CN104047061B - Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof - Google Patents

Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof Download PDF

Info

Publication number
CN104047061B
CN104047061B CN201410285116.4A CN201410285116A CN104047061B CN 104047061 B CN104047061 B CN 104047061B CN 201410285116 A CN201410285116 A CN 201410285116A CN 104047061 B CN104047061 B CN 104047061B
Authority
CN
China
Prior art keywords
jipdyyna
single domain
domain antibodies
sjtgr
tgr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410285116.4A
Other languages
Chinese (zh)
Other versions
CN104047061A (en
Inventor
宋丽君
姚媛
余传信
殷旭仁
沈双
高玒
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Institute of Parasitic Diseases
Original Assignee
Jiangsu Institute of Parasitic Diseases
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Institute of Parasitic Diseases filed Critical Jiangsu Institute of Parasitic Diseases
Priority to CN201410285116.4A priority Critical patent/CN104047061B/en
Publication of CN104047061A publication Critical patent/CN104047061A/en
Application granted granted Critical
Publication of CN104047061B publication Critical patent/CN104047061B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

Anti schistosoma Trx glutathione reductase <i>Sj</iGreatT.G reaT.GT? TGR single domain antibodies and preparation method thereof, belongs to the molecular biology of biotechnology, immunology and pharmaceutical technology.Do you the invention provides the anti-<i>Sj</iGreatT.G reaT.GT of a kind of displaying? the recombinant phage of the single domain antibodies of TGR albumen shows storehouse, anti-<i>Sj</iGreatT.G reaT.GT? single domain antibodies of TGR albumen and preparation method thereof, described anti-<i>Sj</iGreatT.G reaT.GT? TGR single domain antibodies can with <i>Sj</iGreatT.G reaT.GT? TGR protein-specific combines, and/or there is suppression <i>Sj</iGreatT.G reaT.GTTGR enzymic activity, can be used for the preparation treatment new drug of schistosomicide or the targeting vector of medicine for treatment thing.The present invention is that the new schistosomicide medicine of exploitation and new methods for the treatment of are had laid a good foundation, and has important meaning to control schistosomiasis is popular.

Description

Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof
Technical field
The present invention relates to and adopt immunological technique and display technique of bacteriophage structure can show that the recombinant phage of anti-SjTGR albumen single domain antibodies shows storehouse, and therefrom screening can show can recombinant phage protein bound with SjTGR, adopt the single domain antibodies of genetic engineering technique preparation and the anti-SjTGR albumen of purification of Recombinant, this antibody with SjTGR protein binding and/or can suppress SjTGR enzymic activity, the redox equilibrium in schistosomicide physiological metabolism process can be destroyed, cause schistosomicide dead.This antibody also can be used as the targeting vector of SjTGR enzymic activity chemical inhibitor, is applicable to new schistosomicide medicine and the development research of targeted therapies, belongs to the technical fields such as the molecular biology of biotechnology, immunology and pharmacy.
Background technology
Schistosomicide is a kind of zoonosis of serious harm human health, and the whole world has 76 countries to have schistosomiasis endemic, and 600,000,000 populations of having an appointment are subject to the threat of schistosomicide, has Schistosomiasis patients more than 2,000 ten thousand.Through unremitting effort in 60 years, China's 2.4 hundred million populations of still having an appointment threatened by schistosomicide, and have Schistosomiasis patients more than 20 ten thousand people, the natural condition of schistosomiasis endemic still exist.Owing to not preventing the vaccine of schistosomicide, the control of schistosomicide mainly relies on pharmacological agent at present.Praziquantel is current unique schistosomicide medicine, due to long-term large-scale Reusability, there is the persister of anti-praziquantel in Schistosoma mansoni, Schistosoma haematobium, and also occurred, to the phenomenon of praziquantel susceptibility decline, bringing serious challenge to following schistosomiasis control the Schistosoma japonicum that China is popular.Therefore, new schistosomicide medicine is developed and methods for the treatment of is current urgent scientific research mission.
Vital process is made up of a series of biochemical metabolism process, and in this process, in body, many protein moleculars are oxidized, and produces a large amount of toxicity oxygen molecules.Oxidized material has to pass through reduction could recover its biological function, and toxicity oxygen molecule must be decomposed and could remove toxicity, and the redox in such organism reaches balance again, and vital movement process just can continue.Once this balance is destroyed will cause biological death.Therefore, in interference schistosomicide vital process, the function of some important protein moleculars, makes it lose activity, then may destroy bilharzial a certain important biochemical metabolism process, cause schistosomicide dead, reaching the object for the treatment of schistosomicide, is the available strategy of new drug development.These important protein moleculars in vital process (also known as being the necessary protein molecular of vital process, essentialmolecules) are the important potential target molecules of new drug development.
Existing achievement in research display schistosomicide Trx glutathione reductase (TGR) is a necessary protein molecular in schistosomicide redox equilibrium metabolic process, suppress expression or the function of schistosomicide TGR, polypide can be caused dead, be that a very potential schistosomicide infects new drug development target, the inhibitor of exploitation schistosomicide TGR molecule enzymic activity has become the focus of schistosomicide treatment new drug research.
Proteinase inhibitor includes chemical inhibitor, peptide inhibitor and antibody inhibition.TGR is present in intracellular protein molecular, and therefore, medicine must be introduced in cell and could be combined with TGR molecule and play drug action.If medicine orientation is passed to intracellular target molecule by intracellular targeting vector can be entered, effectively can improve the result for the treatment of of medicine, reduce drug dose and Side effects of pharmaceutical drugs.Targeted therapy, due to the high degree of specificity of its action effect and selectivity, has obtained and has applied widely in anti-pathogen infection and antineoplaston.According to the constitutional features of therapeutic targets, can select can with the antibody molecule of target molecule specific binding or ligand molecular as targeting vector, and specific antibody uses maximum targeting vectors in targeted therapy.The antibody utilizing various technology to prepare has been widely used in the fields such as medical diagnosis on disease, treatment, immunologic intervention, scientific research and suitability for industrialized production, demonstrates huge development prospect.In vertebrate, antibody is the natural molecule that armour is invaded from cause of disease, malignant cell and toxic molecule, and it has specificity and the avidity of height to target molecules.Therefore, antibody is selected to be very reasonably select as the targeting vector of medicine or medicine.But, conventional mouse monoclonal antibody there will be serious human antimouse antibody reaction (HAMA) in clinical treatment, and have that molecular weight is large, immunogenicity is strong, penetration power is weak and the shortcoming such as poor stability, cause antibody to be restricted as the application of medicine and targeting vector.Single domain antibodies (Singledomainantibody), the functional heavy chain antibody IgG (Heavychainantibodies of a kind of natural deletions light chain derived from camel, alpaca and shark serum, HCAb) variable region (variabledomainoftheheavychainofHCAb, VHH), also known as nano antibody (Nanobody).Compared with traditional antibody, the feature of single domain antibodies is: molecular weight is little, approximately only has 1/10 of common antibody, about 15kDa, and tissue penetration is strong, can enter in cell; Single domain antibodies is similar to the VH district of conventional antibodies, but its structure and sequence all have unique distinction, the CDR3 of single domain antibodies is long compared with the VHCDR3 of conventional I gG, special large-scale bulge loop structure can be formed, it is made more easily to be attached to the crack at enzyme active center place, or in depression, be natural activity inhibitor; In addition, it also has good water solubility, be easy to carry out expressing in prokaryotic organism and produce, and stable in properties, energy is high temperature resistant and acid or alkali environment, immunogenicity are low, not easily cause the advantages such as rejection.Therefore, single domain antibodies has possessed the potential as therapeutic antibodies of new generation and targeting vector.
If prepare the specificity single domain antibodies of anti-SjTGR albumen, then this antibody will possess the function suppressing SjTGR activity, and can enter in cell and kill schistosomicide.Theoretically, the specificity single domain antibodies of anti-SjTGR has the treatment pharmacy of schistosomicide and the dual-use function of target.If with anti-SjTGR single domain antibodies for carrier, the chemical inhibitor of anti-SjTGR is sent and enters in bilharzial cell, then can reach dual insecticidal effect, the therapeutic dose of chemical inhibitor can also be reduced simultaneously, thus alleviate the side effect of chemicals.Therefore, prepare the specificity single domain antibodies of anti-SjTGR, to the new schistosomicide infection medicine of development and treatment means, there is important using value.
Phage display single domain antibodies storehouse be the gene fragment of a group coding single domain antibodies is inserted into and phage M13 coat protein g III gene open between beginning signal sequence and its Amber stop codon, because Host Strains TG1 can produce a kind of tRNA of suppressive, suppress Amber stop codon phage inserted between allogenic gene and gene3 protein gene sequence, make can read over when translating between insertion allogenic gene and gene3 protein gene, thus make, between g III albumen of insertion extrinsic protein and phage, amalgamation and expression occurs, and be together illustrated in phage surface.If whole heavy chain antibody genes of SjTGR immunity camel are inserted in phasmid pCANTab5E, just can be built into the phage display library that may be shown anti-SjTGR antibody heavy chain variable regions whole in immune camel body, be referred to as again anti-SjTGR nano antibody phage display library.If by SjTGR proteopexy on solid-phase media (as enzyme plate), make it to react with whole phages of phage display library, so phage library shows that the recombinant phage of anti-SjTGR specific nano antibody just can combine with the SjTGR albumen be fixed on solid-phase media, unconjugated or that bonding force is weak phage is removed by washing, just the recombinant phage showing anti-SjTGR protein-specific nano antibody can be obtained, afterwards the gene of the anti-SjTGR protein-specific nano antibody of coding is obtained, thus can genetic engineering technique be adopted in vitro to produce in a large number, the nano antibody of the anti-SjTGR albumen of preparation specificity, and make nano antibody immortalization as the monoclonal antibody, the application that can be subsequently provides antibody sources endlessly.Genotype combines with the amplification property of phage with phenotype, molecule binding activities by display technique of bacteriophage, achieves by the conversion of genotype to phenotype, is a revolutionary new technology of antibody drug exploitation.
At present about anti-SjTGR single domain antibodies research at home, all there is not yet report outward.The present invention is with purification of Recombinant SjTGR protein immunization Xinjiang two-humped camel, collect immune hunchbacked white corpuscle, prepare leukocytic cDNA, adopt single domain antibodies gene-specific primer, by PCR method, amplify the gene fragment of coding camel antibodies variable region (single domain antibodies).This gene fragment is inserted in phagemid vector, builds restructuring phasmid storehouse, saved by phage, final formation SjTGR immunity camel antibody heavy chain variable region phage display library (also known as single domain antibodies phage display library).Utilize the SjTGR protein screening phage display library of purifying, obtain the recombinant phage showing anti-SjTGR specificity single domain antibodies, mode finally by prokaryotic expression prepares the anti-SjTGR single domain antibodies of purifying, for further develop based on anti-SjTGR single domain antibodies schistosomicide treatment new drug and remedy measures lay a good foundation.
Summary of the invention
The present invention seeks to construct the phage display library that is shown anti schistosoma Trx glutathione reductase SjTGR single domain antibodies, screen anti-SjTGR protein-specific single domain antibodies, these single domain antibodieses can be combined with SjTGR protein-specific, and/or suppress the function of SjTGR enzymic activity, can be used for the research of schistosomicide treatment new drug and medicine targeting vector.
Technical scheme of the present invention: a kind of phage display library of single domain antibodies, it contains the gene of the whole coding single domain antibodies of SjTGR immunity Xinjiang two-humped camel, can be used for screening and prepare anti-SjTGR albumen single domain antibodies, and the screening of the specificity single domain antibodies of anti-other antigen molecule any or epi-position and preparation.
With single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 of the anti-SjTGR of three strains of the screening of the phage display library of described single domain antibodies and preparation, it can be used for the immunology application of the exploitation of schistosomicide treatment new drug and schistosomicide targeted therapeutic carrier, method or other immunodetection based on this three strains single domain antibodies, immunologic intervention and immunotherapy.
The phage display library of anti schistosoma Trx glutathione reductase SjTGR single domain antibodies, the recombinant phage containing the whole single domain antibodies gene of coding SjTGR immunity Xinjiang two-humped camel by one group forms, and each recombinant phage wherein all can at the single domain antibodies of a kind of antibody SjTGR of its surface expression.
Described coding anti-SjTGR single domain antibodies gene source is in the Xinjiang two-humped camel adopting restructuring SjTGR immunity, and the immunity system of Xinjiang two-humped camel is subject to forming the blood leukocytes producing the anti-SjTGR single domain antibodies mRNA of coding after external SjTGR stimulates.Encode anti-SjTGR single domain antibodies gene DNA fragment after being cDNA by SjTGR immunity two-humped camel blood leukocytes mRNA reverse transcription, is obtained by PCR amplification.
Described anti-SjTGR single domain antibodies phage display library is inserted in phagemid vector pCANTab5E by the full gene of single domain antibodies of encoding in the two-humped camel blood leukocytes of SjTGR immunity Xinjiang by gene recombination technology, build restructuring phasmid storehouse, the full gene having anti-SjTGR single domain antibodies of encoding is forgiven in this restructuring phasmid storehouse.Then, this restructuring phasmid group is transformed in e. coli tg1, under the assistance of helper phage M13KO7, is packaged into complete phage, forms the phage display library of an energy at the whole single domain antibodies of the anti-SjTGR of surface display.
Described is pCANTab5E for building the preferred phagemid vector of phage display library, includes but not limited to carrier pCANTab5E.
The application in the displaying storehouse of described anti-SjTGR single domain antibodies phage, including, but not limited to for screening the phage of showing anti-SjTGR specificity single domain antibodies, can also be used for the screening of specificity single domain antibodies of other antigen anti-, ligand molecular.Other described antigen, ligand molecular are including, but not limited to macromolecular organic compound, mineral compound and binding substances thereof.
The title of described three strains anti-SjTGR protein-specific single domain antibodies is respectively JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3.
The aminoacid sequence of described single domain antibodies JIPDYYNA-1 molecule and SEQIDNO.1 maintain the homology of at least 90%.
Described single domain antibodies JIPDYYNA-1 molecule, its gene nucleotide series is encoded to SEQIDNO:4.
The aminoacid sequence of described single domain antibodies JIPDYYNA-2 molecule and SEQIDNO.2 maintain the homology of at least 90%.
Described single domain antibodies JIPDYYNA-2 molecule, its gene nucleotide series is encoded to SEQIDNO:5.
The aminoacid sequence of described single domain antibodies JIPDYYNA-3 molecule and SEQIDNO.3 maintain the homology of at least 90%.
Described single domain antibodies JIPDYYNA-3 molecule, its gene nucleotide series is encoded to SEQIDNO:6.
The having of other that the single domain antibodies of described anti-SjTGR produces including, but not limited to being developed by the aminoacid sequence of the present invention three strain single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 is combined with SjTGR, and/or suppresses the single domain antibodies of SjTGR activity.
The present invention is for screening the albumen of above-mentioned three strain single domain antibodieses for restructuring thioredoxin of Schistosoma japonicum glutathione reductase (SjTGR) seleno-protein.
The aminoacid sequence SEQIDNO:7 of described SjTGR protein molecular, maintains the homology of at least 90%.
Described SjTGR protein molecular, its gene nucleotide series is encoded to SEQIDNO:8.
The invention provides and a kind ofly screen the phage display method showing anti-SjTGR specificity single domain antibodies.Particularly, with the restructuring SjTGR coated elisa plate of purifying, the recombinant phage of the single domain antibodies phage display library built with the present invention again combines, wash out with washings and not combine or in conjunction with weak phage, then use the phage of 0.1M glycine solution (pH2.2) wash-out and restructuring SjTGR specific binding.By wash-out bacteriophage ehec infection TG1, the phage of the wash-out that increases under the assistance of helper phage.Re-start screening in the same way, so repeat screening three times, finally obtain the recombinant phage expressing the single domain antibodies be combined with restructuring SjTGR protein-specific.
The present invention also provides a kind of allogenic gene DNA sequence dna identifying in recombinant phage anti-SjTGR protein-specific single-chain antibody of encoding, and the authentication method of single domain antibodies aminoacid sequence.
Particularly, preparation can with restructuring SjTGR protein-specific in conjunction with phage DNA, the allogenic gene sequence of single domain antibodies of determining to encode in phage by DNA sequence analysis, then deduces into peptide amino acid sequence.By comparing with the aminoacid sequence of the protein that existed in Genbank or polypeptide, determine the character of the single domain antibodies of this phage expression.
The invention provides expression plasmid construction process and the engineering bacteria construction process of a kind of prokaryotic expression single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3.
Particularly, first design and synthesis is used for the gene-specific primer of amplification coding single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3, then adopts PCR method from recombinant phage genomic dna, amplify the DNA fragmentation SEQIDNO:4,5 and 6 of coding single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3.Then SEQIDNO:4,5 and 6 is inserted into a kind of expression vector pET-28a(+) middle formation recombinant expression plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a and JIPDYYNA-3-pET28a, then recombinant expression plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a and JIPDYYNA-3-pET28a are transformed into respectively in a kind of host cell E. coli BL21 (DE3) and express restructuring single domain antibodies albumen JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3.
The preferred expression plasmid of the present invention is pET28a(+) (U.S. Novagen Products), be adapted at expressing in colibacillus engineering.But three strain single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 albumen in the present invention also can be expressed by other plasmid of Selection utilization, the plasmid that these expression plasmids include, but are not limited to protokaryon, eukaryotic expression system is commonly used.
Particularly, this recombinant expression plasmid contains suitable promotor, in order to control the expression of fusion rotein.These promotors include, but are not limited to the tac promotor of the following stated, and preferred promotor is T7.
The preparation method of described restructuring single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 albumen, comprise transcribe, translate, albumen sepn and purifying, and authentication step.
The expression of restructuring single domain antibodies, can be detected by general albumen biochemical apparatus, including, but not limited to: enzymatic analysis, SDS-PAGE, WesternBlotting etc.
The invention provides a kind of method of restructuring single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 albumen of purifying prokaryotic expression.
Particularly, when building recombinant expression vector by 5 ' of this three strains single domain antibodies encoding gene end and expression vector pET28a(+) go up the gene order of coding 6 Histidines (6 × his) and merge mutually, the label that the aminoterminal of single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 that expression is drawn all is made up of 6 Histidines with one, then utilize these 6 the histidine-tagged features that can be combined with metal ion, adopt method purifying and the preparation three strain single domain antibodieses of nickel ion affinity chromatograph.
The invention provides the authentication method of a kind of prokaryotic expression single domain antibodies camel source property.
Particularly, single domain antibodies is expressed bacterial lysate point on nitrocellulose filter, more anti-hunchbacked IgG bis-anti-reflective marked with HRP should, with DAB colour developing, observe recombinant expressed single domain antibodies and whether anti-to be identified by anti-hunchbacked two.
The invention provides a kind of method identifying prokaryotic expression single domain antibodies and restructuring SjTGR protein binding capacity.
Particularly, by SDS-PAGE and electrotransfer method respectively by recombinant expressed single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 protein band is transferred on nitrocellulose (NC) film, again by the SjTGR albumen test of the NC film containing single domain antibodies protein band and purifying, after washing away unconjugated SjTGR albumen, again with mouse-anti SjTGR sero-reaction, the anti-detection of against murine IgG bis-is marked with HRP, develop the color through chemoluminescence, observe the response situation of recombinant expressed single domain antibodies and restructuring SjTGR albumen, to judge single domain antibodies and the protein bound ability of SjTGR.
The invention provides and a kind ofly measure the analytical procedure of restructuring single domain antibodies to the active inhibition of the thioredoxin reductase of SjTGR albumen.
Particularly, the measuring method of thioredoxin reductase (TrxR) activity 5-is joined sulfo--bis--2-nitrobenzoic acid (DTNB) to mix with DPNH (NADPH), deposit in case there being TGR, DTNB can be reduced to 5-sulfydryl-2-nitrobenzoic acid (TNB), is determined the activity of the TrxR of SjTGR by TNB in assaying reaction system in the increased value that wavelength is 412nm place absorption value.In above-mentioned system, add the purifying single domain antibodies of some amount, observe its restraining effect to SjTGR albumen thioredoxin reductase activity.
Beneficial effect of the present invention: the anti-SjTGR single domain antibodies phage display library that the present invention builds forgives the encoding gene having the whole single domain antibodies of Xinjiang two-humped camel, can be used for screening and the preparation of the specificity single domain antibodies of anti-any antigen molecule.Three strain single domain antibodieses of screening and preparation can be survived with Schistosoma japonicum specifically and must protein molecular-Trx glutathione reductase (SjTGR) be combined, wherein the thioredoxin reductase of single domain antibodies JIPDYYNA-3 to SjTGR is inhibited, for the targeting vector developing new schistosomicide medicine and schistosomicide medicine is had laid a good foundation, there is important meaning to control schistosomiasis is popular.
Accompanying drawing explanation
The SDS-PAGE of the anti-SjTGR IgG antibody of Fig. 1 purifying camel analyzes, M molecular weight of albumen mark; 1 healthy camel serum; 240% saturated ammonium sulphate camel immunoglobulin (Ig).
Fig. 2 pcr amplification encoding heavy chain IgG antibody 2, IgG3 variable region gene, M, 1kb stranded DNA molecule amount mark; 1, the PCR primer of IgG2 variable region gene; 2, the PCR primer of IgG3 variable region gene.
Fig. 3 recombinates the analysis of phasmid VHHn-pCANTab5E double digestion, M, 1kb stranded DNA molecule amount mark; The Sfi1/Not1 double digestion product of 1-20,20 restructuring phasmids.
Fig. 4 anti-SjTGR nano antibody phage library screening phage eluriates the rate of recovery.
Fig. 5 third round eluriates the restricted enzyme cutting analysis of wash-out bacteriophage DNA, M, 1kb stranded DNA molecule amount mark; The Sfi1/Not1 double digestion product of 1-10,10 phasmid DNA.
The amino acid alignment of Fig. 6 tri-strain nano antibody
Fig. 7 encodes the amplification of nano antibody gene, M, 100bpDNA molecular weight marker; 1, JIPDYYNA-1 amplified production; 2, JIPDYYNA-2 amplified production; 3, JIPDYYNA-3 amplified production.
Fig. 8 recombinant plasmid JIPDYYNA-1-pET28a, the restriction analysis of JIPDYYNA-2-pET28a, JIPDYYNA-3-pET28a, M, 100bpDNA molecular weight marker;
1, the JIPDYYNA-1-pET28a plasmid of restructuring is through Nde1/Not1 double digestion product;
2, the JIPDYYNA-2-pET28a plasmid of restructuring is through Nde1/Not1 double digestion product;
3, the JIPDYYNA-3-pET28a plasmid of restructuring is through Nde1/Not1 double digestion product.
Fig. 9 recombinates the analysis of nano antibody expression product, A:M, Protein Marker; 1, not containing the e. coli bl21 expression product of plasmid; 2, containing the e. coli bl21 expression product of empty plasmid pET28a (+); 3, containing the full bacterium of the e. coli bl21 expression product of JIPDYYNA-1-pET28a plasmid; 4, containing the supernatant of the e. coli bl21 expression product of JIPDYYNA-1-pET28a plasmid; 5, containing the precipitation of the e. coli bl21 expression product of JIPDYYNA-1-pET28a plasmid; 6, containing the full bacterium of the e. coli bl21 expression product of JIPDYYNA-2-pET28a plasmid; 7, containing the supernatant of the e. coli bl21 expression product of JIPDYYNA-2-pET28a plasmid; 8, containing the precipitation of the e. coli bl21 expression product of JIPDYYNA-2-pET28a plasmid.
B:M Protein Marker; 1, not containing the e. coli bl21 expression product of plasmid; 2, containing the e. coli bl21 expression product of empty plasmid pET28a; 3, containing the full bacterium of the e. coli bl21 expression product of JIPDYYNA-3-pET28a plasmid; 4, containing the supernatant of the e. coli bl21 expression product of JIPDYYNA-3-pET28a plasmid; 5, containing the precipitation of the e. coli bl21 expression product of JIPDYYNA-3-pET28a plasmid.
Figure 10 recombinates the purifying of nano antibody albumen, M, protein molecular weight mark; 1, the restructuring JIPDYYNA-1 albumen of purifying; 2, the restructuring JIPDYYNA-2 albumen of purifying; 3, the restructuring JIPDYYNA-3 albumen of purifying.
Figure 11 recombinates the hunchbacked source property checking of VHH, and 1, restructuring JIPDYYNA-1 expresses bacterium lysate; 2, the JIPDYYNA-2 that recombinates expresses bacterium lysate; 3, the JIPDYYNA-3 that recombinates expresses bacterium lysate; 4, BL21 bacterium lysate; 5, camel serum.
The interaction of Figure 12 immunoblotting assay restructuring nano antibody and SjTGR, M, protein molecular weight mark; The restructuring JIPDYYNA-1 albumen of 1-3, purifying, JIPDYYNA-2 albumen and JIPDYYNA-3 albumen and SjTGR react, and mark the anti-detection of sheep anti-Mouse two with mouse-anti SjTGR antibody and HRP; 4, the restructuring JIPDYYNA-1 albumen of purifying does not react with SjTGR, with mouse-anti SjTGR antibody and the anti-detection of sheep anti-Mouse two.
The mixture of Figure 13 JIPDYYNA-1 and SjTGR different ratios is to the restraining effect of SjTGR enzymic activity.
The mixture of Figure 14 JIPDYYNA-2 and SjTGR different ratios is to the restraining effect of SjTGR enzymic activity.
The mixture of Figure 15 JIPDYYNA-3 and SjTGR different ratios is to the restraining effect of SjTGR enzymic activity.
The embodiment provided below can explain main contents of the present invention in detail, but is not limited to these contents following.
Embodiment 1: the preparation of restructuring SjTGR protein immunization Xinjiang two-humped camel and serum antibody
Through hunchbacked jugular vein blood collection before immunity, separation of serum, cryopreservation is for subsequent use.First immunisation is with purifying SjTGR albumen of recombinating (500 μ g) Split completely antigen, and through the skin of neck of subcutaneous multi-point injection Xinjiang two-humped camel, carry out booster immunization with same dosage Freund's incomplete adjuvant antigen subsequently, immunization interval is 2 weeks, altogether booster immunization 4 times.After not secondary immunity 2 weeks, through camel jugular vein blood collection 50mL, separation of serum.With the carbonic acid buffer of SjTGR albumen of recombinating (10 μ g/mL) coated elisa plate, 4 DEG C are spent the night, second day closed with the skim-milk PBS of 5%, 37 DEG C of 2h, sero-reaction hunchbacked with the immunity of doubling dilution again, rabbit anti-camel IgG bis-anti-reflective marked with HRP is again answered, and develops the color with substrate TMB, measures tiring of SjTGR immunity Xinjiang two-humped camel serum SjTGR protein antibodies.
Carry out the purifying of camel serum antibody IgG by the following method.Before using medical blood-sampling needle to gather immunity, young female Xinjiang is bimodal, 4 DEG C of precipitation serum that spend the night.Use 40% saturated ammonium sulphate to go out the total IgG antibody of camel according to HananM.EL-Hewairy method, purge process is as follows:
1) get camel serum 5mL normal saline dilution to 50mL, add 33.3mL saturated ammonium sulphate, dropwise add and stir.
2) beaker is placed 4 DEG C of hold over night and separate out immunoglobulin (Ig).
3) with 3500rpm, 4 DEG C of centrifugal 20min, abandon supernatant, and precipitation uses 20mL physiological saline solution.
4) protein solution of dissolving is put into dialysis tubing, dialyse with 1 × PBS, 4 DEG C of magnetic agitation, every 2h changes a dialyzate, 1% barium chloride solution is dripped in dialyzate, whether have ammonium sulfate exist, until add bariumchloride in dialyzate do not produce white spray, represent that ammonium sulfate has been dialysed totally if detecting in dialyzate.
6) the rear sample of dialysis that takes a morsel carries out 12%SDS-PAG electrophoresis, observes purification effect.
Result: the effect of anti-SjTGR protein antibodies reaches 1 ︰ 12800 in 5 immune camel serum, shows that immunity succeeds.Through saturated ammonium sulphate, prepare the anti-SjTGR IgG antibody of camel of purifying.As shown in Figure 1.
Embodiment 2: the preparation of coding camel anti-SjTGR nano antibody gene fragment
With 1000rpm centrifugal SjTGR immunity camel anticoagulation 10min, separated plasma and hemocyte.Percoll (GEHealth product) is adopted to prepare the camel white corpuscle parting liquid that proportion is 1.07, anticoagulation cell is added on the upper strata of white corpuscle parting liquid, with the rotating speed of 3000g at 4 DEG C of centrifugal 30min, the white cellular layer collecting interface, in a new sterile centrifugation tube, adds aseptic PBS and suspends and washed cell, the centrifugal 10min of 1000rpm, remove supernatant, then add PBS, repetitive scrubbing cell like this 3 times, collecting cell precipitates, and counts.
Adopt Trizol extracting SjTGR immunity camel peripheral blood leucocyte total serum IgE, method is as follows:
1) about 1 × 10 is got 7individual SjTGR immunity Xinjiang two-humped camel peripheral blood leucocyte, adds the Trizol of respective volume by the ratio of Trizol specification sheets requirement, with aseptic rifle head mixing several;
2) room temperature places 5min, allows Nuclear extract complex body dissociate completely;
3) ratio adding 0.2mL chloroform in 1mLTrizol reagent adds chloroform in lysate, covers tightly lid;
4) test tube 15Sec is acutely rocked, incubated at room 2-3min;
5) by 4 DEG C, sample, the centrifugal 15min of 12000g, centrifugal rear liquid is divided into 3 layers, and bottom is red phenol-chloroform layer, middle layer and upper colorless layer liquid phase, and RNA is present in the aqueous phase of upper strata completely;
6) upper liquid is carefully transferred in a new centrifuge tube;
7) add 10 μ g without the glycogen of RNA enzyme and Potassium ethanoate (3M), mixing, then add the cold dehydrated alcohol of 2 times of volumes, after mixing ,-20 DEG C of precipitates overnight;
8) with 4 DEG C, the centrifugal 10min of 12000g, supernatant (now visible RNA white precipitate) is removed;
9) 2 times are precipitated by 75% washing with alcohol, then with 4 DEG C, the centrifugal 10min of 12000g.Remove supernatant as far as possible;
10) by precipitation at room temperature dry 5-10min fade to translucent to precipitation, 50 μ LRNase-free water dissolution RNA can be added and precipitate.
Adopt magnetic bead affinity chromatography to prepare SjTGR immunity camel peripheral blood leucocyte mRNA, method presses the specification sheets of the DynabeadsmRNA purification kit of Invitrogen company.
1) Lysis/BindingBuffer will added in the total serum IgE of acquisition in test kit, mend to cumulative volume be 1mL;
2) Oligo (dT) the 25 magnetic bead liquid in abundant resuspended test kit, draws in the 15mL centrifuge tube of 1mL magnetic bead to RNase-free, is then placed on magnetic apparatus by centrifuge tube;
3) leave standstill liquid to pipe and become clear, with the liquid in transfer pipet draft tube, centrifuge tube is taken out from magnetic apparatus, add the BindingBuffer that 1mL is fresh, resuspended washing magnetic bead;
4) centrifuge tube is relay on magnetic apparatus, leave standstill liquid to pipe and become clear, then sucking liquid;
5) take out in centrifuge tube from magnetic apparatus and add the resuspended magnetic bead of 1mL sample lysate, then the sample containing total serum IgE is added in magnetic bead, mixing;
6) at room temperature continue the liquid 10min in soft mixing pipe, " the A tail " of mRNA Oligo (dT) 25 on magnetic bead is combined;
7) centrifuge tube is placed on magnetic apparatus and leaves standstill 2min, become clearly until the liquid in pipe, sucking liquid;
8) 2 magnetic bead/mRNA mixtures are washed with 2mLWashingBufferA under room temperature.With magnetic apparatus, magnetic bead is separated from washings, sucking-off WashingBufferA;
9) add 1mLcDNA first chain synthesis Buffer and wash magnetic bead once, under magneticaction, be separated magnetic bead, sucking-off supernatant liquor;
10) 50 μ LElutionBuffer(10mMTris-HCl are finally added, pH7.5), and hatch 2min at 80 DEG C, be positioned over immediately on magnetic apparatus immediately and be separated magnetic bead, and the supernatant comprising mRNA is transferred in a new RNase-free pipe, and is positioned over and preserves on ice;
11) using ElutionBuffer as blank, concentration and the purity of the mRNA obtained is measured with Nanodrop2000 ultraviolet nucleic acid-protein determinator.
Use Pusion tMrT-PCRkit synthesizes SjTGR immunity camel white corpuscle first chain cDNA, operates to specifications:
Following composition is added in an aseptic 0.5mL centrifuge tube:
mRNA10μL
Oligo(dT)Primer1μL
RNase-freeH 2O4μL
Amount to 15 μ L
Mix rear 70 DEG C of water-bath 10min, then place immediately on ice, add following reagent:
5×RTBuffer5μL
10mMdNTPMix1.25μL
RNase-freeH 2O2.75μL
Mix latter 37 DEG C and hatch 2min, then add 1 μ LM-MLV reversed transcriptive enzyme, cumulative volume is totally 25 μ L.
Reaction tubes is placed in 42 DEG C of insulation 60min, with rearmounted 80 DEG C of heating 10min, termination reaction.The cDNA of synthesis puts 4 DEG C of preservations.
The design of primers of anti-SjTGR single domain antibodies gene is compiled in amplification
According to the coding camel single domain antibodies gene order of bibliographical information, design amplification two-humped camel two subclass heavy chain antibody (IgG2, IgG3) variable region primers, using the leading peptide conserved sequence of camel heavy chain antibody (HCAb) variable region VHH as common upstream primer, and introduce Sfi1 restriction enzyme site, primer sequence is as follows:
VHH-P1:5'-CATGCCATGACTCGC gGCCCAGCCGGCCgTCCTGGCTGCTCTTCTACAAGG-3'(dashed part is Sfi1 restriction enzyme site).
The special hinge legion sequence of two kinds of hypotype HCAb is as downstream primer and introduce Not1 restriction enzyme site, and primer sequence is respectively:
VHH-P2-IgG2:5'-CGGCACCGGCGCACCT gCGGCCGCcGTGCATTCTGGTTCAGGTTTTGGTTGTGG-3'(dashed part is Not1 restriction enzyme site); VHH-P3-IgG3:5'-CGGCACCGGCGCACCT gCGGCCGCcTTGCATACTTCATTCGTTCC-3'(dashed part is Not1 restriction enzyme site).
Primer is synthesized by the handsome Bioisystech Co., Ltd in Shanghai.
To encode the amplification of anti-SjTGR single domain antibodies gene
Respectively with two couples of primer VHH-P1/VHH-P2(IgG2); VHH-P1/VHH-P3(IgG3) from TGR immunity camel blood leukocytes cDNA, amplify the gene fragment of coding IgG2, IgG3 variable region of heavy chain, and make it 5 ', 3 ' end respectively with Sfi1, Not1 restriction enzyme site.Amplification system is as follows:
IgG2 increases:
5×phusionHFbuffer20μL
dNTPs(10mM）2μL
VHH-P1(50μM）2μL
VHH-P2（IgG2）(50μM）2μL
CDNA template 10 μ L
Phusion high-fidelity enzyme 1 μ L
ddH 2O63μL
Amount to 100 μ L
Amplification condition is as follows: 98 DEG C, denaturation 30s; 98 DEG C, sex change 10s, 50 DEG C, annealing 35s, 72 DEG C, extension 40s, carry out 35 circulations; 72 DEG C, 10min, 4 DEG C of preservations.
IgG3 increases:
5×phusionHFbuffer20μL
dNTPs(10mM）2μL
VHH-P1(50μM）2μL
VHH-P3(IgG3)(50μM）2μL
CDNA template 10 μ L
Phusion high-fidelity enzyme 1 μ L
ddH 2O63μL
Amount to 100 μ L
Amplification condition is as follows: 98 DEG C, denaturation 30s; 98 DEG C, sex change 10s, 55 DEG C, annealing 35s, 72 DEG C, extension 40s, carry out 35 circulations; 72 DEG C, 10min; 4 DEG C of preservations.
Get 5 μ L amplified productions and carry out sepharose (1%) electrophoresis, observe amplified production situation.
To encode the purifying of anti-SjTGR albumen single domain antibodies gene DNA
The PCR primer of coding IgG2, IgG3 antibody heavy chain variable region is carried out low melting-point agarose gel (NuSieveGTG agarose, 1%) electrophoresis respectively, extracts the target DNA fragment blob of viscose containing expection size under ultraviolet lamp, be placed on ice.Adhesive tape twice is soaked, each 30min, balance adhesive tape with 1 × β gelase Ibuffer of two volumes.After exhaustion damping fluid, blob of viscose is put 65 DEG C of thawing 10min that heat, be then cooled to 42 DEG C.The β gelase I of 2U is added, at 42 DEG C of digestion 1h in the agarose glue melted.Then at 65 DEG C of heating 15min, inactivation β gelase I.High speed centrifugation 1min, transfers to supernatant liquor in another clean centrifuge tube.
Adopt the PCR primer purification kit (WizardSVGelandPCRclean-upSystem) of Promega company purifying coding single domain antibodies DNA fragmentation from agarose Digestive system, purge process is as follows:
1) in above-mentioned agarose Digestive system, isopyknic MembranceBingdingSolution is added, mixing; SVMinicolumn is placed in CollectionTube;
2) join in SVMinicolumn by the mixture of sample liquid and MembranceBingdingSolution, room temperature leaves standstill 1min;
3) 14,000rpm centrifugal 1min, pour out from the liquid gone out, again put SVMinicolumn well;
Add the MembraneWashSolution of 700 μ L, the centrifugal 1min of 14,000rpm, pours out from the liquid gone out, again puts SVMinicolumn well;
4) in post, add the MembraneWashSolution of 500 μ L again, the centrifugal 1min of 14000rpm, pours out from the liquid gone out, with the centrifugal 1min of identical rotating speed to remove remaining liquid;
5) SVMinicolumn is placed in a clean 1.5mL centrifuge tube, add on the pellosil of Nuclease-FreeWater to the SVMinicolumn post of 50 μ L, ambient temperatare puts 1min, the centrifugal 1min of 14,000rpm; Collect the goal gene fragment of purifying, put-20 DEG C of preservations; Concentration and the purity of purifying DNA fragment is measured with Nanodrop2000 nucleic acid-protein determinator.
Result: use purification of Recombinant SjTGR protein immunization Xinjiang two-humped camel, through 5 immunity, the level that ELISA method detects the anti-SjTGR IgG antibody of camel serum reaches 1:12800, obtains good immune effect.Collect the white corpuscle in immune camel peripheral blood, with the total serum IgE of Trizol legal system detailed information born of the same parents, use Invitrogen company mRNA magnetic bead separation kit purified mRNA again, obtain the leukocytic mRNA of 4.456 μ g immunity camel, the ratio of its OD260/OD280 is 2.23.
Adopt the first chain cDNA synthesis system in the reverse transcription PCR test kit of NEB, synthesize the first chain cDNA of immune camel blood leukocytes.Utilize gene-specific primer, with immune camel white corpuscle cDNA for template, increase IgG2 and IgG3 heavy chain variable region gene fragment respectively, all obtains the DNA fragmentation that molecular weight is about 500bp, as Fig. 2.
Embodiment 3: anti- sjthe structure of TGR single domain antibodies phage display library
Adopt Sfi1 and Not1 double digestion method to prepare DNA fragmentation that linearizing phasmid pCANTab5EDNA and enzyme cut coding nano antibody, endonuclease reaction system is as follows:
PCANTab5EDNA fragment 30 μ L
10×Buffer45μL
100×BSA0.5μL
Not1-HF1μL
ddH 2O2.5μL
Amount to 49 μ L
Mix centrifugal after, put 37 DEG C of water-bath 4h.Add Sfi11 μ L mix centrifugal after, put 50 DEG C of water bath heat preservation 3h.
The recovery of digestion products: above-mentioned digestion products is carried out the agarose gel electrophoresis of 1%, after 100V electrophoresis 60min, observes digestion products situation.Cut containing object fragment blob of viscose from agarose gel, reclaim the linearizing phasmid pCANTab5EDNA fragment of Purification Kit double digestion with Promega company DNA glue.Enzyme is cut rear nano antibody gene fragment Promega company DNA glue recovery purification kit and is directly carried out purifying, and method presses process specifications.The linearizing phasmid pCANTab5EDNA of purifying and the concentration of nano antibody DNA fragmentation and purity is measured with Nanodrop2000 nucleic acid-protein determinator.
Connect: adopt the CloneDirectRapidLigationKit of Lucigen company to connect.The nano antibody IgG2 of double digestion and IgG3DNA fragment and linearizing phasmid pCANTab5EDNA are pressed 3:1 mixed in molar ratio, and connect under the effect of DNA ligase, linked system is as follows:
10×ligaseBuffer1μL
VHHDNA fragment 5 μ L
pCANTab5E3μL
CloneSmartDNAligase1μL
Amount to 10 μ L
Reaction conditions: 2h is hatched in 23 DEG C of water-baths, then 70 DEG C of heating 15min termination reactions.
In order to expand the diversity in phasmid storehouse, 5 ligations have been carried out in this research respectively, obtain 50 μ L altogether and connect product.
Concentrated: 50 μ L to be connected product sterilized water and is diluted to 300 μ L, add 2 times of volume dehydrated alcohols, mix rearmounted-30 DEG C of precipitation 3h; At 4 DEG C with the centrifugal 30min of 12000g, abandon supernatant, at drying at room temperature 5-10min; Throw out 10 μ L sterilized waters dissolve 3h at 4 DEG C, finally obtain the connection product of about 10 μ L.
Transform: adopt impulse method will connect product conversion e. coli tg1 competent cell.Method is as follows:
1) be that 0.1cm electric shock cup and 1.5mL centrifuge tube are placed on precooling on ice by slit;
2) take out TG1 competent cell from-80 DEG C, put 10-15min on ice and treat to thaw completely;
3) draw in 25 μ L competent cells to precooled sterile centrifugation tube (putting on ice), add 2 μ L and connect product, softly stir evenly with rifle head, place 30min on ice;
4) TG1 competent cell/DNA mixture is carefully transferred to the slit of electric shock cup from centrifuge tube, does not produce bubble, place 5min on ice;
5) electric impulser (BIO-RAD) pulse parameter is set: voltage 2.5kV, electric capacity 25 μ F, resistance 200; The cup that will shock by electricity inserts in electric impulser electric shock tank, pins till two pulsed electrodes are retained to electric discharge simultaneously;
6) take out electric shock cup, add the SOC substratum of 0.975mL37 DEG C of preheating, bacterium liquid is transferred in a sterile glass test tube after mixing, 37 DEG C, 120rpm shaking culture 1h;
7) repeat conversion 5 times in the same way, all link products are carried out electricity and transform; Be divided into 6 parts after being mixed by converted product and be applied to (Amp100 μ g/mL, Glucose2%) on 2 × YT flat board of 6 pieces of 24 × 24cm respectively; Ambient temperatare is put, and after the bacterium liquid on flat board absorbs completely, is inverted dull and stereotyped in 37 DEG C of incubator grow overnight;
8) preservation in nano antibody phasmid storehouse: with 10mL2 × YT substratum the bacterium colony on 6 culture plates is all scraped lower after mix, add the sterile glycerol that final concentration is 20%, be distributed into 1mL/ and prop up ,-80 DEG C save backup.
The calculating of storage capacity:
1) get the phasmid storehouse bacterium liquid 10 μ L under scraping, after doing gradient dilution with 2 × YT substratum, get 100 μ L respectively and be coated with 2 × YT plate, after 37 DEG C of grow overnight, getting bacterium colony is all the single clone's number of monoclonal plate count;
2) be multiplied by extension rate with single clone's number whole on flat board, then be then the storage capacity in restructuring phasmid storehouse divided by the volume (mL) this flat board being coated with bacterium liquid.
The qualification of phasmid storehouse recombination fraction
Random picking 20 single bacterium colonies from flat board, 37 DEG C of overnight incubation in transferred species to 3mLLB liquid nutrient medium, with Promega company plasmid DNA purification test kit (PromegaplasmidMiniprepKit) extracting plasmid, method presses process specifications.
With restriction enzyme Sfi1 and Not1, double digestion is carried out to the plasmid in 20 single bacterium colonies, analyze its recombination fraction.Reaction system is as follows:
Plasmid DNA 10 μ L
10×NEBBuffer42μL
100×BSA0.2μL
Not1-HF1μL
ddH2O6.8μL
Amount to 19 μ L
Mix centrifugal after, put 37 DEG C of water baths reaction 4h; Add again 1 μ LSfi1 mix centrifugal after, put the reaction of 50 DEG C of water baths and spend the night.
Digestion products is carried out 1% agarose gel electrophoresis, 100V electrophoresis 40min, whether gel imaging instrument is observed the digestion products of restructuring phasmid DNA containing DNA band similar to nano antibody gene fragment and linearizing pCANTab5E size respectively, and calculate recombination fraction.
Show anti- sjthe rescue of TGR nano antibody recombinant phage
1) the phasmid storehouse bacterium liquid of 10 times of storage capacities is inoculated in 50mL2 × YTAG(ammonia benzyl 100 μ g/mL, glucose 20%w/v) in, 37 DEG C, 200rpm shaking culture, survey OD at interval of 30min 600nmonce, OD value close to 0.4 time, more every 20min surveys once, until OD 600=0.4;
2) in bacterium liquid, the helper phage M13KO7 of appropriate number is added in the ratio (i.e. every 20 helper phage infection intestinal bacteria) of infection multiplicity (MOI) 20:1,37 DEG C, 200rpm continuation cultivation 1h;
3) with the centrifugal 10min of 4000rpm, remove supernatant, bacterial precipitation is resuspended in 50mL2 × YTAK(ammonia benzyl: 100 μ g/mL, kantlex: 50 μ g/mL) in substratum, 30 DEG C, 200rpm overnight incubation;
4) second day, be transferred to by nutrient solution in centrifuge tube, supernatant, with the centrifugal 10min of 8,000g, is then transferred in a new pipe, abandons precipitation (now phage is in supernatant liquor) by 4 DEG C;
5) centrifuged supernatant again, is carefully transferred to 80% supernatant liquor in a new pipe, and adds the 20%PEG/2.5MNaCl of 1/6 volume, and latter 4 DEG C of reversing mixing staticly settles and spends the night;
6) by the liquid 4 DEG C of precipitates overnight with the centrifugal 15min of 12,000g, abandon supernatant, again quick of short duration centrifugal after by remaining liq exhaust, phage is the white deposits be adsorbed on tube wall;
7) dissolve phages thing with TBS, room temperature is with the centrifugal 5min of 14,000rpm;
8) supernatant liquor is transferred to a new centrifuge tube, adds the 20%PEG/2.5MNaCl of 1/6 volume, ice bath places 1h, with the centrifugal 10min of 14,000rpm, abandons supernatant for 4 DEG C, of short duration quick centrifugal rear exhaustion residue supernatant;
9) by TBS Eddy diffusion precipitation, room temperature is with the centrifugal 1min of 14,000rpm, and draw supernatant in another new pipe, adding sterile glycerol to final concentration is 30%, mixes and is stored in 4 DEG C; This is anti- sjtGR single domain antibodies phage display library.
Anti- sjtGR single domain antibodies phage display library titer determination, method is as follows:
1) from the single colony inoculation of picking TG1 2 × YT plate in 5mL2 × YT substratum, 37 DEG C of shaking culture are to OD 600nm≈ 0.5;
2) when bacterial growth, after pushing up the thawing of agar microwave oven, packing 9mL in sterile tube, and will remain in 45 DEG C of water-baths;
3) with 2 × YT liquid nutrient medium serial dilution storehouse phagocytosis body fluid of pre-temperature, extent of dilution is respectively 1 ︰ 10 3, 10 5, 10 7, 10 9, 10 11, 10 12;
4) when TG1 bacterium arrives logarithmic phase, get 200 μ L respectively and add in each centrifuge tube, often add the dilution phagocytosis body fluid of 10 μ L mono-in pipe, mixing, infects 5min under room temperature;
5) transferred to by the bacterium/phage mixture of infection in the top fat of 45 DEG C of pre-temperature, after putting upside down mixing, 2 × YT of rapid dumps 37 DEG C of preheatings is dull and stereotyped, and Rotating Plates makes top agar be uniformly distributed in dull and stereotyped surface;
After dull and stereotyped cooling 10min, be inverted, 37 DEG C of overnight incubation;
6) choose the flat board of dull and stereotyped upper plaque independent distribution, counting plaque number, and calculate the titre (pfu/mL) of phage.
Result: the heavy chain antibody IgG2 of amplification and IgG3 variable region (VHHn) gene fragment are connected in phagemid vector pCANTab5E and build restructuring phasmid VHHn-pCANTab5E.Forward in Host Strains TG1 intestinal bacteria by repeatedly electricity, be all coated with polylith 2 × YT flat board and obtain the VHHn-pCANTab5E phasmid storehouse be present in Host Strains afterwards.The storage capacity in phasmid storehouse is about 4.5 × 10 10cFU/mL.
20 single bacterium colonies are selected at random from connection product conversion flat board, Sfi1/Not1 double digestion is carried out after extracting phasmid DNA, the electrophoresis result of digestion products shows 20 single bacterium colony phasmid DNA after double digestion, all can produce similar to camel antibody heavy chain variable region (VHH) size, length is about the insertion DNA fragmentation of 400-500bp, as Fig. 3.The recombination fraction in the nano antibody phasmid storehouse of pointing out this to prepare reaches 100%.
Carry out phage rescue with M13KO7 helper phage infection nano antibody phasmid storehouse, obtain and show that the recombinant phage of single domain antibodies shows storehouse, tiring of storehouse is 4 × 10 12pfu/mL, cumulative volume is 8mL.
Embodiment 4: show anti- sjthe screening of TGR single domain antibodies recombinant phage
Method is as follows: the first round eluriates
1) the single bacterium colony of picking e. coli tg1, is inoculated in the LB substratum of 10mL, 20mL respectively, and 37 DEG C of violent joltings, to logarithmic phase, measure and amplification for phage titre;
2) by purifying sjtGR albumen 0.1MNaHCO 3(pH8.6) solution is made into the solution that concentration is 1000 μ g/mL, gets 1mL(1000 μ g) protein solution bag is by 12 porocyte culture plates, and 4 DEG C are spent the night;
3) after coating buffer being outwelled, clean paper pats dry, remove remaining liquid, then in hole, fill it up with confining liquid (the skim-milk PBS of 5%), put 37 DEG C of closed 2h;
4) pat dry with method after outwelling confining liquid, wash plate with TBST (TBS+0.1% [v/v] Tween-20), wash plate 6 times;
5) with TBST by phage display library phage (8 × 10 13pfu) be diluted to 1mL, join bag by good plate hole, softly mix under room temperature, in conjunction with 60min;
6) outwell unconjugated phage, and then pat dry, remove residual liquid;
7) wash plate 10 times with TBST, then wash 5 times with TBS.(when blotting, adopting new paper handkerchief to prevent crossed contamination) at every turn;
8) in hole, add 900 μ L glycine liquid (0.1M, pH2.2) and shake 10min gently at room temperature, the phage of elution of bound; Then elutriant to be transferred in a new sterile tube rapidly, adds 100 μ LTris-HCl (1mol/L, pH8.0), in and pH to being about 7.0;
9) Phage amplification: elutriant is inoculated into 10mL logarithmic phase (OD 600nm=0.5) in TG1 bacterium liquid, after incubated at room 30min, get 10 μ L bacterium liquid and carry out gradient dilution, coat 2 × YT planar surface respectively after mixing with top agar, measure the titre (pfu/mL) of elutriant pnagus medius;
10) remaining bacterium liquid transferred species is in 2 × YTA nutrient solution of 50mL, and 37 DEG C, 200rpm is cultured to OD 600nmafter being about 0.4, add 100 μ LM13KO7 helper phages (10 12pfu), adding kantlex to final concentration after infecting 30min is 50 μ g/mL, 37 DEG C, 200rpm overnight incubation;
11) according to the method for embodiment 3, carry out precipitation with PEG/2.5MNaCl to the phage of incubated overnight and collect, supernatant liquor is the phage of amplification;
12) carry out titer determination by the method for embodiment 3 to the phage of first round elutriation, amplification, the phage of amplification adds isopyknic sterile glycerol, mixing, 4 DEG C of storages.
Second takes turns elutriation
With 1mL (100 μ g) purifying sjtGR albumen bag is by 12 porocyte culture plates, and 4 DEG C of bags are spent the night, add after closing the first round eluriate after the phage of amplification, sieve and wash step 5 by the first round)-12) carry out second and take turns elutriation, phage used is the phagocytosis body fluid (10 of first round amplification 12pfu), in washing lotion, the concentration of tween is increased to 0.5%(v/v).
Measure according to the method for the first round phage quantity that second takes turns wash-out, and carry out Phage amplification, concentrated and titer determination.
Third round is eluriated
With 1mL (10 μ g) purifying sjtGR albumen bag is by 12 porocyte culture plates, and 4 DEG C of bags are spent the night, and adds the phage that the first round eluriates rear amplification, sieve and wash step 5 by the first round after closing)-12) carry out third round elutriation, phage used is the second phagocytosis body fluid (10 of taking turns amplification 12pfu).
The qualification of recombinant phage
Restricted enzyme cutting analysis: phage-infect TG1 bacterium third time elutriation obtained, dull and stereotyped upper 10 the single bacterium colonies of random choose, are inoculated in 10 3mL2 × YTA substratum respectively.37 DEG C, 200rpm shakes bacterium and spends the night.Secondary daily Promega company plasmid DNA purification test kit (PromegaplasmidMiniprepKit) extracts the phasmid of 10 bacterium colonies.Carry out restriction analysis with restriction enzyme Sfi1 and Not1, reaction system is as follows simultaneously:
Plasmid DNA 10 μ L
Not1-HF1μL
100×BSA0.2μL
10×NEBBuffer42μL
ddH 2O6.8μL
Amount to 19 μ L
Mix centrifugal after, put 37 DEG C of water baths reaction 4h.Add again 1 μ LSfi1 mix centrifugal after, put the reaction of 50 DEG C of water baths and spend the night.
Digestion products is all carried out 1% agarose gel electrophoresis, 100V electrophoresis 40min, the whether digested one-tenth of phasmid DNA two DNA band similar to expection nano antibody and linearizing pCANTab5E size respectively observed by gel imaging instrument.
DNA sequence analysis: be inoculated into respectively in 100 3mL2 × YTA substratum from eluriating random choose 100 single bacterium colonies the phage-infect TG1 Bacterial Plate that obtains for the third time.37 DEG C, 200rpm shakes bacterium and spends the night.Secondary daily Promega company plasmid DNA purification test kit (PromegaplasmidMiniprepKit) extracts phasmid DNA.The phasmid sample obtained all is sent to Shanghai invitrogen company, carries out unidirectional order-checking, and analyze sequencing result with phasmid pCANTab5E upstream primer (primer sequence: CCATGATTACGCCAAGCTTTGGAGCC).
Result: carry out phage rescue with M13KO7 helper phage infection nano antibody phasmid storehouse, obtain nano antibody recombinant phage and show storehouse, tiring of storehouse is 4 × 10 12pfu/mL, cumulative volume is 8mL.
With the restructuring of purifying sjtGR albumen coated elisa plate, then the recombinant phage in nano antibody phage display library is combined, carry out 3 take turns elutriation after, along with sjthe reduction of TGR package amount, eluriates the increase of number of times, and the condition of elutriation is rigorous gradually, and the phage of specific binding is significant enrichment trend, and the phage rate of recovery obviously increases.Each take turns to eluriate obtain the data of phage as table 1 and Fig. 4.
The rate of recovery of phage eluriated by table 1 respectively wheel
10 single bacterium colonies are selected at random from the flat board of third round screening wash-out bacteriophage infection TG1 bacterium, extracting phasmid DNA, double digestion analysis is carried out with Sfi1/Not1, digestion products agarose electrophoresis result shows, wherein there is the exogenous insertion DNA fragmentation (Fig. 5) containing 400-500bp in the phasmid of 8 single bacterium colonies, show that the recombination percent of third round wash-out bacteriophage is about 80%.
Third round is eluriated the phage-infect TG1 bacterium obtained, random choose 100 single bacterium colonies, extracting phasmid carries out DNA sequencing, analyze sequencing result VectorNTI10 software.The successful phasmid that checks order has 93, and the phasmid containing the exogenous insertion DNA fragmentation of 500bp size of having an appointment has 69.These 69 exogenous insertion DNA sequence dnas are translated into aminoacid sequence, carries out amino acid sequence homology comparison.It is 429bp that result shows No. 3 clone's single domain antibodies coding gene sequence length, and identical clone has 27; No. 67 clone's single domain antibodies coding gene sequence length is 441bp, and identical clone has 8; And the coding gene sequence length of No. 54 clone's single domain antibodies is 441bp, identical clone has 2; Remaining single domain antibodies sequence does not all repeat (table 2), and 3 strain nano antibodies are named as respectively: JIPDYYNA-1, JIPDYYNA-3 and JIPDYYNA-2, and Amino acid sequences alignment's result is as Fig. 6.
The distribution of table 2 sequence homology nano antibody clone
By contrasting 3 strain nano antibody aminoacid sequences, according to IMGT method, structure division is carried out to sequence, this 3 strain nano antibody is the variable region of camel heavy chain antibody, all containing the cysteine residues (C22, C97) that two, antibody heavy chain variable region is significant, its skeleton district (FR2 district) is containing VHH hydrophilic amino acid characteristic site F37, E44, R45, G47, all containing GTNEVCK territory in carbonyl terminal amino acid sequence, for the characteristic sequence of IgG3 hypotype hinge, show that this three strains nano antibody is all IgG3 subclass antibodies.The CDR3 length of JIPDYYNA-1 is 18 amino acid, and the CDR3 length of JIPDYYNA-2 is 20 amino acid, and the CDR3 length of JIPDYYNA-3 is 21 amino acid, is all greater than the length (9-12 amino acid) of conventional antibody IgG variable region of heavy chain CDR3.In addition, JIPDYYNA-1 aminoacid sequence and ncbi database are logged in and carries out the comparison of Blast homologous sequence, find that the originate homology of VHH sequence of JIPDYYNA-1 and dromedary and alpaca is 60%-62%.
Embodiment 5: the Construction and identification of the prokaryotic expression plasmid of single domain antibodies
The amplification of single domain antibodies gene
Design of primers: the primer redesigning amplification coding single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 gene fragment, makes Nde1 restriction enzyme site in upstream primer 5 ' end band, Not1 site in downstream primer 5 ' end band.Primer sequence is as follows:
P1：5'-CGCCATATGTCCTGGCTGCT-3'，
P2：5'-CGCCATATGTCCTGGCTTGCTCTT-3'，
P3：5'-ATTTGCGGCCGCCTACTTGCATACTTCATTCGTTCC-3'。
Primer is synthesized by the handsome Bioisystech Co., Ltd in Shanghai.
Gene amplification: respectively with phasmid JIPDYYNA-1-pCANTab5E, JIPDYYNA-3-pCANTab5EDNA for template, P1 as upstream primer, P3 as downstream primer, the gene DNA fragment of amplification coding JIPDYYNA-1 and JIPDYYNA-3;
With phasmid JIPDYYNA-2-pCANTab5E for template, P2 is as upstream primer, and P3 amplifies the gene DNA fragment of coding JIPDYYNA-2 as downstream primer.Amplification system is as follows:
10×buffer5μL
25mMMgCl 25μL
10mMdNTP1μL
JIPDYYNA/pCANTab5E1μL
Upstream primer (50mM) 1 μ L
Downstream primer (50mM) 1 μ L
Taq enzyme 1 μ L
ddH 2O35μL
Amount to 50 μ L
Amplification condition: 95 DEG C, 3min; 95 DEG C, 20s, 60 DEG C, 35s, 72 DEG C, 60s, 30 circulations; 72 DEG C, 10min; 4 DEG C of preservations.
The pcr amplification product getting 5-10 μ LJIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 carries out the agarose gel electrophoresis of 1%, observes pcr amplification result under ultraviolet lamp.The gene fragment amplification product of three strain nano antibodies is monospecific DNA and is with.PCR primer purification kit (WizardSVGelandPCRclean-upSystem) is adopted directly to carry out DNA purifying.
The TA clone of coding single domain antibodies gene
Connect: the nano antibody DNA fragmentation after being reclaimed by purifying mixes, at T according to the ratio of molecule mole number 3 ︰ 1 with TAclone carrier pGEMT-EasyDNA 4connect under the effect of DNA ligase, construction recombination plasmid JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3-pGEMT.Linked system is as follows:
2×Ligationbuffer5μL
pGEMT-EasyVector1μL
JIPDYYNA-1、2、3DNA3μL
T4DNALigase1μL
Amount to 10 μ L
4 DEG C of connections are spent the night
Electricity transforms
1) get 10 μ L connection products to join in 100 μ L bacillus coli DH 5 alpha competent cells, carefully mix, do not made bubble produce, place 30min on ice bath;
2) slit mixture connecting product and competent cell being transferred to precooling is on ice in the electric shock cup of 0.1cm, has not made bubble produce in transfer process, carefully wipes the water of condensation outside electric shock cup away;
3) electric impulser (BIO-RAD) pulse parameter is set: voltage 2.5kV, electric capacity 25 μ F, resistance 200.The cup that will shock by electricity inserts in electric impulser electric shock tank, pins till two pulsed electrodes are retained to electric discharge simultaneously;
4) take out electric shock cup, add the SOC substratum of 0.5mL37 DEG C of preheating, bacterium liquid is transferred in a sterile glass test tube after mixing, 37 DEG C, 120rpm shaking culture 40min;
5) get 200 μ L bacterium liquid to be spread evenly across surface and to scribble 40 μ LX-gal(40mg/mL in advance) LB flat board on (containing Amp100 μ g/mL).Ambient temperatare is put, and after the bacterium liquid on flat board absorbs completely, is inverted flat board and spends the night in 37 DEG C of incubators.
Positive clone identification
1) blue/screen in vain on LB flat board, occur that white colony can preliminary judgement be positive colony, blue colonies is negative clone;
2) Nde1/Not1 double digestion qualification: the white colony that picking is single from LB flat board is inoculated in 3mLLB substratum 37 DEG C, 200rpm overnight incubation.With plasmid DNA purification test kit (WizardPlusMiniprepsDNAPurificationSystem) extracting plasmid.Plasmid is done double digestion with Nde1/Not1 restriction enzyme respectively, and endonuclease reaction process is as follows:
10×NEBbuffer42μL
Plasmid DNA 13 μ L
Nde10.5μL
Not10.5μL
ddH 2O4μL
Amount to 20 μ L
37 DEG C of reactions are spent the night, 65 DEG C of 20min inactivations
Digestion products is carried out the agarose electrophoresis of 1%, under ultraviolet lamp, observe enzyme cut result.
3) enzyme is cut and is identified that positive bacterium colony is delivered to Shanghai Sheng Gong biotechnology company limited and carried out determined dna sequence by DNA sequence analysis.
The Construction and identification of recombinant expression plasmid
The preparation of double digestion single domain antibodies gene DNA fragment and linearization plasmid pET28a (+) DNA
By the JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3-pGEMT plasmid DNA of purifying and expression plasmid pET28a (+) DNA, carry out double digestion with Nde1 and Not1-HF respectively simultaneously.Reaction system is as follows: JIPDYYNA gene or plasmid pET28a (+) 30 μ L
100×BSA0.5μL
10×NEBBuffer45μL
Nde12μL
Not1-HF2μL
Amount to 50 μ L
Mix centrifugal after, put 37 DEG C of water-bath enzymes and cut through night.
The recovery of JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3 gene and plasmid pET28a (+) digestion products
Above-mentioned digestion products is carried out the agarose gel electrophoresis of 1%, after 100V electrophoresis 40min, cut containing object fragment blob of viscose from glue, reclaim VHH fragment and linearization plasmid pET28a (+) DNA of Purification Kit double digestion with Promega company DNA glue.
Connect :the nano antibody DNA fragmentation of double digestion and linearization plasmid pET28a (+) DNA are mixed, at T in 3 ︰ 1 ratios 4connect under the effect of DNA ligase, linked system is as follows:
10×T4DNAligaseBuffer1μL
JIPDJIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-37μL
Linearizing pET28a (+) DNA1 μ L
T4DNAligase1μL
Amount to 10 μ L
Reaction conditions: 16 DEG C of water-baths connect spends the night.
Electricity transforms: mixed with bacillus coli DH 5 alpha competent cell by connection product and carry out electricity and transform, method is the same.
Enzyme cuts qualification
1) from the single colony inoculation of picking LB flat board in 3mLLB liquid nutrient medium, 37 DEG C of overnight incubation.By Promega plasmid extraction test kit extracting recombinant plasmid dna;
2) plasmid DNA of extraction is carried out Nde1 and Not1-HF double digestion, reaction system is as follows:
Plasmid DNA 16 μ L
100×BSA0.2μL
Nde10.5μL
Not1-HF0.5μL
10×NEBBuffer42μL
ddH 2O0.8μL
Amount to 20 μ L
37 DEG C of water-bath digestion 4h, get digestion products 10 μ L and carry out 1% agarose gel electrophoresis, it is contrast with recombinant plasmid simultaneously, 100V electrophoresis 1h, the whether digested one-tenth of recombinant plasmid dna two DNA band similar to JIPDYYNA fragment and linearizing pET28a (+) size respectively observed by gel imaging instrument.
Result: adopt single domain antibodies gene-specific primer respectively from plasmid JIPDYYNA1, in 2,3/pCANTab5E, amplification is to the gene fragment of encoding heavy chain antibody variable region respectively, and size is about 500bp, in the same size with expection.As Fig. 7.
Above-mentioned three gene fragments are carried out TA clone, plasmid JIPDYYNA-1-pGEMT, JIPDYYNA-2-pGEMT, JIPDYYNA-3-pGEMT containing coding nano antibody gene is delivered to Shanghai Sheng Gong biotechnology company limited and carries out DNA sequence analysis, the gene order of result and expection is completely the same.
By nano antibody gene by Nde1 and Not1 restriction enzyme site directed cloning in expression vector pET28a, construct recombinant expression plasmid JIPDYYNA-1-pET28a, JIPDYYNA-2-pET28a and JIPDYYNA-3-pET28a.With Nde1 and Not1 enzyme restricted enzyme cutting analysis, result confirms that nano antibody gene is all properly inserted in expression plasmid pET28a, recombinant plasmid JIPDYYNA-2-pET28a and JIPDYYNA-3-pET28a all can cut out the long goal gene band of a treaty 500bp, but because the 125bp place in JIPDYYNA-1 gene order is containing a Not1 restriction enzyme site, so JIPDYYNA-1 gene is cut into 2 DNA bands (Fig. 8) that size is respectively 125bp and about 380bp, but its total length and expection is in the same size.Show three construction of recombinant expression plasmid successes.
Embodiment 6: anti- sjtGR single domain antibodies expresses structure, protein expression and the purifying of engineering strain
By recombinant plasmid JIPDYYNA-1/JIPDYYNA-2/JIPDYYNA-3-pET28a respectively electricity be transformed in expressive host bacterium BL21 (DE3) competent cell, containing screening on the LB flat board of kantlex (50 μ g/mL) containing the transformant bacterial strain of recombinant expression plasmid.
1) single colony inoculation (containing 50 μ g/mL kantlex) in 3mLLB liquid nutrient medium on picking LB flat board, 37 DEG C of shaking culture are spent the night;
2) with the ratio of 1 ︰ 100, incubated overnight bacterium is transferred (containing kantlex 50 μ g/mL) in 1LLB nutrient solution next day, 37 DEG C, 200rpm continues shaking culture 4h;
3) as bacterium liquid OD 600nmwhen reaching 0.6-0.8, in culture, then adding IPTG to final concentration is 1mM, 37 DEG C, 200rpm continues shaking culture 4h;
4) collected by centrifugation bacterium, removes supernatant, with the resuspended bacterial precipitation of the PBS of 50mL;
5) in re-suspension liquid, adding N,O-Diacetylmuramidase to final concentration is 1mg/mL, reacts 1h on ice, lysing cell wall;
6) by bacterial lysate multigelation 2-3 time, until bacterium liquid becomes thick;
7) then bacterial lysate is carried out ultrasonic degradation (program: ice bath, power: 200W, ultrasonic 10s, interval 10s, ultrasonic 10 times repeatedly), then 4 DEG C with the centrifugal 30min of 12000 × g;
8) get the supernatant of above-mentioned expression product, each 200 μ L of throw out respectively, add equal-volume 2 × sample-loading buffer, mixing, room temperature effect 30min, boils 10min, gets 20 μ L expression products and carries out 15%SDS-PAG electrophoresis.After 120V voltage makes sample enter separation gel, 180 vvoltage continues electrophoresis 60min.After electrophoresis terminates, take out gel, coomassie brilliant blue staining 30min under room temperature, then with destainer decolouring to clear background, observing recombinant expression protein is in the supernatant of expression product lysate or in precipitation;
9 )prepare nano antibody expression product in a large number as stated above, collected by centrifugation bacterial precipitation; Ultrasonic degradation after suspending with PBS, is undertaken centrifugal by lysate, collecting precipitation thing;
10) by resuspended for expression product throw out 50mLPBS, then remove supernatant with the centrifugal 10min of 12000g, so repeat fully washing 3 times;
11) LEBuffer throw out 100mL after washing being contained 8M urea dissolves, and 4 DEG C of stirring and dissolving are spent the night;
12) by the liquid 4 DEG C of centrifugal 30min of high speed centrifugation 12000g after dissolving;
13) the centrifugal supernatant of careful absorption, with the membrane filtration of 0.45 μm, nickel chelating affinity chromatography column purification in preparation;
14) nickel post prepares: balance pillar with the LEBuffer that 10 times of volumes contain 8M urea;
15) by nickel affinity chromatography post on the expression product after filtration, the forward and backward solution of upper prop is got respectively for subsequent analysis;
16) wash post with the LEBuffer of 20 times of volumes (20mL), collect and wash post liquid;
17) wash post with the WashBuffer of 20 times of volumes, collect post liquid;
18) respectively with the ElutionBuffer gradient elution target protein containing different concns (20mM, 30mM, 40mM, 50mM, 60mM, 70mM, 200mM, 250mM) imidazoles;
19) get 10 μ L samples and equal-volume 2 × SDSloadingbuffer respectively to mix and boil 10min and carry out 15%SDS-PAG electrophoresis.After 120V voltage makes sample enter separation gel, 180V voltage continues electrophoresis 70min.After electrophoresis terminates, take out gel, coomassie brilliant blue staining 30min under room temperature, then with destainer decolouring to clear background, observations;
20) get the purifying protein after wash-out and carry out dialysis renaturation, dialyzate is the PBS damping fluid containing 50mML-arginine and different concns urea, and regulates pH of buffer to 8.0.Take the mode reducing urea concentration gradually 4 DEG C of dialysis, finally use 1 × PBS to dialyse.
Result: will containing recombinant plasmid JIPDYYNA-1-pET28a, the engineering bacteria of JIPDYYNA-2-pET28a, JIPDYYNA-3 – pET28a is inoculated in LB substratum respectively to be cultivated, and carries out protein induce expression with IPTG.Through optimization to expression condition, induce with 1mMIPTG, at 37 DEG C of induction 4h, the recombinant protein that a part amount is about 20kDa can be given expression to, with matching with His label nano antibody molecular weight of recombinating of estimating.SDS-PAGE analyzes three recombinant expressed strain single domain antibodies albumen of display and is insoluble inclusion body protein, is present in the precipitation of expression product lysate.As Fig. 9.
Adopt nickel ion metal chelate affinity chromatography glue under Denaturing, to carry out purifying to recombinant expressed nano antibody, all obtain purer restructuring single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 albumen.As Figure 10.
Embodiment 7 is recombinated the hunchbacked source property analysis of nano antibody
Adopt Dot-ELISA, single domain antibodies of will recombinate expresses bacterium lysate as antigen point film, simultaneously with negative bacteria lyse liquid for negative control, camel serum is positive control, reacts with it, DAB colour developing using HRP coupling goat-anti camel how anti-to resist as two.Result: nano antibody JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 expression product lysate all can by anti-camel IgG bis-anti-identify have and react more by force, and contrast bacterium and do not react.Figure 11.
Embodiment 8: recombinant expressed single domain antibodies with sjthe binding ability analysis of TGR albumen
The single domain antibodies albumen of purifying is transferred on NC film after SDS-PAGE, respectively with sjafter TGR reaction, then with anti- sjtGR mouse two anti-reflective should, then mark sheep anti-Mouse two with HRP and resists and carry out recognition reaction.Result: recombinant expressed JIPDYYNA-1, JIPDYYNA-2, JIPDYYNA-3 albumen all can be with sjtGR protein binding, being about 18-20kDa place at molecular weight has the band that significantly develops the color, and not with sjthe restructuring JIPDYYNA-1 protein band of TGR albumen test does not then develop the color.Figure 12.Show that restructuring JIPDYYNA-1, JIPDYYNA-2, JIPDYYNA-3 albumen all can be with sjtGR specific binding.
Embodiment 9: restructuring single domain antibodies pair sjtGR albumen thioredoxin reductase activity inhibition is analyzed
Principle: sjthe activity of the thioredoxin reductase (TR) of TGR can be deposited at reduzate NADPH and in case substrate DTNB is reduced to TNB, shows as reaction system solution and raises in the absorption value of 412nm.The present invention will sjtGR carries out enzymatic reaction after being combined respectively with recombinant expressed single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 of different mol ratio again, and after utilizing ultraviolet spectrophotometer to measure enzymatic reaction, whether the change of the 412nm absorption value of system is right to observe restructuring nano antibody sjthe TR enzymic activity of TGR is inhibited.
The reduction test of DTNB
1) reaction principle: 5-joins sulfo--bis--2-nitrobenzoic acid (DTNB) under reduzate NADPH exists situation, can quilt sjtGR is reduced to 5-sulfydryl-2-nitrobenzoic acid (TNB), and TNB is that 412nm place has maximum absorption peak at wavelength, and after there is lipase-catalyzed, reaction system can increase in the absorption value of 412nm.
TrxR
NADPH+H ++DTNBNADP ++2TNB
2) reaction system is as follows: EDTA5mM
Potassium phosphate buffer (pH7.4) 100mM
NADPH50μM
DTNB1.5mM
3) sample determination: this experiment is divided into blank group, control group and experimental group.Blank group gets the restructuring of 5 μ L sjtGR albumen (0.08mg/mL) mixes with 5 μ L potassium phosphate buffers (pH7.4), joining volume after left at room temperature reaction 15min is in the cuvette of 100 μ L, add 90 μ L reaction system mix reagents subsequently and start reaction, the increased value of Continuous Observation reaction initial rear front 1min inherent 412nm place absorption peak.Continuously tested 3 times also calculates enzymic activity, conduct of averaging respectively sjvalue during TGR100% enzyme activity.
Control group is then that the 0.08mg/mL restructuring SjTGR getting 5 μ L mixes containing the JIPDYYNA diluted protein solution of 0.7M urea with 5 μ L, joining volume after left at room temperature reaction 15min is in the cuvette of 100 μ L, add 90 μ L reaction system mix reagents subsequently and start reaction, the increased value of Continuous Observation reaction initial rear front 1min inherent 412nm place absorption peak.Continuously tested calculates enzymic activity 3 times respectively, and carries out with blank group enzymic activity tinspection statistics is analyzed, to judge that whether urea-containing diluted protein solution is right sjtGR enzyme is lived and is had an impact.
Experimental group is that the 0.08mg/mL getting 5 μ L recombinates SjTGR and 5 μ LJIPDYYNA-1, JIPDYYNA-2 or JIPDYYNA-3 albumen respectively with the mixed in molar ratio of 2:1/1:1/1:4/1:16, joining volume after left at room temperature reaction 15min is in the cuvette of 100 μ L, add 90 μ L reaction system mix reagents subsequently and start reaction, the increased value of Continuous Observation reaction initial rear front 1min inherent 412nm place absorption peak, calculates enzymic activity.All tests all repeat 3 times.And carry out with control group enzymic activity tinspection statistics is analyzed.
4) enzymic activity calculates: the enzymic activity of a unit is defined as the TNB being produced 2 μMs under 25 DEG C of conditions in 1min by NADPH.According to the absorbance of different time, OriginPro7.0 carries out fitting of a straight line, slope is initial velocity υ (△ A412/min).Calculation formula is as follows:
Thioredoxin reductase activity (μm olmin-1mg-1) in sample=
The specific absorbance (ε) using TNB during calculating is 13.6mM -1cm -1.
The TR activity of result: JIPDYYNA-1 to TGR has comparatively high inhibition effect, and when mol ratio is 1:1, the TR activity of TGR suppresses to reach maximum, and decline about 73.58%(table 3, Figure 13).Blank group compared with control group, enzyme live no difference of science of statistics ( p>0.05), experimental group with blank group, compared with control group, enzyme live that there were significant differences ( p<0.05), VHH54 and VHH67 is then all right under each concentration ratio sjtGR unrestraint effect (table 4,5, Figure 14,15), experimental group with blank group, compared with control group, enzymic activity no difference of science of statistics ( p>0.05).
SEQIDNO1
MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal
51015
ProArgGlySerHisMetSerTrpLeuLeuPheLeuGlnGlyVal
202530
ArgThrGlnThrProLeuValGluSerGlyGlyGlySerValGln
354045
ValGlyGlySerLeuArgLeuThrCysThrAlaProGlyAsnArg
505560
TyrAspThrMetAlaTrpPheArgGlnAlaProGlySerGlyArg
657075
GluArgValAlaAlaValTyrSerValAlaGlyIleProThrTyr
808590
AlaAspSerValLysGlyArgPheThrIleSerGlnAlaThrAsp
95100105
AlaLysThrLeuAsnLeuGlnMetThrAsnLeuIleProGlyAsp
110115120
ThrAlaMetTyrTyrCysAlaAlaGlnArgPheProCysGlyIle
125130135
ThrAlaAlaAspProArgAspTyrThrTyrTrpGlyGlnGlyThr
140145150
GlnValThrValSerSerGlyThrAsnGluValCysLys***
155160163
SEQIDNO2
MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal
51015
ProArgGlySerHisMetSerTrpLeuAlaLeuLeuGlnValVal
202530
GlnAlaGlnValGlnLeuValGluSerGlyGlyGlySerValGln
354045
GluGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyPheThr
505560
AsnSerArgProCysMetGlyTrpPheArgGlnAlaProGlyLys
657075
GluArgGluGlyValAlaThrIleSerGlnGlyGlyThrSerGln
808590
TyrTyrAlaGlySerValLysGlyArgPheThrIleSerArgAsn
95100105
AsnThrGluAspThrValTyrLeuLysMetAsnAsnLeuLysPro
110115120
GluAspThrAlaMetTyrTyrCysAlaThrLysArgAspCysLeu
125130135
AspLeuGlySerValGlyPheArgProValAlaTyrAsnTyrTrp
140145150
GlyGlnGlyThrGlnValThrValSerSerGlyThrAsnGluVal
155160165
CysLys***
167
SEQIDNO3
MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuVal
51015
ProArgGlySerHisMetSerTrpLeuLeuLeuGlnGlyValGln
202530
GlyGlnValGlnLeuThrGluSerGlyGlyGlySerValGlnAla
354045
GlyGlySerLeuArgLeuSerCysAlaHisSerThrLeuGlyAla
505560
AlaArgTyrCysLeuAlaTrpPheArgGlnValGluGlyGlnSer
657075
ArgGluTrpValAlaSerIleAsnProAlaAsnGlyAlaThrTyr
808590
TyrGluAspSerValLysGlyArgPheThrIleThrArgAspArg
95100105
AlaGluArgLysLeuPheLeuGlnLeuAsnThrValLysProGly
110115120
AspAlaAlaMetTyrTyrCysAlaAlaArgArgAspArgLeuGly
125130135
SerTyrCysAsnAlaHisGlyValAsnAspArgTyrValHisTrp
140145150
GlyGlnGlyThrGlnValThrValSerSerGlyThrAsnGluVal
155160165
CysLys***
167
SEQIDNO4
atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat60
atgtcctggctgctctttctacaaggtgtccggactcagacgccattggtggagtctggg120
ggaggctcggtgcaggtcggagggtctctgagactcacctgcacagcgcctggcaaccgt180
tacgacaccatggcctggttccgccaggctccaggatcggggcgcgagcgggtcgcggca240
gtttacagtgtcgcaggtatcccaacgtatgccgacagcgtgaagggccgattcaccatc300
tcccaagcaactgacgcgaagacgctcaatctgcaaatgacgaacttgatacctggggac360
actgccatgtactattgtgcggcacagcgctttccttgtgggataacagccgctgatcca420
cgagactatacatactggggccaggggacccaggtcaccgtctcctcaggaacgaatgaa480
gtatgcaagtag492
SEQIDNO5
atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat60
atgtcctggcttgctcttctacaagtggtccaggctcaggtgcagttggtggagtctggg120
ggaggctcggtgcaggaaggagggtctctgagactctcctgtgcagcctccggattcacc180
aatagtcgcccctgcatgggctggttccgccaggctccagggaaggagcgcgagggggtt240
gcgactatttctcaagggggtacgagtcaatactatgccggctctgtgaagggccgattc300
accatctcccgtaacaacactgaggacacggtgtatctaaagatgaacaacctgaaacct360
gaggacactgccatgtactactgcgcgacaaaaagggactgcctcgaccttggtagtgtt420
gggttccgacctgtcgcgtataattactggggccaggggacccaggtcaccgtctcctca480
ggaacgaatgaagtatgcaagtag504
SEQIDNO6
atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat60
atgtcctggctgcttctacaaggtgtccagggacaggtacagttaacggagtctggggga120
ggctcggtgcaggctggaggatctctgagactctcctgtgcacactccacactcggcgcc180
gcgcgctactgtttggcctggttccgccaggtcgaaggacaatcgcgcgagtgggtcgca240
tcaattaatcctgcgaatggggccacatattatgaagactccgtgaagggccggttcacc300
atcacccgggacagggccgagaggaagttgtttctccaactgaacacagtaaaacctggg360
gacgctgcgatgtactactgcgcggcgagaagggaccgtcttggtagttactgcaatgcg420
catggcgtcaatgatcgatatgtccactggggccaggggacccaggtcaccgtctcttca480
ggaacgaatgaagtatgcaagtag504
SEQIDNO7
MetProProIleAspGlyThrSerGlnTrpLeuGlnArgThrIle
51015
GluSerAlaAlaValIleValPheSerLysThrThrCysProPhe
202530
CysLysLysLeuLysAspValLeuAlaGluAlaLysIleLysHis
354045
AlaThrIleGluLeuAspGlnLeuSerAsnGlySerValIleGln
505560
LysAlaLeuSerAsnPheSerLysIleGluThrValProGlnMet
657075
PheValArgGlyLysPheIleGlyAspSerLysAlaValLeuAsn
808590
TyrHisAsnAsnAsnGlnLeuGlnAlaIleValAsnGluAsnLys
95100105
TyrAspTyrAspLeuIleIleIleGlyGlyGlySerGlyGlyLeu
110115120
AlaAlaGlyLysGluAlaAlaLysTyrGlyAlaLysThrAlaVal
125130135
LeuAspTyrValGluProThrProMetGlyThrThrTrpGlyLeu
140145150
GlyGlyThrCysValAsnValGlyCysIleProLysLysLeuMet
155160165
HisGlnAlaGlyLeuLeuSerHisSerLeuGluAspAlaGlnHis
170175180
PheGlyTrpSerLeuAspLysSerLysIleSerHisAspTrpSer
185190195
ThrMetValGluGlyValGlnSerHisIleGlySerLeuAsnTrp
200205210
GlyTyrLysValSerLeuArgAspAsnAlaValThrTyrLeuAsn
215220225
AlaArgGlyMetLeuLeuSerProHisGluValGlnIleThrGlu
230235240
LysAsnLysLysValSerThrIleThrGlyAsnLysIleIleLeu
245250255
AlaThrGlyGluArgProLysTyrProGluIleProGlyAlaIle
260265270
GluTyrGlyIleThrSerAspAspLeuPheSerLeuProTyrPhe
275280285
ProGlyLysThrLeuValValGlyAlaSerTyrValAlaLeuGlu
290295300
CysAlaGlyPheLeuAlaSerLeuGlyGlyAspValThrValMet
305310315
ValArgSerIleLeuLeuArgGlyPheAspGlnGlnMetAlaGlu
320325330
LysValGlyAspTyrMetGluAsnHisGlyValLysPheAlaLys
335340345
LeuCysValProAspGluIleThrGlnLeuLysProValAspThr
350355360
GluAsnAsnLysProGlyLeuLeuLeuValLysGlyHisTyrThr
365370375
AspGlyLysLysPheGluGluGluPheGluThrValIlePheAla
380385390
ValGlyArgGluProGlnLeuSerLysLeuAsnCysGluAlaVal
395400405
GlyValLysLeuAspLysAsnGlyArgValValCysSerAspAsp
410415420
GluGlnThrThrValSerAsnIleTyrAlaIleGlyAspIleAsn
425430435
AlaGlyLysProGlnLeuThrProValAlaIleHisAlaGlyArg
440445450
TyrLeuAlaArgArgLeuPheAlaGlyAlaThrGluLeuThrAsp
455460465
TyrSerAsnValAlaThrThrValPheThrProLeuGluTyrGly
470475480
AlaCysGlyLeuSerGluGluAspAlaIleGluLysTyrGlyAsp
485490495
AsnAspIleGluValTyrHisSerHisPheLysProLeuGluTrp
500505510
ThrValAlaHisArgGluAspAsnValCysTyrMetLysLeuVal
515520525
CysArgIleSerAspAsnMetArgValLeuGlyLeuHisValLeu
530535540
GlyProAsnAlaGlyGluIleThrGlnGlyTyrAlaValAlaIle
545550555
LysMetGlyAlaThrLysGluAspPheAspArgThrIleGlyIle
560565570
HisProThrCysSerGluThrPheThrThrLeuHisValThrLys
575580585
ArgSerGlyGlySerAlaAlaValThrGlyCys***
590595596
SEQIDNO8
atgcctccgattgatggaacatcccagtggttgcagaggactatcgaatcagcggcggta60
atcgtctttagcaaaacaacttgtccattttgcaaaaagctaaaggatgttttagctgaa120
gcaaagattaaacacgctacaattgaactggatcaattatccaatggttcggttattcaa180
aaggcattatctaacttctctaaaattgaaacagtcccgcaaatgtttgttagaggcaag240
ttcattggcgattctaaagcagtacttaattaccacaataataatcaattgcaggcgatc300
gtcaacgaaaataagtatgactatgatctgataatcatcggtggaggatctggtggactc360
gctgctggaaaggaggcagccaaatacggcgcaaagacagctgttctggattatgtagaa420
ccgactccaatgggtactacttggggattaggtggaacctgtgttaacgttggatgtatc480
cctaaaaaattaatgcaccaagctggactcttaagtcattctttggaagatgcccaacat540
ttcggttggagcttggataaatcaaaaatttcccatgattggtcaactatggttgaagga600
gttcagagtcacatcggttctttaaattggggctataaagtttcactaagagataatgcg660
gttacgtatcttaatgctcgtgggatgctattaagtcctcatgaggttcagattacagaa720
aagaataaaaaagtatccacaataactggaaataaaatcatcttagctactggcgagcgt780
ccaaaatacccagaaatacctggagcaatcgaatatgggattacaagtgatgatttgttt840
tccttaccatacttcccgggcaaaacactggtcgttggagcgagctatgttgcattggaa900
tgtgctggttttcttgccagtttgggcggtgatgttactgttatggttcgttccattttg960
cttcgtggtttcgatcaacaaatggctgagaaggttggcgattatatggaaaatcatgga1020
gtcaagttcgcaaagttgtgtgtaccagacgagattacacagttgaaaccggtagatact1080
gagaataacaaacctggactcctgcttgttaagggtcattatactgatggtaagaagttt1140
gaagaagaatttgaaacggtcattttcgctgttggtcgtgaaccacaattatcgaagctt1200
aattgtgaagctgtcggtgttaaactagataagaatggtcgggttgtatgctcagatgat1260
gaacaaactacagtcagtaacatttatgccattggagatataaacgctggaaaaccacag1320
ttaactccagtggctattcatgctggacgttatttggctagacggttattcgctggtgca1380
actgaactgactgactattccaatgttgctacgactgttttcactccattagaatatggc1440
gcttgtggactgagtgaagaggatgcaattgaaaagtatggtgataatgatattgaggta1500
tatcattcacatttcaaacctttagaatggactgttgctcatcgtgaagataatgtttgt1560
tacatgaaacttgtttgccgtatatctgataacatgcgtgtactgggtctacatgtttta1620
ggacctaatgcaggtgaaataacacaggggtatgcagttgcaattaaaatgggtgcaact1680
aaagaagattttgatcgtaccataggaattcacccaacttgttctgagacatttacaacg1740
ttgcatgtaaccaagagatctgggggctctgcagcggtaaccggttgctga1791

Claims (1)

1. single domain antibodies JIPDYYNA-1, JIPDYYNA-2 and JIPDYYNA-3 of three strain anti schistosoma Trx glutathione reductase SjTGR albumen, it is characterized in that this three strains single domain antibodies can be combined with SjTGR protein-specific, and the enzymic activity of SjTGR albumen can be suppressed, for the immunology application of the schistosomicide treatment exploitation of new drug and schistosomicide targeted therapeutic carrier, methods for the treatment of or other immunodetection based on this three strains single domain antibodies, immunologic intervention and immunotherapy;
The nucleotides sequence of the encoding gene of described single domain antibodies JIPDYYNA-1 molecule is classified as SEQIDNO:4; The nucleotides sequence of the encoding gene of described single domain antibodies JIPDYYNA-2 molecule is classified as SEQIDNO:5; The nucleotides sequence of the encoding gene of described single domain antibodies JIPDYYNA-3 molecule is classified as SEQIDNO:6.
CN201410285116.4A 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof Active CN104047061B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410285116.4A CN104047061B (en) 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410285116.4A CN104047061B (en) 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof

Publications (2)

Publication Number Publication Date
CN104047061A CN104047061A (en) 2014-09-17
CN104047061B true CN104047061B (en) 2016-03-23

Family

ID=51500439

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410285116.4A Active CN104047061B (en) 2014-07-29 2014-07-29 Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof

Country Status (1)

Country Link
CN (1) CN104047061B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106645352A (en) * 2017-01-22 2017-05-10 浙江省医学科学院 Nano-antibody composition for detecting schistosome, immunosensor, preparation method of immunosensor and application of nano-antibody composition

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108627469B (en) * 2017-03-21 2021-04-02 凯熙医药（武汉）股份有限公司 Thioredoxin reductase activity detection method for cooperative detection equipment

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102336816A (en) * 2011-10-09 2012-02-01 江苏省血吸虫病防治研究所 Schistosoma japonicum thioredoxin glutathione reductase (SjTGR) functional inhibitory peptides and application thereof
CN103396482A (en) * 2013-05-17 2013-11-20 东南大学 Prealbumin nano-antibody, and coding sequence and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102336816A (en) * 2011-10-09 2012-02-01 江苏省血吸虫病防治研究所 Schistosoma japonicum thioredoxin glutathione reductase (SjTGR) functional inhibitory peptides and application thereof
CN103396482A (en) * 2013-05-17 2013-11-20 东南大学 Prealbumin nano-antibody, and coding sequence and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Thioredoxin Glutathione Reductase as a Novel Drug Target: Evidence fromSchistosoma japonicum;LiJun Song et al;《PLOS ONE》;20120229;第7卷(第2期);全文 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106645352A (en) * 2017-01-22 2017-05-10 浙江省医学科学院 Nano-antibody composition for detecting schistosome, immunosensor, preparation method of immunosensor and application of nano-antibody composition

Also Published As

Publication number Publication date
CN104047061A (en) 2014-09-17

Similar Documents

Publication Publication Date Title
CN104086652B (en) Resisting O-type foot and mouth disease virus specificity single domain antibody and recombinant expression carrier thereof
CN103665152B (en) Canine parvovirus single domain antibody and its preparation method and application
CN108299561A (en) A kind of PD-1 nano antibodies and its cloning expression method and application
CN102875674B (en) Anti-tetanotoxin antibody, and preparation method and application thereof
CN104861049B (en) Acinetobacter bauamnnii 1A1S_1969 recombinant proteins and its preparation method and application
CN103319595A (en) Preparation method and application of anti-human alpha fetoprotein (AFP) single-chain antibody and fusion antigen peptide
CN104047061B (en) Anti schistosoma Trx glutathione reductase Sj TGR single domain antibodies and preparation method thereof
CN109897110A (en) Nano antibody and preparation method thereof
CN109160948A (en) A kind of hepatitis B surface antigen nano antibody and nucleic acid molecules and application
CN110590942B (en) Fully human monoclonal antibody for neutralizing enterovirus 71 and application thereof
CN104610451A (en) Nano antibody for aflatoxin B1, and coding sequence and application thereof
CN101597334A (en) Monoclonal antibody of bluetongue virus (BTV) and preparation method and application
CN108126190A (en) The preparation and application of mycobacteriophage lyases Lysin-Guo1
CN102174106A (en) Anti-Met humanized Fab, anti-Met humanized Fab and doxorubicin conjugate and preparation method and application of anti-Met humanized Fab and doxorubicin conjugate
CN104678097B (en) A kind of mycobacterium tuberculosis combined antigen for diagnosis of pulmonary tuberculosis
CN114685664B (en) Single-domain antibody for resisting human B lymphocyte surface antigen CD20 and application thereof
CN110423273B (en) Anti-pseudomonas aeruginosa exotoxin A nano antibody and application thereof
CN103374572A (en) Sequence of aptamer of hepatoma cell and application thereof
CN105504053A (en) Specific HCA (heavy chain antibody) for PEDV (porcine epidemic diarrhea virus) M protein
CN109206519A (en) The nano antibody and nucleic acid molecules of a kind of antiurease B subunit and application
CN103319593B (en) Anti StxII monoclonal antibody
CN100441689C (en) EHEC 0157 shiga-like toxin IIA resisting subunit monoclonal antibody 5F3 light and heavy chain variable region gene and its application
CN107041950A (en) A kind of Echinococcus moltilocularis polyepitope vaccines LTB AE design, preparation method and application
CN103408667B (en) Cystatin C nano antibody and coding sequence thereof
CN102477096B (en) Human creatine kinase single-chain antibody with molecular chaperone function

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant