CN102260352A

CN102260352A - Targeted interleukin fusion protein as well as preparation method thereof and application thereof

Info

Publication number: CN102260352A
Application number: CN2010101855032A
Authority: CN
Inventors: 周兵; 姜静; 周宇; 邓磊修; 刘武
Original assignee: SHANDONG XIANSHENG MAIDEJIN BIOLOGICAL PHARMACEUTICAL CO Ltd
Current assignee: Shandong Simcere bio Pharmaceutical Co. Ltd.
Priority date: 2010-05-28
Filing date: 2010-05-28
Publication date: 2011-11-30
Anticipated expiration: 2030-05-28
Also published as: WO2011147138A1; CN102260352B

Abstract

The invention relates to the technical field of biology, and in particular provides a targeted interleukin fusion protein, a DNA (Deoxyribose Nucleic Acid) molecule for encoding the fusion protein, a carrier containing the DNA sequence, a host cell or a transgenic animal containing the carrier as well as a preparation method and an application of the fusion protein. The fusion protein provided by the invention comprises a targeted connection area and an interleukin from an end N to an end C, wherein the connection area which can be formed by no more than 10 amino acids according to the situation is used for connecting the targeted combining area and the interleukin. As a preference, the target combining area is homologous with somatostatin. It is shown in an experiment that the interleukin concentration of the targeted tissue can be increased by using the fusion protein, the interleukin concentrations of other tissues can be also reduced, the side effect of 1L-2 can be reduced while the curative effect is enhanced, and the fusion protein can be used for treating tumors and has wide application prospects.

Description

Target interleukin 8 plain fusion protein and preparation method thereof and application

Technical field

The present invention relates to biological field, be specifically related to interleukin 8 plain fusion protein and preparation and its application at field of medicaments.

Background technology

The traditional treatment method for cancer has operative treatment, chemotherapy, radiotherapy and hormonotherapy etc.In recent years, the exploitation selectively acting has become important research exploitation direction in efficient, the low toxicity of specific target spot, the antibumor molecules targeted drug of high specificity.Immunotherapy of tumors has become one of most active antineoplastic target research field, and monoclonal antibody, cell adoptive immunotherapy, tumor vaccine, cytokine therapy have demonstrated the complementarity with traditional remedies.

Interleukin II (IL-2) is a kind of interleukin-well known in the art, be found in 1976, the homo agglutinin of human plants such as Morgan stimulates normal human lymphocyte, find that it can produce a kind of cytokine that can selectivity promotes the T lymphocyte growth, it must with IL-2 receptors bind competence exertion biological effect.IL-2 is multiple biological function cytokine, but the non-specific killing ability of the differentiation of irritation cell poison T lymphocyte, activating cells poison T lymphocyte, natural killer cell, eosinophil, mastocyte also can strengthen the antibody-secreting and the propagation of bone-marrow-derived lymphocyte.Therefore also be mainly used in the systemic immunity that immunological adjuvant is transferred body clinically, reach the purpose of assisting therapy control tumour.

As the interleukin-molecule of first separated purifying, the eighties, U.S. Cetus company exploit person source recombinant il-2 was used for the treatment of cancer, and until 1993, IL-2 was used for the treatment of kidney and melanoma by the FDA approval; At present the IL-2 heavy dose that also goes through is used for the treatment of HIV.Clinical trial shows the efficient low of IL-2 single therapy cancer, and side effect is big.High-dose therapy melanomatous objective efficient be 5-27%, wherein have only patient's state of an illness of 0-4% to alleviate fully.The side effect of IL-2 is big, and patient produces series reaction such as body fluid storage is stayed, diarrhoea, hypopiesia, the small portion death, and these toxic side effect are many, and to cause other histogenic immunity overreactions of whole body of non-treatment focus relevant with IL-2.

Be directed to the limitation of the clinical use of IL-2, it is to reduce drug side effect, raising drug effect, prolong drug transformation period that present IL-2 pharmaceutical grade protein is studied main direction.The tactful polyoxyethylene glycol (PEG) of IL-2 that mainly comprises is modified, is merged prolong half-life with human serum albumin (HSA), glycosylation modified raising IL-2 stability, with the monoclonal antibody fusion drug targeting is arrived specific target spot (as tumour cell), merge generation drug combination effect etc. with other albumen (as immune-regulating factor).In clinical experiment, the IL-2 that PEG modifies compares with IL-2, is not significantly improved the transformation period and efficient, is not used for cancer therapy by the FDA approval so far.Human GenomeSciences company has developed HSA-IL-2 fusion rotein Albuleukin, and bring up to 6 hour from 19 minutes of IL-2 the plasma half-life of intravenous injection Albuleukin, entered the second stage of clinical experiment at present.The 3rd Thr of natural IL-2 is by glycosyl modified, the glycosylation ground means of present IL-2 are divided into eukaryotic cell expression and synthetic glycosylation small peptide is connected two kinds of strategies with IL-2 albumen, Symansis company chooses 293 cell expressing hcxIL-2 in sale on the market, domestic have several laboratories all to develop the glycosylated IL-2 of yeast expression, also is in the development phase at present.At present Merck ﹠ Co., Inc. will resist antibody drug EMD273066 (hu14.18-IL-2) that the C end of Sphingolipids,sialo GD2 merges IL-2 to be used for the treatment of melanoma to have finished the I phase clinical, the result shows among the 33 routine patients, 8 routine stable disease.Do not have 4 grades of toxic reactions (death) and take place, but still find to have 3 grades of toxic reactions such as ypotension, histanoxia.The research that IL-2 is melted into other antibody (as anti-her2antibody, anti-her3, IgG3 etc.) is also arranged in addition, to strengthen IL-2 inductive T cell to the tumor cytotoxicity specificity.Other IL-2 fusion rotein medicines, as Aerolysin-IL-2, IL-6-IL-2, GCSF-IL-2, recombinant human alpha prothymosin-interleukin-22 etc., the effect of generation drug combination.

The problem that may exist for the interleukin-2 with the connection/fusion of biomacromolecule coupling is, being multiplied of drug molecule amount makes it more be difficult to pass physiologic barrier arrival target tissue though the transformation period prolongs, especially poor to the wetting property of large-scale solid tumor, make it be difficult to pass physiologic barrier and arrive tumor locus.The not high meeting of the specificity of targeted drug and affinity causes targeted drug injuring normal cell before the arrival target tissue, has consumed drug effect.

At the problems referred to above, at first will select the high tumour antigen of specificity is target spot, also to carry out appropriate design to targeted drug in addition by protein engineering, reduce molecular mass, improve avidity and specificity, increase the concentration and the distribution that reduce in healthy tissues of medicine, reduce Normocellular toxic side effect at tumor tissues.Can select target short peptide and the non-antibody albumen of main target, wherein have at the NGR of endothelial cells in tumor neogenetic blood vessels surface molecular aminopeptidase N and the RGD of integrin (integrins α v β 3) in endothelial cells in tumor neogenetic blood vessels and tumour cell.Some utilizes the developing drugs of above-mentioned relevant target peptide, has successfully entered clinical experiment.Just be NGR fusion tumour necrosis factor (NGR-hTNF α) as Modmed company exploitation ARENEGYR, being used for the treatment of the rectum cancer, liver cancer, mesothelioma, to have entered the II phase clinical.It is clinical that the medicine 18F-AH111585 (radiolabeled RGD) that GE company exploitation is used for diagnosing tumor also enters first phase.

Somatostatin (Somatostatin, SST) and somatostatin analogue such as vapreotide (Vapreotide) and Lanreotide (Lanreotide) etc. successfully be used for the clinical treatment of cardiovascular disorder (cerebral thrombosis etc.) and carcinoid, glucagonoma of pancreas, gastrinoma etc. respectively as single medicine.Somatostatin receptor (SSTR) finds to be expressed in kinds of tumor cells, and reasonableness and the feasibility that the target peptide is selected fully supported in these researchs.

Summary of the invention

The purpose of this invention is to provide a kind of target interleukin fusion rotein, this fusion rotein can specificity in conjunction with some cell particularly tumor tissue cell or its new vessel endotheliocyte, the plain concentration of significant leukocyte increasing Jie in target tissue, reduce its concentration at its hetero-organization, thereby the raising result of treatment reduces toxic side effect.

In order to realize the foregoing invention purpose, the present invention by the following technical solutions:

A kind of fusion rotein is held to C end from N to comprise the target land of (1) specificity in conjunction with tumour cell or tumor vascular endothelial cell; (2) interleukin-.

According to circumstances, fusion rotein of the present invention can be used to connect described target land and interleukin-by no more than 10 joining regions that amino acid is formed.

In one embodiment of the invention, there are three amino acid the joining region: glycine-glycine-Serine-(GGS), 6 amino acid are arranged in another embodiment: glycine-glycine-Serine-glycine-glycine-Serine (GGSGGS).

As preferably, interleukin-behaviour source interleukin II has the aminoacid sequence as SEQ ID NO:1 in the fusion rotein of the present invention.

As preferably, behaviour source, target land aminoacid sequence in the fusion rotein of the present invention.

More preferably, described target land and Somatostatin homology, the aminoacid sequence and the Somatostatin homology of described target land are not less than 60%.

In embodiment, the present invention specifically provides a kind of fusion rotein, the aminoacid sequence of its target land is FCYWKSCT, shown in SEQ ID NO:2, or for the aminoacid sequence shown in the SEQ IDNO.2 has 80% consistence at least through replacing, lacking or add one or several amino acid derived aminoacid sequence with shown in the SEQ ID NO.2, and has the activity of specific combination tumour cell or tumor vascular endothelial cell.

In one embodiment, the target land can be to comprise being no less than 3 but no more than 50 amino acid whose aminoacid sequences in the fusion rotein of the present invention, preferred sequence contains no more than 15 aminoacid sequences of Somatostatin homologous, in a preferred embodiment, the target land of fusion rotein of the present invention contains the described aminoacid sequence just like SEQ ID NO:2, its N-terminal can have the methionine(Met) of the initiator codon translation of escherichia coli expression, may be excised by heterogeneity in translation process.

As preferably, will the target land shown in SEQ ID NO:2 in tyrosine contain phenyl ring or heterocyclic amino acid is replaced by arbitrary, preferably replace with phenylalanine or tryptophane, do not influence its target.

As preferably, will the target land shown in SEQ ID NO:2 in Serine replace or disappearance by arbitrary amino acid that contains hydroxyl, preferably replace with Threonine, do not influence its target.

In a preferred embodiment, the invention provides a kind of concrete fusion rotein, contain the described aminoacid sequence just like SEQ IDD NO:3, note is made SIL.Be convenient to purifying in order to make fused protein, can include but not limited to poly Histidine (Poly-His is generally 6 Histidines), poly arginine (Poly-Arg is generally 5-6 arginine) etc. at amino (N) end or the terminal upper amino acid label that connects of carboxyl (C).

Another aspect of the present invention also provides the dna molecular of the fusion rotein of the present invention of encoding.Owing to the degeneracy of codon, can there be the nucleotide sequence of a variety of specific proteins of the present invention of can encoding.In one embodiment, the invention provides to encode contains dna molecular just like the fusion rotein of the described aminoacid sequence of SEQ IDD NO:3, and its nucleotide sequence is shown in SEQ IDD NO:4.

In order to produce fusion rotein of the present invention, the dna molecular of encoding fusion protein is integrated in the expression cassette, and expression cassette is inserted into suitable expression vector subsequently.Then, this expression vector is changed over to host cell or animal is used for expression of recombinant proteins.

Expression cassette comprises following content at least: can the encode dna molecular of fusion rotein of the present invention of (1) transcription initiation region, (2), this is transcribed is to carry out under the regulation and control at transcription initiation region, and (3) transcription pausing district.

According to the difference of the host cell that is used for protein expression, transcription initiation region and transcription pausing district can be natural existence or artificial constructed sequence, and this sequence is suitable for the genetic transcription in eucaryon or the prokaryotic cell prokaryocyte.This type of sequence is well known in the present technique field.The suitable DNA sheet that contains transcriptional initiation sequence is connected with the dna fragmentation of encoding fusion protein with the suitable dna fragmentation that contains the transcription pausing district.This method of attachment is well known in the present technique field, such as, select suitable digestion with restriction enzyme and connection.

The present invention further provides has recombinated the encode expression vector of dna molecular of fusion rotein of the present invention and the cell and transgenic animal of expressing described fusion rotein.Described expression vector preferred plasmid or virus.Described cell can be mammalian cell, insect cell, yeast or bacterium.Transgenic animal can be transgenic sheeps, ox, or the like.

In an embodiment of the present invention, a kind of intestinal bacteria of dna molecular of fusion rotein of the present invention of encoding of having recombinated specifically are provided, described intestinal bacteria are deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 24th, 2010, and deposit number is CGMCC No.3867.

In addition, the present invention also provides the production method of described fusion rotein, may further comprise the steps: the cell or the transgenic animal of the dna molecular that contains the fusion rotein of the present invention of encoding are provided, make this cell or transgenic animal express described fusion rotein and separate described fusion rotein.

Experiment shows, fusion rotein of the present invention can be by activating NK cell, CTL cell, LAK cell at tumor tissues/position, improve the ability of immunity system killing tumor cell, therefore the present invention also provides the application of described fusion rotein, promptly is used for the treatment of the purposes in the medicine of the disorders such as cancers that disease that cell hyperplasia causes or preparation treatment cell hyperplasia cause.

Biological preservation explanation

Classification name: colon bacillus, Escherichia coli. is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 24th, 2010, the address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.3867.

Description of drawings:

Fig. 1 shows fusion rotein structural representation of the present invention.

A: target land; B: joining region; C: people source interleukin II.

Fig. 2 shows the SDS-PAGE qualification result behind the fusion rotein SIL expression and purification of the present invention.

Swimming lane 1: molecular weight Marker; Be followed successively by 97.0kDa, 66.0kDa, 45.0kDa, 30.0kDa, 20.1kDa, 14.4kDa from top to bottom.

Swimming lane 2: the host bacterium lysate of expressed fusion protein;

Swimming lane 3: the inclusion body of final washing;

Swimming lane 4: through the target protein of Ni Sepharose High Performance protein affinity purification.

Fig. 3 shows the SDS-PAGE result of fusion rotein SIL renaturation of the present invention.

A:15%SDS-PAGE analyzes, O: non-reduced electrophoresis;

M: molecular weight Marker is followed successively by 97.0kDa, 66.0kDa, 43.0kDa, 30.0kDa, 20.1kDa, 14.4kDa from top to bottom;

R:SIL reduces electrophoresis;

Fig. 4 shows fusion rotein SIL carbon 18 reversed phase high efficiency liquid phase analysis figure (C18RP-HPLC) of the present invention, chromatography column: ZORBA 300SB-C185um, 4.6*250mm; Detect wavelength: 280nm; Purity: 96.7%.

The external target of Fig. 5 fusion rotein SIL of the present invention is in conjunction with experimental result.

Fig. 6 shows after fusion rotein SIL of the present invention is in conjunction with different target cells to be influenced the CTLL-2 cell proliferation rate.

Fig. 7 shows fusion rotein SIL high dosage of the present invention and low dosage and IL-2 anti-tumor in vivo experiment comparing result.

Fig. 8 shows that fusion rotein SIL of the present invention and IL-2 are to the contrast of inoculation H22 kunming mice increase in life span.

Embodiment:

The invention discloses a kind of interleukin 8 plain fusion protein and preparation and its application at field of medicaments, those skilled in the art can use for reference this paper content, suitably improve processing parameter and realize.Special needs to be pointed out is that all similarly replace and change apparent to those skilled in the art, they all are regarded as being included in the present invention.Product of the present invention, method and application are described by preferred embodiment, the related personnel obviously can change or suitably change and combination methods and applications as herein described in not breaking away from content of the present invention, spirit and scope, realizes and use the technology of the present invention.

According to the present invention, a kind of fusion rotein of interleukin-of target is held to C end from N to comprise the target land of (1) specificity in conjunction with tumour cell or tumor vascular endothelial cell; (2) no more than 10 amino acid whose joining regions according to circumstances can be arranged; (3) interleukin-aminoacid sequence

In one embodiment, the target land can be to comprise being no less than 3 but no more than 50 amino acid whose aminoacid sequences in the fusion rotein of the present invention, preferred sequence contains no more than 15 aminoacid sequences of Somatostatin homologous, in a preferred embodiment, the target land of fusion rotein of the present invention contains the described aminoacid sequence just like SEQ ID NO:2, wherein the N end can have the methionine(Met) of the initiator codon translation of escherichia coli expression, may be excised by heterogeneity in translation process; As preferably, will be shown in SEQ ID NO:2 in the target land tyrosine contain phenyl ring or heterocyclic amino acid is replaced by arbitrary, preferred phenylalanine or tryptophane do not influence its target.

As preferably, will be shown in SEQ ID NO:2 in the target land tyrosine replace or disappearance by arbitrary amino acid that contains hydroxyl, be preferably Threonine, do not influence its target.

The target land of fusion rotein of the present invention can directly connect together by peptide bond or by the joining region with interleukin-.Depend on the needs, the joining region can have 2 to 10 amino acid to connect target land and interleukin II.

In one embodiment, there are three amino acid the joining region: glycine-glycine-Serine-(GGS), 6 amino acid glycine-glycine-Serine-glycine-glycine-Serines (GGSGGS) are arranged in another embodiment.

In a preferred embodiment, fusion rotein of the present invention contains the described aminoacid sequence just like SEQ IDDNO:4, and note is made SIL.

In a preferred embodiment, fusion rotein of the present invention contains the described aminoacid sequence just like SEQ IDDNO:3.

Another aspect of the present invention also provides the dna molecular of the above-mentioned fusion rotein of code book invention.Owing to the degeneracy of codon, can there be the nucleotide sequence of a variety of specific proteins of the present invention of can encoding.In one embodiment, the invention provides to encode contains dna molecular just like the fusion rotein of the described aminoacid sequence of SEQ IDD NO:3, and its nucleotide sequence is shown in SEQ IDD NO:4.

Expression cassette can be integrated the insertion expression vector, and this expression vector is changed over to host cell or animal subsequently.Generally speaking, expression vector also will comprise the replication initiation sequence, and selection markers, and for example, for the protein expression of bacterium, plasmid is a kind of carrier on way of great use.The a variety of plasmid vectors that can be used for this purpose well known are arranged in the present technique field, comprise, but be not limited only to pET15b, pET22b, pET25b, pET28b or the like.If come recombinant expressed fusion rotein by yeast cell, Yeast expression carrier, such as pPIC9, pAO815, pPICZ or the like can be used as expression vector.If carry out protein expression, a lot of suitable expression of recombinant proteins carriers are arranged also by mammalian cell.Be used for the dna sequence dna that the proteic expression vector of mammalian cell expression comprises, need to be fit to integrate the insertion host cell chromosome in the homologous recombination mode.Mammalian cell expression vector, such as pcDNA3.1, pSI or the like.For coming expressed fusion protein by animal, be used to produce the technique means of the transgenic animal that contain expression cassette (transgenic sheep, ox, or the like), well known in the present technique field.Such as pBLG or the like, can be used as the carrier that transgenic animal are expressed.

After obtaining transformed host cells or transgenic animal, can under the condition that is fit to expression fusion rotein of the present invention, give expression to fusion rotein.Difference by its physico-chemical property and other characteristic is used various separation method separation and purification fusion roteins.These methods are well-known to those skilled in the art, for example: the combination of conventional purification process such as conventional sex change renaturation handles, centrifugal, ultrasonication, ultrafiltration membrance filter, metal affinity chromatography, ion exchange chromatography, gel permeation chromatography, dialysis, high performance liquid chromatography and these methods.

Fusion rotein of the present invention is by activating the ability that NK cell, CTL cell, LAK cell etc. improve local organization and/or organ immunity system killing tumor cell at tumor tissues/position.Another aspect of the present invention also provides the medicinal use of described fusion rotein, maybe can produce the medicine that is used for the treatment of a kind of disease.

Below in conjunction with embodiment, further set forth the present invention.

Embodiment 1. is used to express the structure of the interleukin-22 fusion rotein plasmid of Somatostatin homology target peptide of the present invention

N-terminal and N-terminal aminoacid sequence and the additional target of N-terminal land amino acid to be added based on fusion rotein, design and synthesize a pair of primer, and increase from people's liver cDNA library with polymerase chain reaction (PCR) technology and to obtain encoding the dna sequence dna of human interleukin-12 (IL-2), also directly the dna sequence dna of composite coding human interleukin-12 (C125S) is as template, and a pair of primer of design is:

5 upstream primers:

CATATGTTCTGTTTCTGGAAGACGTGCACCGGCGGTAGCGCACCTAC (shown in SEQ ID NO:5)

Wherein contain NdeI site: CATATG successively, comprise the target land encoding sequence of 24 Nucleotide: TTCTGTTTCTGGAAGACGTGCACC, link zone sequence: GGCGGT with and subsequent interleukin II anneal sequence: AGCGCACCTAC;

3 (downstream) primer:

CAACACTGACTCACCATCACCATCACCATTGAAGCTT (shown in SEQID NO:6)

Wherein contain anneal sequence: CAACACTGACT, histidine-tagged sequence: CACCATCACCATCACCAT, terminator codon TGA and subsequent HindIII site successively.

((toolenzyme is all available from Takara company to cut pcr amplification product and pET25b empty plasmid with NdeI and HindIII enzyme, plasmid is available from Novage company), above-mentioned endonuclease bamhi all reclaims the fragment of corresponding size with sepharose, connect each fragment with the T4DNA ligase enzyme, the recombinant plasmid of gained is interleukin-Expression of Fusion Protein carrier, called after pET-S-IL.The fusion rotein structure as shown in Figure 1.

At first with ligation mixture transformed into escherichia coli XL-1Blue, after the incubated overnight, select positive bacterium colony and therefrom prepare DNA in a large number in containing the substratum of penicillin, through dna sequence analysis, its nucleotide sequence is shown in SEQ ID NO:4.

After further confirming the sequence exactness, with this recombinant plasmid transformed in competence e. coli bl21 (DE3) bacterial strain (Novagen) that carries the T7 promoter gene, be the engineering bacteria of expressing corresponding protein, called after SIL-BL21, this project bacterium classification name: colon bacillus, Escherichia coli. is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 24th, 2010, the address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.3867.

Embodiment 2: Expression of Fusion Protein of the present invention and purifying

The e. coli bl21 that recombinant plasmid pET-S-IL transforms is cloned cultivation (37 ℃) in the culturing bottle that is added in the LB substratum, treat that bacterial density reaches OD600 ≈ 4-6, carry out the 5L fermentor cultivation by inoculum size 5-10%, treat OD600 ≈ 10-20, in substratum, add 0.5-1mM isopropyl-(IPTG) and carry out abduction delivering, to inducing back OD600 no longer to increase following jar, with 10,000g * (15 minutes) centrifugal results thalline.

The thalline of results is resuspended in the 3M urea 100mM phosphoric acid 20mM Tris pH8.0 damping fluid (buffer), and room temperature was placed 1 hour, and with cell supersound process 3 times, 20, the centrifugal collection inclusion body of 000g.Then solubilization of inclusion bodies was placed 4 hours in 8M urea 100mM sodium phosphate 50mM mercaptoethanol Tris (pH 8.0) buffering, collected supernatant in centrifugal 20 minutes with 20000g.

Supernatant liquor is splined on Ni Sepharose HighPerformance (GE company) the affinity post of crossing with above-mentioned damping fluid pre-equilibration, carry out the pH wash-out that successively decreases with 8M urea 100mM sodium phosphate 20mM imidazole buffer with pH 8.0-4.0, obtain purity during pH4.0 greater than 90% recombinant protein, as shown in Figure 2, its aminoacid sequence is shown in SEQ ID NO:3.

With the eluate that contains the purpose fusion rotein that elutes from Ni+ affinity post as stated above, by 1: 10 volume ratio be diluted in rapidly contain 3M urea, 100mM NaCl, 20mMTris-HCl (pH 8.0), 5mM also in the solution of ortho states gsh and 0.05mM oxidation state gsh so that protein refolding (renaturation).After 4 degree are placed 48 hours, dialyse in PBS, and be that 5000 daltonian ultra-filtration membranes are concentrated, carry out the purity of protein analysis, as shown in Figure 3 and Figure 4 with molecular weight cut-off.

Embodiment 3: the external target Journal of Sex Research of fusion rotein of the present invention

With gastric carcinoma cells SGC-7901, human liver cancer cell SMMC-7721, human breast cancer cell MB-MDA-231, human pancreatic cancer cell PANC-1, Human umbilical vein endothelial cells HUVEC, external conventional cultivation of human embryonic fibroblast M-20, digest centrifugal, above-mentioned cell is inoculated into respectively in the 12 porocyte culture plates, treat that cell grows to about culture plate 70%-80%, (final concentration is respectively 2000U/ml for the interleukin II of adding different concns and fusion rotein S-interleukin-22 of the present invention (SIL) sample, 1000U/ml, 500U/ml), if PBS negative control group, abandon supernatant behind the about 4h of effect after the dosing, with PBS continuous wash three times, rinse the back well and add no IL-2, density 20 * 10 ⁴The mouse T lymphocyte of/ml (CTLL-2) cell 1ml, incubated overnight, microscopically was observed in second day, when treating the basic apoptosis of negative control hole CTLL-2 cell, every hole adds the about 100ul of tetramethyl-tetrazolium bromide (MTT) of 5mg/ml, acts on about 4h, adds the SDS-HCl lysate and spends the night, microplate reader 570nm surveys the OD value down, calculates the CTLL-2 proliferation rate.

Calculation formula: CTLL-2 proliferation rate=(OD _{The dosing group}/ OD _{Blank group}-1) * 100%

The result shows: the interleukin II (IL-2) of no target land and gastric carcinoma cells (SGC-7901) debond, SIL can be with it in conjunction with and be dosage correlation, the MTT result consistent with the microscopically observations (as Fig. 5) that develops the color; SIL has specificity to combine with tumour cells such as people's cancer of the stomach, liver cancer, mammary cancer, carcinoma of the pancreas, slightly combine with endotheliocyte, and be dosage correlation, with fetal fibroblast substantially can not be in conjunction with (as Fig. 6), kinds of tumor cells and endotheliocyte expression somatostatin receptor is described, though the target land combination with it of variant fusion rotein.

The experiment of embodiment 4:SIL anti-tumor in vivo activity----tumour inhibiting rate

Inoculation rat liver cancer (H22) in kunming mice right fore oxter is by 1 * 10 ⁶/ ml, 0.2ml/ only inoculate, be divided into physiological saline group, IL-2 high dose group (6000U//sky), IL low (3000U//day), SIL height (6000U//sky), SIL low (3000U//sky), 10 every group, connect knurl posterior vein administration successive administration 12 days.Observed 6 days after the drug withdrawal, put to death mouse, peel off tumour and weigh, calculate every group of average knurl kind and tumour inhibiting rate.Tumour inhibiting rate calculates with following formula.

The result shows that in high dose group, the tumour inhibiting rate of SIL and IL-2 contrasts, no significant difference (P＞0.05), and in low dose group, the contrast of the tumour inhibiting rate of SIL and IL has highly significant difference (P＜0.01), and the result is as shown in Figure 7; The IL-2 high dose group has two animal deads, SIL high dosage animal does not have death, after illustrating that SIL is enriched to tumor tissues, reduced the toxic side effect of other tissue of whole body and SIL be enriched to tumor locus after, strengthened it greatly and induced the effect of CTL cell killing tumour cell.

Embodiment 5:SIL anti-tumor in vivo activity---increase in life span experiment

Inoculation rat liver cancer (H22) in kunming mice abdominal cavity is by 5 * 10 ⁶/ ml, 0.2ml/ only inoculate, be divided into (5000U//sky) SIL low (2500U//sky) among (5000U//sky) among physiological saline group, IL-2 high dose group (10000U//sky), the IL, IL low (2500U//sky), SIL height (10000U//sky), the SIL, every group 10, connect knurl posterior vein administration successive administration 14 days.Continue after the drug withdrawal to observe, mouse existence and death condition respectively organized in record.

The result shows, finish (40 days) by experiment, the physiological saline treated animal is all dead, other each administration group surviving animals number of elements is respectively: (4)=IL low (4) among low (5 the)＞IL of (6)＞IL height (5)=SIL among SIL height (9)＞SIL, each dosage group survival mice number of SIL is all more than each dosage group of IL, after the target that increases IL-2 is described, obviously strengthened its antineoplastic activity, the result as shown in Figure 8.

Above presentation of results, the of the present invention connection with the IL-2 fusion rotein of Somatostatin homologous target land can combine with kinds of tumor cells specificitys such as people's cancer of the stomach, liver cancer, mammary cancer, carcinoma of the pancreas, and be dosage correlation, significantly strengthen the target of IL-2, after being enriched to tumor tissues, reduced the toxic side effect of other tissue of whole body and SIL be enriched to tumor locus after, strengthened it greatly and induced the effect of CTL cell killing tumour cell.

The above only is a preferred implementation of the present invention; should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the principle of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

SEQUENCE LISTING

＜110〉Shandong Xiansheng Maidejin Biological Pharmaceutical Co., Ltd.

＜120〉target interleukin 8 plain fusion protein and preparation method thereof and application

<130>MP1002482

<160>6

<170>PatentIn version 3.3

<210>1

<211>133

<212>PRT

<213>Homo sapiens

<400>1

Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His

1 5 10 15

Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys

20 25 30

Asn Pro Lys Leu Thr Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys

35 40 45

Lys Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys

50 55 60

Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu

65 70 75 80

Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu

85 90 95

Lys Gly Ser Glu Thr Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala

100 105 110

Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe Ser Gln Ser Ile

115 120 125

Ile Ser Thr Leu Thr

130

<210>2

<211>8

<212>PRT

<213>Homo sapiens

<400>2

Phe Cys Tyr Trp Lys Ser Cys Thr

1 5

<210>3

<211>144

<212>PRT

<213>Homo sapiens

<400>3

Phe Cys Tyr Trp Lys Ser Cys Thr Gly Gly Ser Ala Pro Thr Ser Ser

1 5 10 15

Ser Thr Lys Lys Thr Gln Leu Gln Leu Glu His Leu Leu Leu Asp Leu

20 25 30

Gln Met Ile Leu Asn Gly Ile Asn Asn Tyr Lys Asn Pro Lys Leu Thr

35 40 45

Arg Met Leu Thr Phe Lys Phe Tyr Met Pro Lys Lys Ala Thr Glu Leu

50 55 60

Lys His Leu Gln Cys Leu Glu Glu Glu Leu Lys Pro Leu Glu Glu Val

65 70 75 80

Leu Asn Leu Ala Gln Ser Lys Asn Phe His Leu Arg Pro Arg Asp Leu

85 90 95

Ile Ser Asn Ile Asn Val Ile Val Leu Glu Leu Lys Gly Ser Glu Thr

100 105 110

Thr Phe Met Cys Glu Tyr Ala Asp Glu Thr Ala Thr Ile Val Glu Phe

115 120 125

Leu Asn Arg Trp Ile Thr Phe Ser Gln Ser Ile Ile Ser Thr Leu Thr

130 135 140

<210>4

<211>456

<212>DNA

<213>artificial

<400>4

atgttctgtt actggaagac gtgcaccggc ggtagcgcac ctacttcaag ttctacaaag 60

aaaacacagc tacaactgga gcatttactg ctggatttac agatgatttt gaatggaatt 120

aataattaca agaatcccaa actcaccagg atgctcacat ttaagtttta catgcccaag 180

aaggccacag aactgaaaca tcttcagtgt ctagaagaag aactcaaacc tctggaggaa 240

gtgctaaatt tagctcaaag caaaaacttt cacttaagac ccagggactt aatcagcaat 300

atcaacgtaa tagttctgga actaaaggga tctgaaacaa cattcatgtg tgaatatgct 360

gatgagacag caaccattgt agaatttctg aacagatgga ttaccttttc tcaaagcatc 420

atctcaacac tgactcacca tcaccatcac cattga 456

<210>5

<211>47

<212>DNA

<213>artificial primer

<400>5

catatgttct gtttctggaa gacgtgcacc ggcggtagcg cacctac

47

<210>6

<211>37

<212>DNA

<213>artificial primer

<400>6

caacactgac tcaccatcac catcaccatt gaagctt

37

Claims

1. fusion rotein, comprising: (1) specificity is in conjunction with the target land of tumour cell or tumor vascular endothelial cell; (2) interleukin-.

2. fusion rotein as claimed in claim 1 is characterized in that, described fusion rotein also comprises by no more than 10 joining regions that amino acid is formed, and is used to connect described target land and interleukin-.

3. fusion rotein as claimed in claim 1 is characterized in that, described interleukin-behaviour source interleukin II has the aminoacid sequence shown in SEQ ID NO:1.

4. as claim 1 or 2 or 3 described fusion roteins, it is characterized in that described target land is for being no less than 3 but no more than 50 amino acid whose aminoacid sequences.

5. fusion rotein as claimed in claim 4 is characterized in that, behaviour source, described target land aminoacid sequence.

6. fusion rotein as claimed in claim 4 is characterized in that, described target land and Somatostatin homology.

7. fusion rotein as claimed in claim 6 is characterized in that, the aminoacid sequence and the Somatostatin homology of described target land are not less than 60%.

8. as claim 6 or 7 described fusion roteins, it is characterized in that, the aminoacid sequence of described target land is FCYWKSCT, shown in SEQ ID NO:2, or for the aminoacid sequence shown in the SEQ ID NO.2 has 80% consistence at least through replacing, lacking or add one or several amino acid derived aminoacid sequence with shown in the SEQ IDNO.2, and has the activity of specific combination tumour cell or tumor vascular endothelial cell.

9. fusion rotein as claimed in claim 8 is characterized in that, will the target land shown in SEQ ID NO:2 in tyrosine contain phenyl ring or heterocyclic amino acid is replaced by arbitrary, preferably replace with phenylalanine or tryptophane.

10. fusion rotein as claimed in claim 9 is characterized in that, will the target land shown in SEQ ID NO:2 in Serine replace or disappearance by arbitrary amino acid that contains hydroxyl, preferably replace with Threonine.

11., it is characterized in that wherein said fusion rotein contains the aminoacid sequence just like SEQ ID NO:3 as each described fusion rotein of claim 1-8.

12. the dna molecular of each described fusion rotein of coding claim 1-11.

13. dna molecular according to claim 12 is characterized in that, it contains just like the nucleotide sequence shown in the SEQ IDNO:4.

14. an expression cassette comprises: transcription initiation region; Be subjected to the dna molecular of each described fusion rotein of coding claim 1-11 of transcription initiation region regulation and control; And transcription pausing district.

The expression vector of each described fusion rotein dna molecular of coding claim 1-11 15. recombinated.

16. expression vector as claimed in claim 15 is characterized in that, described expression vector is plasmid or virus.

The cell of the dna molecular of each described fusion rotein of coding claim 1-11 17. recombinated.

18. cell as claimed in claim 17 is characterized in that, described cell is mammalian cell, insect cell, yeast or bacterium.

19. cell according to claim 17 is characterized in that, described cell belongs to intestinal bacteria, is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center, and deposit number is CGMCC No.3867.

20. transgenic animal is characterized in that, transfection each described fusion rotein of coding claim 1-11 dna molecular and express described fusion rotein.

21. the preparation method of each described fusion rotein of claim 1-11 comprises:

Each described cell of claim 17-19 or the described transgenic animal of claim 20 are provided;

Make cell or transgenic animal express described fusion rotein; And separate described fusion rotein.

22. as claim 1-11 fusion rotein purposes in the medicine of making the disease that the treatment cell hyperplasia causes as described in each.

23. purposes as claimed in claim 22 is characterized in that, described disease is a cancer.