette that volume is 100 μ L, add subsequently 90 μ L reaction system mix reagents to start reaction, the increased value of the inherent 412 nm place absorption peaks of initial rear front 1 min of Continuous Observation reaction.Continuously tested calculates respectively enzymic activity 3 times, and carries out with blank group enzymic activity twhether inspection statistics is analyzed, right to judge urea-containing diluted protein solution sjthe work of TGR enzyme exerts an influence.
Experimental group is to get the 0.08 mg/mL restructuring Sj TGR of 5 μ L and 5 μ L JIPDYYNA-1, JIPDYYNA-2 or JIPDYYNA-3 albumen respectively with the mixed in molar ratio of 2:1/1:1/1:4/1:16, under room temperature, after standing and reacting 15 min, join in the cuvette that volume is 100 μ L, add subsequently 90 μ L reaction system mix reagents to start reaction, the increased value of the inherent 412 nm place absorption peaks of initial rear front 1 min of Continuous Observation reaction, calculates enzymic activity.All tests all repeat 3 times.And carry out with control group enzymic activity tinspection statistics is analyzed.
4) enzymic activity is calculated: the enzymic activity of a unit is defined as the TNB that is produced 2 μ M under 25 DEG C of conditions in 1 min by NADPH.According to the absorbance of different time, on OriginPro 7.0, carry out fitting of a straight line, slope is initial velocity υ (△ A412/min).Calculation formula is as follows:
Thioredoxin reductase activity in sample (μ molmin-1mg-1)=
When calculating, using the specific absorbance (ε) of TNB is 13.6 mM -1cm -1.
Result: JIPDYYNA-1 has stronger restraining effect to the TR activity of TGR, and in the time that mol ratio is 1:1, the TR of TGR is active suppresses to reach maximum, the about 73.58%(table 3 that declines, Figure 13).Blank group compared with control group, enzyme live no difference of science of statistics ( p>0.05), experimental group compared with blank group, control group, enzyme live that there were significant differences ( p<0.05), VHH54 and VHH67 are all right under each concentration ratio sjtGR unrestraint effect (table 4,5, Figure 14,15), experimental group compared with blank group, control group, enzymic activity no difference of science of statistics ( p>0.05).
SEQ ID NO 1
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val
5 10 15
Pro Arg Gly Ser His Met Ser Trp Leu Leu Phe Leu Gln Gly Val
20 25 30
Arg Thr Gln Thr Pro Leu Val Glu Ser Gly Gly Gly Ser Val Gln
35 40 45
Val Gly Gly Ser Leu Arg Leu Thr Cys Thr Ala Pro Gly Asn Arg
50 55 60
Tyr Asp Thr Met Ala Trp Phe Arg Gln Ala Pro Gly Ser Gly Arg
65 70 75
Glu Arg Val Ala Ala Val Tyr Ser Val Ala Gly Ile Pro Thr Tyr
80 85 90
Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Ala Thr Asp
95 100 105
Ala Lys Thr Leu Asn Leu Gln Met Thr Asn Leu Ile Pro Gly Asp
110 115 120
Thr Ala Met Tyr Tyr Cys Ala Ala Gln Arg Phe Pro Cys Gly Ile
125 130 135
Thr Ala Ala Asp Pro Arg Asp Tyr Thr Tyr Trp Gly Gln Gly Thr
140 145 150
Gln Val Thr Val Ser Ser Gly Thr Asn Glu Val Cys Lys***
155 160 163
SEQ ID NO 2
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val
5 10 15
Pro Arg Gly Ser His Met Ser Trp Leu Ala Leu Leu Gln Val Val
20 25 30
Gln Ala Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln
35 40 45
Glu Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
50 55 60
Asn Ser Arg Pro Cys Me tGly Trp Phe Arg Gln Ala Pro Gly Lys
65 70 75
Glu Arg Glu Gly Val Ala Thr Ile Ser Gln Gly Gly Thr Ser Gln
80 85 90
Tyr Tyr Ala Gly Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asn
95 100 105
Asn Thr Glu Asp Thr Val Tyr Leu Lys Met Asn Asn Leu Lys Pro
110 115 120
Glu Asp Thr Ala Met Tyr Tyr Cys Ala Thr Lys Arg Asp Cys Leu
125 130 135
Asp Leu Gly Ser Val Gly Phe Arg Pro Val Ala Tyr Asn Tyr Trp
140 145 150
Gly Gln Gly Thr Gln Val Thr Val Ser Ser Gly Thr Asn Glu Val
155 160 165
Cys Lys***
167
SEQ ID NO 3
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val
5 10 15
Pro Arg Gly Ser His Met Ser Trp Leu Leu Leu Gln Gly Val Gln
20 25 30
Gly Gln Val Gln Leu Thr Glu Ser Gly Gly Gly Ser Val Gln Ala
35 40 45
Gly Gly Ser Leu Arg Leu Ser Cys Ala His Ser Thr Leu Gly Ala
50 55 60
Ala Arg Tyr Cys Leu Ala Trp Phe Arg Gln Val Glu Gly Gln Ser
65 70 75
Arg Glu Trp Val Ala Ser Ile Asn Pro Ala Asn Gly Ala Thr Tyr
80 85 90
Tyr Glu Asp Ser Val Lys Gly Arg Phe Thr Ile Thr Arg Asp Arg
95 100 105
Ala Glu Arg Lys Leu Phe Leu Gln Leu Asn Thr Val Lys Pro Gly
110 115 120
Asp Ala Ala Met Tyr Tyr Cys Ala Ala Arg Arg Asp Arg Leu Gly
125 130 135
Ser Tyr Cys Asn Ala His Gly Val Asn Asp Arg Tyr Val His Trp
140 145 150
Gly Gln Gly Thr Gln Val Thr Val Ser Ser Gly Thr Asn Glu Val
155 160 165
Cys Lys***
167
SEQ ID NO 4
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
atgtcctggc tgctctttct acaaggtgtc cggactcaga cgccattggt ggagtctggg 120
ggaggctcgg tgcaggtcgg agggtctctg agactcacct gcacagcgcc tggcaaccgt 180
tacgacacca tggcctggtt ccgccaggct ccaggatcgg ggcgcgagcg ggtcgcggca 240
gtttacagtg tcgcaggtat cccaacgtat gccgacagcg tgaagggccg attcaccatc 300
tcccaagcaa ctgacgcgaa gacgctcaat ctgcaaatga cgaacttgat acctggggac 360
actgccatgt actattgtgc ggcacagcgc tttccttgtg ggataacagc cgctgatcca 420
cgagactata catactgggg ccaggggacc caggtcaccg tctcctcagg aacgaatgaa 480
gtatgcaagt ag 492
SEQ ID NO 5
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
atgtcctggc ttgctcttct acaagtggtc caggctcagg tgcagttggt ggagtctggg 120
ggaggctcgg tgcaggaagg agggtctctg agactctcct gtgcagcctc cggattcacc 180
aatagtcgcc cctgcatggg ctggttccgc caggctccag ggaaggagcg cgagggggtt 240
gcgactattt ctcaaggggg tacgagtcaa tactatgccg gctctgtgaa gggccgattc 300
accatctccc gtaacaacac tgaggacacg gtgtatctaa agatgaacaa cctgaaacct 360
gaggacactg ccatgtacta ctgcgcgaca aaaagggact gcctcgacct tggtagtgtt 420
gggttccgac ctgtcgcgta taattactgg ggccagggga cccaggtcac cgtctcctca 480
ggaacgaatg aagtatgcaa gtag 504
SEQ ID NO 6
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
atgtcctggc tgcttctaca aggtgtccag ggacaggtac agttaacgga gtctggggga 120
ggctcggtgc aggctggagg atctctgaga ctctcctgtg cacactccac actcggcgcc 180
gcgcgctact gtttggcctg gttccgccag gtcgaaggac aatcgcgcga gtgggtcgca 240
tcaattaatc ctgcgaatgg ggccacatat tatgaagact ccgtgaaggg ccggttcacc 300
atcacccggg acagggccga gaggaagttg tttctccaac tgaacacagt aaaacctggg 360
gacgctgcga tgtactactg cgcggcgaga agggaccgtc ttggtagtta ctgcaatgcg 420
catggcgtca atgatcgata tgtccactgg ggccagggga cccaggtcac cgtctcttca 480
ggaacgaatg aagtatgcaa gtag 504
SEQ ID NO 7
Met Pro Pro Ile Asp Gly Thr Ser Gln Trp Leu Gln Arg Thr Ile
5 10 15
Glu Ser Ala Ala Val Ile Val Phe Ser Lys Thr Thr Cys Pro Phe
20 25 30
Cys Lys Lys Leu Lys Asp Val Leu Ala Glu Ala Lys Ile Lys His
35 40 45
Ala Thr Ile Glu Leu Asp Gln Leu Ser Asn Gly Ser Val Ile Gln
50 55 60
Lys Ala Leu Ser Asn Phe Ser Lys Ile Glu Thr Val Pro Gln Met
65 70 75
Phe Val Arg Gly Lys Phe Ile Gly Asp Ser Lys Ala Val Leu Asn
80 85 90
Tyr His Asn Asn Asn Gln Leu Gln Ala Ile Val Asn Glu Asn Lys
95 100 105
Tyr Asp Tyr Asp Leu Ile Ile Ile Gly Gly Gly Ser Gly Gly Leu
110 115 120
Ala Ala Gly Lys Glu Ala Ala Lys Tyr Gly Ala Lys Thr Ala Val
125 130 135
Leu Asp Tyr Val Glu Pro Thr Pro Met Gly Thr Thr Trp Gly Leu
140 145 150
Gly Gly Thr Cys Val Asn Val Gly Cys Ile Pro Lys Lys Leu Met
155 160 165
His Gln Ala Gly Leu Leu Ser His Ser Leu Glu Asp Ala Gln His
170 175 180
Phe Gly Trp Ser Leu Asp Lys Ser Lys Ile Ser His Asp Trp Ser
185 190 195
Thr Met Val Glu Gly Val Gln Ser His Ile Gly Ser Leu Asn Trp
200 205 210
Gly Tyr Lys Val Ser Leu Arg Asp Asn Ala Val Thr Tyr Leu Asn
215 220 225
Ala Arg Gly Met Leu Leu Ser Pro His Glu Val Gln Ile Thr Glu
230 235 240
Lys Asn Lys Lys Val Ser Thr Ile Thr Gly Asn Lys Ile Ile Leu
245 250 255
Ala Thr Gly Glu Arg Pro Lys Tyr Pro Glu Ile Pro Gly Ala Ile
260 265 270
Glu Tyr Gly Ile Thr Ser Asp Asp Leu Phe Ser Leu Pro Tyr Phe
275 280 285
Pro Gly Lys Thr Leu Val Val Gly Ala Ser Tyr Val Ala Leu Glu
290 295 300
Cys Ala Gly Phe Leu Ala Ser Leu Gly Gly Asp Val Thr Val Met
305 310 315
Val Arg Ser Ile Leu Leu Arg Gly Phe Asp Gln Gln Met Ala Glu
320 325 330
Lys Val Gly Asp Tyr Met Glu Asn His Gly Val Lys Phe Ala Lys
335 340 345
Leu Cys Val Pro Asp Glu Ile Thr Gln Leu Lys Pro Val Asp Thr
350 355 360
Glu Asn Asn Lys Pro Gly Leu Leu Leu Val Lys Gly His Tyr Thr
365 370 375
Asp Gly Lys Lys Phe Glu Glu Glu Phe Glu Thr Val Ile Phe Ala
380 385 390
Val Gly Arg Glu Pro Gln Leu Ser Lys Leu Asn Cys Glu Ala Val
395 400 405
Gly Val Lys Leu Asp Lys Asn Gly Arg Val Val Cys Ser Asp Asp
410 415 420
Glu Gln Thr Thr Val Ser Asn Ile Tyr Ala Ile Gly Asp Ile Asn
425 430 435
Ala Gly Lys Pro Gln Leu Thr Pro Val Ala Ile His Ala Gly Arg
440 445 450
Tyr Leu Ala Arg Arg Leu Phe Ala Gly Ala Thr Glu Leu Thr Asp
455 460 465
Tyr Ser Asn Val Ala Thr Thr Val Phe Thr Pro Leu Glu Tyr Gly
470 475 480
Ala Cys Gly Leu Ser Glu Glu Asp Ala Ile Glu Lys Tyr Gly Asp
485 490 495
Asn Asp Ile Glu Val Tyr His Ser His Phe Lys Pro Leu Glu Trp
500 505 510
Thr Val Ala His Arg Glu Asp Asn Val Cys Tyr Met Lys Leu Val
515 520 525
Cys Arg Ile Ser Asp Asn Met Arg Val Leu Gly Leu His Val Leu
530 535 540
Gly Pro Asn Ala Gly Glu Ile Thr Gln Gly Tyr Ala Val Ala Ile
545 550 555
Lys Met Gly Ala Thr Lys Glu Asp Phe Asp Arg Thr Ile Gly Ile
560 565 570
His Pro Thr Cys Ser Glu Thr Phe Thr Thr Leu His Val Thr Lys
575 580 585
Arg Ser Gly Gly Ser Ala Ala Val Thr Gly Cys ***
590 595 596
SEQ ID NO 8
atgcctccga ttgatggaac atcccagtgg ttgcagagga ctatcgaatc agcggcggta 60
atcgtcttta gcaaaacaac ttgtccattt tgcaaaaagc taaaggatgt tttagctgaa 120
gcaaagatta aacacgctac aattgaactg gatcaattat ccaatggttc ggttattcaa 180
aaggcattat ctaacttctc taaaattgaa acagtcccgc aaatgtttgt tagaggcaag 240
ttcattggcg attctaaagc agtacttaat taccacaata ataatcaatt gcaggcgatc 300
gtcaacgaaa ataagtatga ctatgatctg ataatcatcg gtggaggatc tggtggactc 360
gctgctggaa aggaggcagc caaatacggc gcaaagacag ctgttctgga ttatgtagaa 420
ccgactccaa tgggtactac ttggggatta ggtggaacct gtgttaacgt tggatgtatc 480
cctaaaaaat taatgcacca agctggactc ttaagtcatt ctttggaaga tgcccaacat 540
ttcggttgga gcttggataa atcaaaaatt tcccatgatt ggtcaactat ggttgaagga 600
gttcagagtc acatcggttc tttaaattgg ggctataaag tttcactaag agataatgcg 660
gttacgtatc ttaatgctcg tgggatgcta ttaagtcctc atgaggttca gattacagaa 720
aagaataaaa aagtatccac aataactgga aataaaatca tcttagctac tggcgagcgt 780
ccaaaatacc cagaaatacc tggagcaatc gaatatggga ttacaagtga tgatttgttt 840
tccttaccat acttcccggg caaaacactg gtcgttggag cgagctatgt tgcattggaa 900
tgtgctggtt ttcttgccag tttgggcggt gatgttactg ttatggttcg ttccattttg 960
cttcgtggtt tcgatcaaca aatggctgag aaggttggcg attatatgga aaatcatgga 1020
gtcaagttcg caaagttgtg tgtaccagac gagattacac agttgaaacc ggtagatact 1080
gagaataaca aacctggact cctgcttgtt aagggtcatt atactgatgg taagaagttt 1140
gaagaagaat ttgaaacggt cattttcgct gttggtcgtg aaccacaatt atcgaagctt 1200
aattgtgaag ctgtcggtgt taaactagat aagaatggtc gggttgtatg ctcagatgat 1260
gaacaaacta cagtcagtaa catttatgcc attggagata taaacgctgg aaaaccacag 1320
ttaactccag tggctattca tgctggacgt tatttggcta gacggttatt cgctggtgca 1380
actgaactga ctgactattc caatgttgct acgactgttt tcactccatt agaatatggc 1440
gcttgtggac tgagtgaaga ggatgcaatt gaaaagtatg gtgataatga tattgaggta 1500
tatcattcac atttcaaacc tttagaatgg actgttgctc atcgtgaaga taatgtttgt 1560
tacatgaaac ttgtttgccg tatatctgat aacatgcgtg tactgggtct acatgtttta 1620
ggacctaatg caggtgaaat aacacagggg tatgcagttg caattaaaat gggtgcaact 1680
aaagaagatt ttgatcgtac cataggaatt cacccaactt gttctgagac atttacaacg 1740
ttgcatgtaa ccaagagatc tgggggctct gcagcggtaa ccggttgctg a 1791

Claims (2)

1. a phage display library for single domain antibodies, is characterized in that the gene that contains the whole coding single domain antibodies of Xinjiang two-humped camel, can be used for screening and preparation is anti- sjtGR albumen single domain antibodies, and screening and the preparation of the specificity single domain antibodies of anti-any other antigen molecule or epi-position.
2. anti-with the phage display library screening of single domain antibodies described in claim 1 and three strains of preparation sjsingle domain antibodies JIPDYYNA-1, JIPDYYNA-2 and the JIPDYYNA-3 of TGR albumen, is characterized in that can be used for the schistosomicide treatment exploitation of new drug and the application of the immunology of schistosomicide targeted therapeutic carrier, method or other immunodetection, immunologic intervention and immunotherapy based on this three strains single domain antibodies.
CN201410285116.4A 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof Active CN104047061B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410285116.4A CN104047061B (en) 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410285116.4A CN104047061B (en) 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof

Publications (2)

Publication Number Publication Date
CN104047061A true CN104047061A (en) 2014-09-17
CN104047061B CN104047061B (en) 2016-03-23

Family

ID=51500439

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410285116.4A Active CN104047061B (en) 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof

Country Status (1)

Country Link
CN (1) CN104047061B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108627469A (en) * 2017-03-21 2018-10-09 凯熙医药（武汉）股份有限公司 A kind of thioredoxin reductase activity test method for cooperation detection equipment

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106645352B (en) * 2017-01-22 2019-01-18 浙江省医学科学院 One kind is for detecting bilharzial nano antibody composition, immunosensor and its preparation method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102336816A (en) * 2011-10-09 2012-02-01 江苏省血吸虫病防治研究所 Schistosoma japonicum thioredoxin glutathione reductase (SjTGR) functional inhibitory peptides and application thereof
CN103396482A (en) * 2013-05-17 2013-11-20 东南大学 Prealbumin nano-antibody, and coding sequence and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102336816A (en) * 2011-10-09 2012-02-01 江苏省血吸虫病防治研究所 Schistosoma japonicum thioredoxin glutathione reductase (SjTGR) functional inhibitory peptides and application thereof
CN103396482A (en) * 2013-05-17 2013-11-20 东南大学 Prealbumin nano-antibody, and coding sequence and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIJUN SONG ET AL: "Thioredoxin Glutathione Reductase as a Novel Drug Target: Evidence fromSchistosoma japonicum", 《PLOS ONE》, vol. 7, no. 2, 29 February 2012 (2012-02-29) *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108627469A (en) * 2017-03-21 2018-10-09 凯熙医药（武汉）股份有限公司 A kind of thioredoxin reductase activity test method for cooperation detection equipment
CN108627469B (en) * 2017-03-21 2021-04-02 凯熙医药（武汉）股份有限公司 Thioredoxin reductase activity detection method for cooperative detection equipment

Also Published As

Publication number Publication date
CN104047061B (en) 2016-03-23

Similar Documents

Publication Publication Date Title
CN113264998B (en) Single-chain antibody of S1 protein on surface of anti-new coronavirus SARS-CoV-2 and application thereof
CN113563463B (en) Neutralizing nano antibody for resisting novel coronavirus SARS-CoV-2 and application thereof
KR20180069931A (en) Anti-PD-L1 nano-antibodies and their applications
CN113150129B (en) Single-chain antibody for resisting S2 protein on surface of new coronavirus SARS-CoV-2 and application thereof
CN101037671B (en) Hybridoma cell line and anti-human erythrocyte surface H antigen monoclonal antibodies generated thereof
CN112500480B (en) Nanobodies against novel coronaviruses and uses thereof
CN108299561A (en) A kind of PD-1 nano antibodies and its cloning expression method and application
CN108892723B (en) Single-domain heavy chain antibody for detecting porcine epidemic diarrhea virus, preparation method and application
WO2023125520A1 (en) CAMEL-DERIVED NANOBODY WITH HIGH-AFFINITY FOR α, β, γ AND δ MUTANT STRAINS OF SARS-COV-2
CN109897110B (en) Nano antibody and preparation method thereof
CN113461810B (en) Fully human monoclonal antibody for resisting novel coronavirus spike protein and application thereof
CN103319595A (en) Preparation method and application of anti-human alpha fetoprotein (AFP) single-chain antibody and fusion antigen peptide
CN108341854A (en) A kind of novel polypeptide of cancer target and application thereof
CN113045662B (en) Nano antibody for specifically recognizing PD-L1 and application thereof
CN104047061A (en) Schistosoma japonicum thioredoxin glutathione reductase Sj TGR single-domain antibody and preparation method thereof
WO2022011717A1 (en) Nanobody against novel coronavirus, and use thereof
CN114685664B (en) Single-domain antibody for resisting human B lymphocyte surface antigen CD20 and application thereof
CN110423273B (en) Anti-pseudomonas aeruginosa exotoxin A nano antibody and application thereof
CN114671947B (en) High-affinity nano antibody for surface S protein of different subtypes of hepatitis B virus and application thereof
CN107987168B (en) Single-chain double-specific antibody for resisting VEGF and EGFR and application thereof
CN109206519A (en) The nano antibody and nucleic acid molecules of a kind of antiurease B subunit and application
CN100441689C (en) EHEC 0157 shiga-like toxin IIA resisting subunit monoclonal antibody 5F3 light and heavy chain variable region gene and its application
Gupta et al. Recombinant fusion proteins for haemagglutination-based rapid detection of antibodies to HIV in whole blood
CN102336816A (en) Schistosoma japonicum thioredoxin glutathione reductase (SjTGR) functional inhibitory peptides and application thereof
CN102477096B (en) Human creatine kinase single-chain antibody with molecular chaperone function

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant