CN102260352B - Targeted interleukin fusion protein as well as preparation method thereof and application thereof - Google Patents
Targeted interleukin fusion protein as well as preparation method thereof and application thereof Download PDFInfo
- Publication number
- CN102260352B CN102260352B CN2010101855032A CN201010185503A CN102260352B CN 102260352 B CN102260352 B CN 102260352B CN 2010101855032 A CN2010101855032 A CN 2010101855032A CN 201010185503 A CN201010185503 A CN 201010185503A CN 102260352 B CN102260352 B CN 102260352B
- Authority
- CN
- China
- Prior art keywords
- fusion rotein
- cell
- fusion protein
- interleukin
- dna molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
- A61K38/2013—IL-2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/55—IL-2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/655—Somatostatins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Endocrinology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology, and in particular provides a targeted interleukin fusion protein, a DNA (Deoxyribose Nucleic Acid) molecule for encoding the fusion protein, a carrier containing the DNA sequence, a host cell or a transgenic animal containing the carrier as well as a preparation method and an application of the fusion protein. The fusion protein provided by the invention comprises a targeted connection area and an interleukin from an end N to an end C, wherein the connection area which can be formed by no more than 10 amino acids according to the situation is used for connecting the targeted combining area and the interleukin. As a preference, the target combining area is homologous with somatostatin. It is shown in an experiment that the interleukin concentration of the targeted tissue can be increased by using the fusion protein, the interleukin concentrations of other tissues can be also reduced, the side effect of 1L-2 can be reduced while the curative effect is enhanced, and the fusion protein can be used for treating tumors and has wide application prospects.
Description
Technical field
The present invention relates to biological field, be specifically related to interleukin 8 plain fusion protein and preparation and its application at field of medicaments.
Background technology
The method of traditional treatment cancer has operative treatment, chemotherapy, radiotherapy and hormonotherapy etc.In recent years, the exploitation selectively acting has become important research exploitation direction in efficient, the low toxicity of specific target spot, the antibumor molecules targeted drug of high specificity.Immunotherapy of tumors has become one of most active antineoplastic target research field, and monoclonal antibody, adoptive cellular immunotherapy, tumor vaccine, cytokine therapy have demonstrated the complementarity with traditional remedies.
Interleukin II (IL-2) is a kind of interleukin-well known in the art, be found in 1976, the people such as Morgan stimulate normal human lymphocyte with the homo agglutinin of plant, find that it can produce a kind of cytokine that can selectivity promotes the T lymphocyte growth, it must with IL-2 receptors bind competence exertion biological effect.IL-2 is multiple biological function cytokine, but the non-specific killing ability of the differentiation of irritation cell poison T lymphocyte, activating cells poison T lymphocyte, natural killer cell, eosinophil, mastocyte, also can strengthen antibody-secreting and the propagation of bone-marrow-derived lymphocyte.Therefore also be mainly used in clinically the systemic immunity that immunological adjuvant is transferred body, reach the purpose that assisting therapy is controlled tumour.
As the interleukin-molecule of first separated purifying, U.S. Cetus company's exploit person eighties source recombinant il-2 is used for the treatment of cancer, until 1993, IL-2 is used for the treatment of kidney and melanoma by the FDA approval; At present the IL-2 heavy dose that also goes through is used for the treatment of HIV.Clinical trial shows the efficient low of IL-2 single therapy cancer, and side effect is large.High-dose therapy melanomatous objective efficient be 5-27%, wherein only have patient's state of an illness of 0-4% to alleviate fully.The side effect of IL-2 is large, and patient produces the series reaction such as the body fluid storage is stayed, diarrhoea, hypopiesia, the small portion death, and many other histogenic immunity overreactions of whole body with the non-treatment focus of IL-2 initiation of these toxic side effect are relevant.
Be directed to the limitation of the clinical use of IL-2, the main direction of IL-2 pharmaceutical grade protein research is to reduce drug side effect, raising drug effect, prolong drug transformation period at present.Strategy comprises that mainly the polyoxyethylene glycol (PEG) of IL-2 modifies, with human serum albumin (HSA), merges prolong half-life, glycosylation modified raising IL-2 stability, with monoclonal antibody, merge drug targeting is arrived to specific target spot (as tumour cell), with other albumen (as immune-regulating factor), merge and produce drug combination effect etc.In clinical experiment, the IL-2 that PEG modifies compares with IL-2, is not significantly improved the transformation period and efficient, by the FDA approval, is not used for cancer therapy so far.Human GenomeSciences company has developed HSA-IL-2 fusion rotein Albuleukin, and bring up to 6 hour from 19 minutes of IL-2 the plasma half-life of intravenous injection Albuleukin, entered at present the second stage of clinical experiment.The 3rd Thr of natural IL-2 is by glycosyl modified, the glycosylation ground means of present IL-2 are divided into eukaryotic cell expression and synthetic glycosylation small peptide is connected two kinds of strategies with IL-2 albumen, Symansis company employment 293 cell expressing hcxIL-2 are selling on the market, domestic have several laboratories all to develop the glycosylated IL-2 of yeast expression, also is at present the development phase.At present Merck & Co., Inc. will resist antibody drug EMD273066 (hu14.18-IL-2) that the C end of Sphingolipids,sialo GD2 merges IL-2 to be used for the treatment of melanoma to have completed the I phase clinical, result shows in 33 routine patients, 8 routine stable disease.Without 4 grades of toxic reactions (death), occur, but still find that there is 3 grades of toxic reactions such as ypotension, histanoxia.The research that IL-2 is melted into to other antibody (as anti-her2antibody, anti-her3, IgG3 etc.) is also arranged in addition, to strengthen T cell that IL-2 induces to the tumor cytotoxicity specificity.Other IL-2 fusion rotein medicines, as Aerolysin-IL-2, IL-6-IL-2, GCSF-IL-2, recombinant human alpha prothymosin-interleukin-22 etc., the effect of generation drug combination.
The problem that may exist for the interleukin-2 that is coupled with biomacromolecule/merges is, although being multiplied of Increased Plasma Half-life but drug molecule amount makes it more be difficult to pass physiologic barrier and arrives target tissue, especially poor to the wetting property of large-scale solid tumor, make it be difficult to pass physiologic barrier and arrive tumor locus.The not high meeting of the specificity of targeted drug and affinity causes targeted drug injuring normal cell before the arrival target tissue, has consumed drug effect.
For the problems referred to above, at first will select the tumour antigen that specificity is high is target spot, also to targeted drug, carry out appropriate design by protein engineering in addition, reduce molecular mass, improve avidity and specificity, increase medicine in the concentration of tumor tissues and reduce the distribution in healthy tissues, reducing Normocellular toxic side effect.Can select main target in target short peptide and the non-antibody albumen of endothelial cells in tumor neogenetic blood vessels and tumour cell, wherein have for the NGR of endothelial cells in tumor neogenetic blood vessels surface molecular aminopeptidase N and the RGD of integrin (integrins α v β 3).Some utilizes the developing drugs of above-mentioned relevant targeting peptides, has successfully entered clinical experiment.As Modmed company exploitation ARENEGYR, just be NGR fusion tumour necrosis factor (NGR-hTNF α), being used for the treatment of the rectum cancer, liver cancer, mesothelioma, to have entered the II phase clinical.It is clinical that GE company exploitation also enters first phase for the medicine 18F-AH111585 (radiolabeled RGD) of diagnosing tumor.
Somatostatin (Somatostatin, SST) and somatostatin analogue such as vapreotide (Vapreotide) and Lanreotide (Lanreotide) etc. as single medicine respectively successfully for the clinical treatment of cardiovascular disorder (cerebral thrombosis etc.) and carcinoid, glucagonoma of pancreas, gastrinoma etc.Somatostatin receptor (SSTR) finds to be expressed in kinds of tumor cells, and reasonableness and the feasibility that targeting peptides is selected fully supported in these researchs.
Summary of the invention
The purpose of this invention is to provide a kind of targeting interleukin fusion rotein, this fusion rotein can some cell of specific binding particularly tumor tissue cell or its new vessel endotheliocyte, the significant concentration of interleukin-in target tissue that increases, reduce its concentration at its hetero-organization, thereby the raising result for the treatment of, reduce toxic side effect.
In order to realize the foregoing invention purpose, the present invention by the following technical solutions:
A kind of fusion rotein, hold the target land that comprises (1) specific binding tumour cell or tumor vascular endothelial cell to the C end from N; (2) interleukin-.
According to circumstances, fusion rotein of the present invention can be by no more than 10 joining regions that amino acid forms, be used to connecting described target land and interleukin-.
In one embodiment of the invention, there are three amino acid joining region: Gly-Gly-Serine-(GGS), 6 amino acid are arranged in another embodiment: Gly-Gly-Serine-Gly-Gly-Serine (GGSGGS).
As preferably, in fusion rotein of the present invention, interleukin-is Human interleukin-2, has the aminoacid sequence as SEQ ID NO:1.
As preferably, behaviour source, target land aminoacid sequence in fusion rotein of the present invention.
More preferably, described target land and Somatostatin homology, aminoacid sequence and the Somatostatin homology of described target land are not less than 60%.
In embodiment, the present invention specifically provides a kind of fusion rotein, the aminoacid sequence of its target land is FCYWKSCT, as shown in SEQ ID NO:2, or for the aminoacid sequence shown in SEQ IDNO.2 has 80% consistence at least through replacing, lacking or add one or several amino acid derived aminoacid sequence with shown in SEQ ID NO.2, and has the activity of specific combination tumour cell or tumor vascular endothelial cell.
In one embodiment, in fusion rotein of the present invention, the target land can be to comprise being no less than 3 but no more than 50 amino acid whose aminoacid sequences, preferred sequence contains no more than 15 aminoacid sequences of Somatostatin homology, in a preferred embodiment, the target land of fusion rotein of the present invention contains the described aminoacid sequence just like SEQ ID NO:2, its N-terminal can, with the methionine(Met) of the initiator codon of escherichia coli expression translation, may be excised by heterogeneity in translation process.
As preferably, will the target land as shown in SEQ ID NO:2 in tyrosine by arbitrary amino acid substitution that contains phenyl ring or heterocycle, preferably replace with phenylalanine or tryptophane, do not affect its targeting.
As preferably, will the target land as shown in SEQ ID NO:2 in Serine by arbitrary amino acid substitution or disappearance that contains hydroxyl, preferably replace with Threonine, do not affect its targeting.
In a preferred embodiment, the invention provides a kind of concrete fusion rotein, contain the described aminoacid sequence just like SEQ IDD NO:3, be denoted as SIL.In order to make fused protein, be convenient to purifying, can connect the upper amino acid label at amino (N) end or carboxyl (C) end, include but not limited to poly Histidine (Poly-His is generally 6 Histidines), poly arginine (Poly-Arg is generally 5-6 arginine) etc.
Another aspect of the present invention also provides the DNA molecular of the fusion rotein of the present invention of encoding.Due to the degeneracy of codon, can there is the nucleotide sequence of a variety of specific proteins of the present invention of can encoding.In one embodiment, the invention provides to encode contains the DNA molecular just like the fusion rotein of the described aminoacid sequence of SEQ IDD NO:3, and its nucleotide sequence is as shown in SEQ IDD NO:4.
In order to produce fusion rotein of the present invention, the DNA molecular of encoding fusion protein is integrated in expression cassette, and expression cassette is inserted into suitable expression vector subsequently.Then, this expression vector is changed over to host cell or animal for expression of recombinant proteins.
Expression cassette comprises following content at least: can the encode DNA molecular of fusion rotein of the present invention of (1) transcription initiation region, (2), this is transcribed is to carry out under the regulation and control at transcription initiation region, and (3) transcription pausing district.
According to the difference of the host cell for protein expression, transcription initiation region and transcription pausing district can be natural existence or artificial constructed sequence, and this sequence is suitable for the genetic transcription in eucaryon or prokaryotic cell prokaryocyte.This type of sequence is well known in the art.The suitable DNA sheet that contains transcriptional initiation sequence is connected with the DNA fragmentation of encoding fusion protein with the suitable DNA fragmentation that contains the transcription pausing district.This method of attachment is well known in the art, such as, select suitable digestion with restriction enzyme and connection.
The present invention further provides has recombinated the encode expression vector of DNA molecular of fusion rotein of the present invention and cell and transgenic animal of expressing described fusion rotein.Described expression vector preferred plasmid or virus.Described cell can be mammalian cell, insect cell, yeast or bacterium.Transgenic animal can be transgenic sheeps, ox, etc.
In an embodiment of the present invention, a kind of intestinal bacteria of DNA molecular of fusion rotein of the present invention of encoding of having recombinated specifically are provided, described intestinal bacteria are deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on May 24th, 2010, and deposit number is CGMCC No.3867.
In addition, the present invention also provides the production method of described fusion rotein, comprise the following steps: cell or the transgenic animal of the DNA molecular that contains the fusion rotein of the present invention of encoding are provided, make this cell or transgenic animal express described fusion rotein and separate described fusion rotein.
Experiment shows, fusion rotein of the present invention can be by activating NK cell, CTL cell, LAK cell at tumor tissues/position, improve the ability of immunity system killing tumor cell, therefore the present invention also provides the application of described fusion rotein, namely is used for the treatment of the purposes in the medicine of the disorders such as cancers that disease that cell hyperplasia causes or preparation treatment cell hyperplasia cause.
Biological preservation explanation
Classification And Nomenclature: colon bacillus, Escherichia coli. is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on May 24th, 2010, address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.3867.
The accompanying drawing explanation:
Fig. 1 shows fusion rotein structural representation of the present invention.
A: target land; B: joining region; C: Human interleukin-2.
Fig. 2 shows the SDS-PAGE qualification result after fusion protein S IL expression and purification of the present invention.
Swimming lane 1: molecular weight Marker; Be followed successively by from top to bottom 97.0kDa, 66.0kDa, 45.0kDa, 30.0kDa, 20.1kDa, 14.4kDa.
Swimming lane 2: the Host Strains lysate of expressed fusion protein;
Swimming lane 3: the inclusion body of final washing;
Swimming lane 4: through the target protein of Ni Sepharose High Performance protein affinity purification.
Fig. 3 shows the SDS-PAGE result of fusion protein S IL renaturation of the present invention.
A:15%SDS-PAGE analyzes, O: non-reduced electrophoresis;
M: molecular weight Marker is followed successively by 97.0kDa, 66.0kDa, 43.0kDa, 30.0kDa, 20.1kDa, 14.4kDa from top to bottom;
R:SIL reduces electrophoresis;
Fig. 4 shows fusion protein S IL carbon 18 RP-HPLC analysis charts (C18RP-HPLC) of the present invention, chromatography column: ZORBA 300SB-C185um, 4.6*250mm; Detect wavelength: 280nm; Purity: 96.7%.
Fig. 5 fusion protein S IL of the present invention targeting is in conjunction with experimental result.
Fig. 6 shows after fusion protein S IL of the present invention is in conjunction with different target cells to be affected the CTLL-2 cell proliferation rate.
Fig. 7 shows fusion protein S IL high dosage of the present invention and low dosage and IL-2 anti-tumor in vivo experiment comparing result.
Fig. 8 shows that fusion protein S IL of the present invention and IL-2 are to the contrast of inoculation H22 kunming mice increase in life span.
Embodiment:
The invention discloses a kind of interleukin 8 plain fusion protein and preparation and its application at field of medicaments, those skilled in the art can use for reference this paper content, suitably improve processing parameter and realize.Special needs to be pointed out is, all similarly replace and change apparent to those skilled in the art, and they all are deemed to be included in the present invention.Product of the present invention, method and application are described by preferred embodiment, the related personnel obviously can change methods and applications as herein described or suitably change and combination within not breaking away from content of the present invention, spirit and scope, realize and apply the technology of the present invention.
According to the present invention, a kind of fusion rotein of interleukin-of targeting, hold the target land that comprises (1) specific binding tumour cell or tumor vascular endothelial cell to the C end from N; (2) no more than 10 amino acid whose joining regions according to circumstances can be arranged; (3) interleukin-aminoacid sequence
In one embodiment, in fusion rotein of the present invention, the target land can be to comprise being no less than 3 but no more than 50 amino acid whose aminoacid sequences, preferred sequence contains no more than 15 aminoacid sequences of Somatostatin homology, in a preferred embodiment, the target land of fusion rotein of the present invention contains the described aminoacid sequence just like SEQ ID NO:2, wherein N end can, with the methionine(Met) of the initiator codon translation of escherichia coli expression, may be excised by heterogeneity in translation process; As preferably, will in the target land, tyrosine to be by arbitrary amino acid substitution that contains phenyl ring or heterocycle as shown in SEQ ID NO:2, preferred phenylalanine or tryptophane, do not affect its targeting.
As preferably, will be as shown in SEQ ID NO:2 in the target land tyrosine by arbitrary amino acid substitution or disappearance that contains hydroxyl, be preferably Threonine, do not affect its targeting.
The target land of fusion rotein of the present invention can directly connect together by peptide bond or by joining region with interleukin-.Depend on the needs, joining region can have 2 to 10 amino acid to connect target land and interleukin II.
In one embodiment, there are three amino acid joining region: Gly-Gly-Serine-(GGS), 6 amino acid Gly-Gly-Serine-Gly-Gly-Serines (GGSGGS) are arranged in another embodiment.
In a preferred embodiment, fusion rotein of the present invention contains the described aminoacid sequence just like SEQ IDDNO:4, is denoted as SIL.
In a preferred embodiment, fusion rotein of the present invention contains the described aminoacid sequence just like SEQ IDDNO:3.
Another aspect of the present invention also provides the DNA molecular of the above-mentioned fusion rotein of code book invention.Due to the degeneracy of codon, can there is the nucleotide sequence of a variety of specific proteins of the present invention of can encoding.In one embodiment, the invention provides to encode contains the DNA molecular just like the fusion rotein of the described aminoacid sequence of SEQ IDD NO:3, and its nucleotide sequence is as shown in SEQ IDD NO:4.
In order to produce fusion rotein of the present invention, the DNA molecular of encoding fusion protein is integrated in expression cassette, and expression cassette is inserted into suitable expression vector subsequently.Then, this expression vector is changed over to host cell or animal for expression of recombinant proteins.
Expression cassette comprises following content at least: can the encode DNA molecular of fusion rotein of the present invention of (1) transcription initiation region, (2), this is transcribed is to carry out under the regulation and control at transcription initiation region, and (3) transcription pausing district.
According to the difference of the host cell for protein expression, transcription initiation region and transcription pausing district can be natural existence or artificial constructed sequence, and this sequence is suitable for the genetic transcription in eucaryon or prokaryotic cell prokaryocyte.This type of sequence is well known in the art.The suitable DNA sheet that contains transcriptional initiation sequence is connected with the DNA fragmentation of encoding fusion protein with the suitable DNA fragmentation that contains the transcription pausing district.This method of attachment is well known in the art, such as, select suitable digestion with restriction enzyme and connection.
Expression cassette can integrated insertion expression vector, and this expression vector is changed over to host cell or animal subsequently.Generally, expression vector also will comprise the replication initiation sequence, and selection markers, and for example, for the protein expression of bacterium, plasmid is a kind of carrier on way of great use.Arranged a variety of well known can comprising for the plasmid vector of this purpose in the art, but be not limited only to, pET15b, pET22b, pET25b, pET28b etc.If carry out recombinant expressed fusion rotein by yeast cell, Yeast expression carrier, such as pPIC9, pAO815, pPICZ etc., can be used as expression vector.If carry out protein expression by mammalian cell, a lot of suitable expression of recombinant proteins carriers are also arranged.For the DNA sequence dna that the expression vector of mammalian cell expression albumen comprises, need to be suitable for integrating Insertion Into Host Cell karyomit(e) in the homologous recombination mode.Mammalian cell expression vector, such as pcDNA3.1, pSI etc.For by animal, carrying out expressed fusion protein, for the production of the technique means of the transgenic animal that contain expression cassette (transgenic sheep, ox, etc.), well known in the art.Such as pBLG etc., can be used as the carrier that transgenic animal are expressed.
After obtaining the host cell or transgenic animal that transform, can under the condition that is suitable for expression fusion rotein of the present invention, give expression to fusion rotein.Difference by its physico-chemical property and other characteristic is used various separation method separation and purification fusion roteins.These methods are well-known to those skilled in the art, such as: conventional sex change renaturation process, the combination of the conventional purification process such as centrifugal, ultrasonication, ultrafiltration membrance filter, metal affinity chromatography, ion exchange chromatography, gel permeation chromatography, dialysis, high performance liquid chromatography and these methods.
Fusion rotein of the present invention is by activating at tumor tissues/position the ability that NK cell, CTL cell, LAK cell etc. improve local organization and/or organ immunity system killing tumor cell.Another aspect of the present invention also provides the medicinal use of described fusion rotein, maybe can produce the medicine that is used for the treatment of a kind of disease.
Below in conjunction with embodiment, further set forth the present invention.
Embodiment 1. is be used to the structure of the interleukin-22 fusion rotein plasmid of expressing Somatostatin homology targeting peptides of the present invention
N-terminal and N-terminal aminoacid sequence and the additional target land amino acid of N-terminal to be added based on fusion rotein, design and synthesize pair of primers, and from people's Liver cDNA Library, increasing, obtain the DNA sequence dna of encoding human interleukin II (IL-2) with polymerase chain reaction (PCR) technology, also directly the DNA sequence dna of composite coding human interleukin-12 (C125S) is as template, and the pair of primers of design is:
5 upstream primers:
CATATGTTCTGTTTCTGGAAGACGTGCACCGGCGGTAGCGCACCTAC (as shown in SEQ ID NO:5)
Wherein contain successively NdeI site: CATATG, comprise the target land encoding sequence of 24 Nucleotide: TTCTGTTTCTGGAAGACGTGCACC, link zone sequence: GGCGGT with and subsequent interleukin II anneal sequence: AGCGCACCTAC;
3 (downstream) primer:
CAACACTGACTCACCATCACCATCACCATTGAAGCTT (as shown in SEQID NO:6)
Wherein contain successively anneal sequence: CAACACTGACT, histidine-tagged sequence: CACCATCACCATCACCAT, terminator codon TGA and subsequent HindIII site.
((toolenzyme is all purchased from Takara company with NdeI and HindIII enzyme, to cut pcr amplification product and pET25b empty plasmid, plasmid is purchased from Novage company), above-mentioned endonuclease bamhi all reclaims the fragment of corresponding size with sepharose, with the T4DNA ligase enzyme, connect each fragment, the recombinant plasmid of gained is the expression vector of interleukin 8 plain fusion protein, called after pET-S-IL.The fusion rotein structure as shown in Figure 1.
At first the ligation mixture is transformed to intestinal bacteria XL-1Blue, in containing the substratum of penicillin, after incubated overnight, select positive bacterium colony and therefrom prepare in a large number DNA, through DNA sequence analysis, its nucleotide sequence is as shown in SEQ ID NO:4.
After further confirming the sequence exactness, by this recombinant plasmid transformed in competence e. coli bl21 (DE3) bacterial strain (Novagen) that carries the T7 promoter gene, be the engineering bacteria of expressing corresponding protein, called after SIL-BL21, this project bacterium Classification And Nomenclature: colon bacillus, Escherichia coli. is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on May 24th, 2010, address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.3867.
Embodiment 2: the expression and purification of fusion rotein of the present invention
The e. coli bl21 that recombinant plasmid pET-S-IL transforms is cloned to cultivation (37 ℃) in the culturing bottle that is added in the LB substratum, treat that bacterial density reaches OD600 ≈ 4-6, by inoculum size 5-10%, carry out the 5L fermentor cultivation, treat OD600 ≈ 10-20, in substratum, add 0.5-1mM isopropyl-β-D-thiogalactoside(IPTG) (IPTG) to carry out abduction delivering, to inducing rear OD600 no longer to increase lower tank, with 10,000g * (15 minutes) centrifugal results thalline.
The thalline of results is resuspended in 3M urea 100mM phosphoric acid 20mM Tris pH8.0 damping fluid (buffer), and room temperature was placed 1 hour, and by cell supersound process 3 times, the centrifugal collection inclusion body of 20,000g.Then solubilization of inclusion bodies was placed 4 hours in 8M urea 100mM sodium phosphate 50mM mercaptoethanol Tris (pH 8.0) buffering, with 20000g, collected supernatant in centrifugal 20 minutes.
Supernatant liquor is splined on to Ni Sepharose HighPerformance (GE company) the affinity post of crossing with above-mentioned damping fluid pre-equilibration, with 8M urea 100mM sodium phosphate 20mM imidazole buffer, with pH 8.0-4.0, carry out the pH wash-out that successively decreases, during pH4.0, obtain purity greater than 90% recombinant protein, as shown in Figure 2, its aminoacid sequence is as shown in SEQ ID NO:3.
By the eluate that contains the purpose fusion rotein that elutes from Ni+ affinity post as stated above, by the volume ratio of 1: 10, be diluted in rapidly in the solution that contains 3M urea, 100mM NaCl, 20mMTris-HCl (pH 8.0), 5mM reduction-state gsh and 0.05mM oxidation state gsh so that protein refolding (renaturation).After 4 degree are placed 48 hours, dialyse in PBS, and be that 5000 daltonian ultra-filtration membranes are concentrated with molecular weight cut-off, carry out the purity of protein analysis, as shown in Figure 3 and Figure 4.
Embodiment 3: fusion rotein targeting Journal of Sex Research of the present invention
by gastric carcinoma cells SGC-7901, human liver cancer cell SMMC-7721, human breast cancer cell MB-MDA-231, human pancreatic cancer cell PANC-1, Human umbilical vein endothelial cells HUVEC, the external cellar culture of human embryonic fibroblast M-20, digest centrifugal, above-mentioned cell is inoculated into respectively in 12 porocyte culture plates, treat that cell grows to culture plate 70%-80% left and right, (final concentration is respectively 2000U/ml to add the interleukin II of different concns and fusion protein S-interleukin-22 of the present invention (SIL) sample, 1000U/ml, 500U/ml), if PBS negative control group, after dosing, after the about 4h of effect, abandon supernatant, with PBS continuous wash three times, after rinsing well, add without IL-2, density 20 * 10
4the mouse T lymphocyte of/ml (CTLL-2) cell 1ml, incubated overnight, the micro-Microscopic observation of second day, when the basic apoptosis of negative control hole CTLL-2 cell, every hole adds the about 100ul of tetramethyl-tetrazolium bromide (MTT) of 5mg/ml, acts on about 4h, adds the SDS-HCl lysate to spend the night, under microplate reader 570nm, survey the OD value, calculate the CTLL-2 proliferation rate.
Calculation formula: CTLL-2 proliferation rate=(OD
The dosing group/ OD
Blank group-1) * 100%
Result shows: the interleukin II (IL-2) without the target land is not combined with gastric carcinoma cells (SGC-7901), SIL can be with it in conjunction with and be dosage correlation, the MTT result consistent with observations under microscope (as Fig. 5) that develops the color; The tumour cells such as SIL and people's cancer of the stomach, liver cancer, mammary cancer, carcinoma of the pancreas have specific binding, with endotheliocyte, slightly be combined, and be dosage correlation, with fetal fibroblast substantially can not be in conjunction with (as Fig. 6), kinds of tumor cells and endotheliocyte expression somatostatin receptor are described, though the target land combination with it of variant fusion rotein.
Embodiment 4:SIL anti-tumor in vivo activity----tumour inhibiting rate experiment
Kunming mice right fore oxter Mice Inoculated liver cancer (H22), by 1 * 10
6/ ml, 0.2ml/ only inoculate, be divided into physiological saline group, IL-2 high dose group (6000U/ pcs/day), IL low (3000U/ pcs/day), SIL high (6000U/ pcs/day), SIL low (3000U/ pcs/day), 10 every group, connect knurl posterior vein administration successive administration 12 days.After drug withdrawal, observed 6 days, put to death mouse, peel off tumour and weigh, calculate every group of average knurl kind and tumour inhibiting rate.Tumour inhibiting rate calculates with following formula.
Result shows, in high dose group, and the contrast of the tumour inhibiting rate of SIL and IL-2, without significant difference (P>0.05), in low dose group, the tumour inhibiting rate of SIL and IL contrasts, and highly significant difference (P<0.01) is arranged, and result is as shown in Figure 7; The IL-2 high dose group has two animal deads, SIL high dosage animal does not have death, after illustrating that SIL is enriched to tumor tissues, after having reduced the toxic side effect of other tissue of whole body and SIL being enriched to tumor locus, greatly strengthened it and induced the effect of CTL cell killing tumour cell.
Embodiment 5:SIL anti-tumor in vivo activity---increase in life span experiment
Kunming mice intraperitoneal inoculation rat liver cancer (H22), by 5 * 10
6/ ml, 0.2ml/ only inoculate, be divided into (5000U/ pcs/day) SIL low (2500U/ pcs/day) in (5000U/ pcs/day) in physiological saline group, IL-2 high dose group (10000U/ pcs/day), IL, IL low (2500U/ pcs/day), SIL high (10000U/ pcs/day), SIL, every group 10, connect knurl posterior vein administration successive administration 14 days.After drug withdrawal, continue to observe, mouse existence and death condition respectively organized in record.
Result shows, by experiment, finish (40 days), the equal dead of physiological saline treated animal, other each administration group surviving animals number of elements is respectively: (4)=IL low (4) in low (5 the)>IL of high (5 the)=SIL of (6)>IL in high (9 the)>SIL of SIL, each dosage group survival mice number of SIL is all more than each dosage group of IL, after the targeting that increases IL-2 is described, obviously strengthened its antineoplastic activity, result as shown in Figure 8.
These results suggest that, of the present invention connected with the IL-2 fusion rotein of the target land of Somatostatin homology can with the kinds of tumor cells specific bindings such as people's cancer of the stomach, liver cancer, mammary cancer, carcinoma of the pancreas, and be dosage correlation, significantly strengthen the targeting of IL-2, after being enriched to tumor tissues, after having reduced the toxic side effect of other tissue of whole body and SIL being enriched to tumor locus, greatly strengthened it and induced the effect of CTL cell killing tumour cell.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
SEQUENCE LISTING
<110 > Shandong Xiansheng Maidejin Biological Pharmaceutical Co., Ltd.
<120 > targeting interleukin 8 plain fusion protein and preparation method thereof and application
<130>MP1002482
<160>6
<170>PatentIn version 3.3
<210>1
<211>133
<212>PRT
<213>Homo sapiens
<400>1
Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His
1 5 10 15
Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys
20 25 30
Asn Pro Lys Leu Thr Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys
35 40 45
Lys Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys
50 55 60
Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu
65 70 75 80
Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu
85 90 95
Lys Gly Ser Glu Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala
100 105 110
Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Ser Gln Ser Ile
115 120 125
Ile Ser Thr Leu Thr
130
<210>2
<211>8
<212>PRT
<213>Homo sapiens
<400>2
Phe Cys Tyr Trp Lys Ser Cys Thr
1 5
<210>3
<211>144
<212>PRT
<213>Homo sapiens
<400>3
Phe Cys Tyr Trp Lys Ser Cys Thr Gly Gly Ser Ala Pro Thr Ser Ser
1 5 10 15
Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His Leu Leu Leu Asp Leu
20 25 30
Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys Asn Pro Lys Leu Thr
35 40 45
Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys Lys Ala Thr Glu Leu
50 55 60
Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys Pro Leu Glu Glu Val
65 70 75 80
Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu Arg Pro Arg Asp Leu
85 90 95
Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu Lys Gly Ser Glu Thr
100 105 110
Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala Thr Ile Val Glu Phe
115 120 125
Leu Asn Arg Trp Ile Thr Phe Ser Gln Ser Ile Ile Ser Thr Leu Thr
130 135 140
<210>4
<211>456
<212>DNA
<213>artificial
<400>4
atgttctgtt actggaagac gtgcaccggc ggtagcgcac ctacttcaag ttctacaaag 60
aaaacacagc tacaactgga gcatttactg ctggatttac agatgatttt gaatggaatt 120
aataattaca agaatcccaa actcaccagg atgctcacat ttaagtttta catgcccaag 180
aaggccacag aactgaaaca tcttcagtgt ctagaagaag aactcaaacc tctggaggaa 240
gtgctaaatt tagctcaaag caaaaacttt cacttaagac ccagggactt aatcagcaat 300
atcaacgtaa tagttctgga actaaaggga tctgaaacaa cattcatgtg tgaatatgct 360
gatgagacag caaccattgt agaatttctg aacagatgga ttaccttttc tcaaagcatc 420
atctcaacac tgactcacca tcaccatcac cattga 456
<210>5
<211>47
<212>DNA
<213>artificial primer
<400>5
catatgttct gtttctggaa gacgtgcacc ggcggtagcg cacctac
47
<210>6
<211>37
<212>DNA
<213>artificial primer
<400>6
caacactgac tcaccatcac catcaccatt gaagctt
37
Claims (11)
1. a fusion rotein, is characterized in that, the aminoacid sequence of wherein said fusion rotein is as shown in SEQ ID NO:3.
2. the DNA molecular of coding claim 1 described fusion rotein.
3. DNA molecular according to claim 2, is characterized in that, its nucleotide sequence is as shown in SEQ ID NO:4.
4. expression cassette, by transcription initiation region; Be subjected to the DNA molecular of the described fusion rotein of coding claim 1 of transcription initiation region regulation and control; And the transcription pausing district forms.
5. the recombinated expression vector of the described fusion rotein DNA molecular of coding claim 1.
6. expression vector as claimed in claim 5, is characterized in that, described expression vector is plasmid or virus.
7. the cell of the DNA molecular of the described fusion rotein of the coding claim 1 of having recombinated.
8. cell as claimed in claim 7, is characterized in that, described cell is mammalian cell, insect cell, yeast or bacterium.
9. cell according to claim 8, is characterized in that, described cell belongs to intestinal bacteria, is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center, and deposit number is CGMCC No.3867.
10. the preparation method of the described fusion rotein of claim 1 comprises:
The described cell of claim 7～9 any one or transfection are provided coding claim 1 described fusion rotein DNA molecular and express the transgenic animal of described fusion rotein;
Make cell or transgenic animal express described fusion rotein; And separate described fusion rotein.
11. the purposes of fusion rotein in the medicine of manufacturing treatment cancer of the stomach, liver cancer, mammary cancer or carcinoma of the pancreas as claimed in claim 1.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101855032A CN102260352B (en) | 2010-05-28 | 2010-05-28 | Targeted interleukin fusion protein as well as preparation method thereof and application thereof |
| PCT/CN2010/076635 WO2011147138A1 (en) | 2010-05-28 | 2010-09-06 | Targeting fusion protein of interleukin and preparation method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101855032A CN102260352B (en) | 2010-05-28 | 2010-05-28 | Targeted interleukin fusion protein as well as preparation method thereof and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102260352A CN102260352A (en) | 2011-11-30 |
| CN102260352B true CN102260352B (en) | 2013-11-20 |
Family
ID=45003233
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101855032A Active CN102260352B (en) | 2010-05-28 | 2010-05-28 | Targeted interleukin fusion protein as well as preparation method thereof and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN102260352B (en) |
| WO (1) | WO2011147138A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108218978B (en) * | 2016-12-13 | 2020-05-12 | 沈阳何氏眼产业集团有限公司 | Recombinant interleukin 18 and preparation method and application thereof |
| AU2020292421A1 (en) * | 2019-06-14 | 2022-01-27 | Cugene, Inc. | Novel interleukin-2 variants and bifunctional fusion molecules thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6180085B1 (en) * | 2000-01-18 | 2001-01-30 | Mallinckrodt Inc. | Dyes |
| CN1665543A (en) * | 2002-04-30 | 2005-09-07 | 莫尔梅德股份有限公司 | Fusions of cytokines and tumor targeting proteins |
| CN101182349A (en) * | 2007-10-08 | 2008-05-21 | 王自正 | Recombinant octreotide and uses thereof |
| CN101439182A (en) * | 2008-12-18 | 2009-05-27 | 北京大学 | Somatostatin receptor mediated tumor-targeted medicament composition |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE284413T1 (en) * | 1993-08-09 | 2004-12-15 | Sod Conseils Rech Applic | THERAPEUTIC PEPTIDE DERIVATIVES |
| US7491805B2 (en) * | 2001-05-18 | 2009-02-17 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US7202330B2 (en) * | 2000-04-26 | 2007-04-10 | Biosynthema Inc. | RGD (Arg-Gly-Asp) coupled to (neuro)peptides |
| US20030170222A1 (en) * | 2001-01-29 | 2003-09-11 | University Of Utah Research Foundation | Beta-superfamily conotoxins |
-
2010
- 2010-05-28 CN CN2010101855032A patent/CN102260352B/en active Active
- 2010-09-06 WO PCT/CN2010/076635 patent/WO2011147138A1/en active Application Filing
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6180085B1 (en) * | 2000-01-18 | 2001-01-30 | Mallinckrodt Inc. | Dyes |
| CN1665543A (en) * | 2002-04-30 | 2005-09-07 | 莫尔梅德股份有限公司 | Fusions of cytokines and tumor targeting proteins |
| CN101182349A (en) * | 2007-10-08 | 2008-05-21 | 王自正 | Recombinant octreotide and uses thereof |
| CN101439182A (en) * | 2008-12-18 | 2009-05-27 | 北京大学 | Somatostatin receptor mediated tumor-targeted medicament composition |
Non-Patent Citations (12)
| Title |
|---|
| Accession:.3INK_C.《Genbank》.2009, * |
| Accession:.AAS17753.1.《Genbank》.2004, * |
| Carmelo Scarpignato，Iva Pelosini.Somatostatin Analogs for Cancer Treatment and Diagnosis: An Overview.《Chemotherapy》.2001,第47卷(第2期),1-29页. * |
| Hirsch B, Brauer J, 等.Anti-CD30 human IL-2 fusion proteins display strong and specific cytotoxicity in vivo.《Current Drug Targets》.2009,第10卷(第2期),110-7. * |
| Juliana Hamzah, Delia Nelson, 等.Vascular targeting of anti-CD40 antibodies and IL-2 into autochthonous tumors enhances immunotherapy in mice.《The Journal of Clinical Investigation》.2008,第118卷(第5期), * |
| L. A. khawli, P. Hu, A. L. Epstein.Cytokine, chemokine, and co-stimulatory fusion proteins for the immunotherapy of solid tumors.《Handbook of Experimental Pharmacology》.2008,第181卷(第5期),291-328. * |
| Sirisha Potala, 等.Modified DT-IL2 fusion toxin targeting uniquely IL2Rα expressing leukemiacell lines - Construction and characterization.《Journal of Biotechnology》.2010,第148卷(第2-3期),147-155. |
| Sirisha Potala, 等.Modified DT-IL2 fusion toxin targeting uniquely IL2Rα expressing leukemiacell lines - Construction and characterization.《Journal of Biotechnology》.2010,第148卷(第2-3期),第153页第二段-第154页末. |
| Sirisha Potala, 等.Modified DT-IL2 fusion toxin targeting uniquely IL2Rα expressing leukemiacell lines- Construction and characterization.《Journal of Biotechnology》.2010,第148卷(第2-3期),147-155. * |
| Sirisha Potala, 等.Modified DT-IL2 fusion toxin targeting uniquely IL2Rα expressing leukemiacell lines- Construction and characterization.《Journal of Biotechnology》.2010,第148卷(第2-3期),第153页第二段-第154页末. * |
| U. KUMAR,等.Somatostatin receptors in primary human breast cancer: quantitative analysis of mRNA for subtypes 1-5 and correlation with receptor protein expression and tumor pathology.《BREAST CANCER RESEARCH AND TREATMENT》.2005,第92卷(第2期),175-186页. * |
| Vascular targeting of anti-CD40 antibodies and IL-2 into autochthonous tumors enhances immunotherapy in mice;Juliana Hamzah, Delia Nelson, 等;《The Journal of Clinical Investigation》;20080408;第118卷(第5期);第1691页第一栏第12-17行，第二栏第10-14行，第1695页第二栏第二段第22-30行，1698页第11-12行 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102260352A (en) | 2011-11-30 |
| WO2011147138A1 (en) | 2011-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3453401A1 (en) | Interleukin combination and use thereof | |
| CN101578373A (en) | Fusion peptide therapeutic compositions | |
| CN102153653B (en) | Fusion protein of tumor blood vessel targeted polypeptide and tissue factor and preparation method thereof | |
| CN102898526A (en) | Tumor necrosis factor-related apoptosis-inducing ligand fusion protein, its preparation and application | |
| US20200062818A1 (en) | Bifunctional fusion proteins to inhibit angiogenesis in tumor microenvironment and to activate adaptive immune responses and the genes and uses thereof | |
| BR112013013548B1 (en) | anticancer fusion protein | |
| CN1935846A (en) | Fusion protein for treating diabetes, and its preparing method and use | |
| CN100400549C (en) | Nerve growth factor combined with collagen specificity and its coading gene and application | |
| CN102250254A (en) | Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) fusion protein, its preparation and applications | |
| CN101717449A (en) | Recombinant TRAIL-Fc fusion protein as well as preparation and application thereof | |
| JP2001521733A (en) | Fusion protein of human epidermal growth factor and human angiogenin and method for producing the same | |
| CN102260352B (en) | Targeted interleukin fusion protein as well as preparation method thereof and application thereof | |
| EP0550769A1 (en) | Hematopoietic stem cell multiplier | |
| CN109400711B (en) | PDGFR beta targeting tumor necrosis factor related apoptosis inducing ligand variant and preparation method and application thereof | |
| CN103755813B (en) | A kind of targeting antineoplastic amalgamation protein and encoding gene thereof and expression plasmid | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| WO2005061531A1 (en) | A superantigen fusion protein used for antitumor therapy and the preparation thereof | |
| CN103865899B (en) | There is VEGFR 2the fusion toxin of/KDR receptor-specific and encoding gene thereof and application | |
| CN105985447B (en) | A kind of albumin mating type tumor necrosin relative death inducing ligand variant and its preparation method and application | |
| CN103232543B (en) | Recombinant protein Tumstatin-CD137L4 with Tumstatin activities as well as preparation method and application thereof | |
| CN109776653B (en) | Human serum albumin adhesion peptide and application thereof | |
| KR100612673B1 (en) | Cell-transducing botoxin fusion protein | |
| CN102391377A (en) | Fusion protein capable of inducing and activating cancer targeting T-cells as well as preparation method and application of the fusion protein | |
| CN102260353A (en) | Targeted interleukin fusion protein and preparation method as well as application thereof | |
| CN101456913B (en) | Anti-tumor fusion protein and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: 264006 No. 1, Heilongjiang Road, Yantai economic and Technological Development Zone, Shandong, China Patentee after: Shandong Simcere bio Pharmaceutical Co. Ltd. Address before: 264001 No. 1, Heilongjiang Road, Yantai economic and Technological Development Zone, Shandong, China Patentee before: Shandong Xiansheng Maidejin Biological Pharmaceutical Co., Ltd. |