CN102260353A - Targeted interleukin fusion protein and preparation method as well as application thereof - Google Patents
Targeted interleukin fusion protein and preparation method as well as application thereof Download PDFInfo
- Publication number
- CN102260353A CN102260353A CN2010105985711A CN201010598571A CN102260353A CN 102260353 A CN102260353 A CN 102260353A CN 2010105985711 A CN2010105985711 A CN 2010105985711A CN 201010598571 A CN201010598571 A CN 201010598571A CN 102260353 A CN102260353 A CN 102260353A
- Authority
- CN
- China
- Prior art keywords
- fusion rotein
- cell
- interleukin
- seq
- aminoacid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to the field of biotechnology and provides a targeted interleukin fusion protein, a DNA (deoxyribonucleic acid) molecule for coding the fusion protein, a carrier containing the DNA sequence, a host cell or a transgenic animal containing the carrier, and a preparation method as well as application of the fusion protein. The fusion protein provided by the invention comprises a targeted connection area and an interleukin from an N terminal to a C terminal, wherein the connection area composed of amino acids (of which the number is not more than 10) can be provided according to conditions to be used for connecting a targeted combination area with the interleukin. Preferably, the targeted combination area is homologous with urokinase. The experiment shows that the fusion protein provided by the invention can improve the concentration of the targeted tissue interleukin as well as reduce the concentration of other tissue interleukins, and can improve the treatment effect as well as reduce the side effect of the IL-2 (interleukin-2), thus the fusion protein can be used for treating tumors and has wide application prospects.
Description
Technical field
The present invention relates to biological field, be specifically related to interleukin 8 plain fusion protein and preparation and its application at field of medicaments.
Background technology
The traditional treatment method for cancer has operative treatment, chemotherapy, radiotherapy and hormonotherapy etc.In recent years, the exploitation selectively acting has become important research exploitation direction in efficient, the low toxicity of specific target spot, the antibumor molecules targeted drug of high specificity.Immunotherapy of tumors has become one of most active antineoplastic target research field, and monoclonal antibody, cell adoptive immunotherapy, tumor vaccine, cytokine therapy have demonstrated the complementarity with traditional remedies.
Interleukin II (IL-2) is a kind of interleukin-well known in the art, be found in 1976, the homo agglutinin of human plants such as Morgan stimulates normal human lymphocyte, find that it can produce a kind of cytokine that can selectivity promotes the T lymphocyte growth, it must with IL-2 receptors bind competence exertion biological effect.IL-2 is multiple biological function cytokine, but the non-specific killing ability of the differentiation of irritation cell poison T lymphocyte, activating cells poison T lymphocyte, natural killer cell, eosinophil, mastocyte also can strengthen the antibody-secreting and the propagation of bone-marrow-derived lymphocyte.Therefore also be mainly used in the systemic immunity that immunological adjuvant is transferred body clinically, reach the purpose of assisting therapy control tumour.
As the interleukin-molecule of first separated purifying, the eighties, U.S. Cetus company exploit person source recombinant il-2 was used for the treatment of cancer, and until 1993, IL-2 was used for the treatment of kidney and melanoma by the FDA approval; At present the IL-2 heavy dose that also goes through is used for the treatment of HIV.Clinical trial shows the efficient low of IL-2 single therapy cancer, and side effect is big.High-dose therapy melanomatous objective efficient be 5-27%, wherein have only patient's state of an illness of 0-4% to alleviate fully.The side effect of IL-2 is big, and patient produces series reaction such as body fluid storage is stayed, diarrhoea, hypopiesia, the small portion death, and these toxic side effect are many, and to cause other histogenic immunity overreactions of whole body of non-treatment focus relevant with IL-2.
Be directed to the limitation of the clinical use of IL-2, it is to reduce drug side effect, raising drug effect, prolong drug transformation period that present IL-2 pharmaceutical grade protein is studied main direction.The tactful polyoxyethylene glycol (PEG) of IL-2 that mainly comprises is modified, is merged prolong half-life with human serum albumin (HSA), glycosylation modified raising IL-2 stability, with the monoclonal antibody fusion drug targeting is arrived specific target spot (as tumour cell), merge generation drug combination effect etc. with other albumen (as immune-regulating factor).In clinical experiment, the IL-2 that PEG modifies compares with IL-2, is not significantly improved the transformation period and efficient, is not used for cancer therapy by the FDA approval so far.Human GenomeSciences company has developed HSA-IL-2 fusion rotein Albuleukin, and bring up to 6 hour from 19 minutes of IL-2 the plasma half-life of intravenous injection Albuleukin, entered the second stage of clinical experiment at present.The 3rd Thr of natural IL-2 is by glycosyl modified, the glycosylation ground means of present IL-2 are divided into eukaryotic cell expression and synthetic glycosylation small peptide is connected two kinds of strategies with IL-2 albumen, Symansis company chooses 293 cell expressing hcxIL-2 in sale on the market, domestic have several laboratories all to develop the glycosylated IL-2 of yeast expression, also is in the development phase at present.At present Merck ﹠ Co., Inc. will resist antibody drug EMD273066 (hu14.18-IL-2) that the C end of Sphingolipids,sialo GD2 merges IL-2 to be used for the treatment of melanoma to have finished the I phase clinical, the result shows among the 33 routine patients, 8 routine stable disease.Do not have 4 grades of toxic reactions (death) and take place, but still find to have 3 grades of toxic reactions such as ypotension, histanoxia.The research that IL-2 is melted into other antibody (as anti-her2 antibody, anti-her3, IgG3 etc.) is also arranged in addition, to strengthen IL-2 inductive T cell to the tumor cytotoxicity specificity.Other IL-2 fusion rotein medicines, as Aerolysin-IL-2, IL-6-IL-2, GCSF-IL-2, recombinant human alpha prothymosin-interleukin-22 etc., the effect of generation drug combination.
The problem that may exist for the interleukin-2 with the connection/fusion of biomacromolecule coupling is, being multiplied of drug molecule amount makes it more be difficult to pass physiologic barrier arrival target tissue though the transformation period prolongs, especially poor to the wetting property of large-scale solid tumor, make it be difficult to pass physiologic barrier and arrive tumor locus.The not high meeting of the specificity of targeted drug and affinity causes targeted drug injuring normal cell before the arrival target tissue, has consumed drug effect.
At the problems referred to above, at first will select the high tumour antigen of specificity is target spot, also to carry out appropriate design to targeted drug in addition by protein engineering, reduce molecular mass, improve avidity and specificity, increase the concentration and the distribution that reduce in healthy tissues of medicine, reduce Normocellular toxic side effect at tumor tissues.Can select target short peptide and the non-antibody albumen of main target, wherein have at the NGR of endothelial cells in tumor neogenetic blood vessels surface molecular aminopeptidase N and the RGD of integrin (integrins α v β 3) in endothelial cells in tumor neogenetic blood vessels and tumour cell.Utilize the developing drugs of above-mentioned relevant target peptide as some, successfully entered clinical experiment.Modmed company exploitation ARENEGYR just is NGR fusion tumour necrosis factor (NGR-hTNF α), and being used for the treatment of the rectum cancer, liver cancer, mesothelioma, to have entered the II phase clinical.It is clinical that the medicine 18F-AH111585 (radiolabeled RGD) that GE company exploitation is used for diagnosing tumor also enters first phase.
Urokinase such as Sostatin (Octreotide) successfully have been used for the clinical treatment of cardiovascular disorder (cerebral thrombosis etc.) and carcinoid, glucagonoma of pancreas, gastrinoma etc. respectively as single medicine, have fully supported reasonableness and feasibility that urokinase is selected as the target peptide.
Summary of the invention
The purpose of this invention is to provide a kind of target interleukin fusion rotein, this fusion rotein can specificity in conjunction with some cell particularly tumor tissue cell or its new vessel endotheliocyte, the plain concentration of significant leukocyte increasing Jie in target tissue, reduce its concentration at its hetero-organization, thereby the raising result of treatment reduces toxic side effect.
In order to realize the foregoing invention purpose, the present invention by the following technical solutions:
A kind of fusion rotein is held to C end from N to comprise the target land of (1) specificity in conjunction with tumour cell or tumor vascular endothelial cell; (2) interleukin-.
According to circumstances, fusion rotein of the present invention can be used to connect described target land and interleukin-by no more than 10 joining regions that amino acid is formed.
In one embodiment of the invention, there are three amino acid the joining region: glycine-glycine-Serine-(GGS), 6 amino acid are arranged in another embodiment: glycine-glycine-Serine-glycine-glycine-Serine (GGSGGS).
As preferably, interleukin-behaviour source interleukin II has the aminoacid sequence as SEQ ID NO:1 in the fusion rotein of the present invention.
Interleukin II (IL-2) nucleotide sequence GenBank accession number NM_000586.3.IL-2 also is the cytokine of, purifying the most separated as far back as molecular level, evaluation.It is to have multi-functional secretion monomer glycoprotein.After cutting the signal peptide of 20 hydrophobic amino acids of N end, ripe IL-2 is that 133 amino acid are formed, and molecular weight is 15.5kD.IL-2 contains three halfcystines (Cys58, Cys105 and Cys125), and preceding two Cys form intrachain disulfide bond, and its stability and function performance are had vital role.So industrial normal preparation IL-2 mutant IL-2C125S, to promote the correct pairing of its disulfide linkage.In one embodiment, the people source interleukin II in the fusion rotein of the present invention contains the described aminoacid sequence just like SEQ IDD NO:1, and wherein the 125th halfcystine (C) sports Serine (S).
As preferably, behaviour source, target land aminoacid sequence in the fusion rotein of the present invention.
More preferably, described target land and urokinase homology, the aminoacid sequence and the urokinase homology of described target land are not less than 60%.
In embodiment, the present invention specifically provides a kind of fusion rotein, the aminoacid sequence of its target land is shown in SEQ ID NO:2, or for the aminoacid sequence shown in the SEQ ID NO.2 has 80% consistence at least through replacing, lacking or add one or several amino acid derived aminoacid sequence with shown in the SEQ IDNO.2, and has the activity of specific combination tumour cell or tumor vascular endothelial cell.
In one embodiment, the target land can be to comprise being no less than 3 but no more than 50 amino acid whose aminoacid sequences in the fusion rotein of the present invention, preferred sequence contains no more than 25 aminoacid sequences of urokinase homologous, in a preferred embodiment, the target land of fusion rotein of the present invention contains the described aminoacid sequence just like SEQ ID NO:2, its N-terminal can have the methionine(Met) of the initiator codon translation of escherichia coli expression, may be excised by heterogeneity in translation process.
In a preferred embodiment, the invention provides a kind of concrete fusion rotein, contain the described aminoacid sequence just like SEQ IDD NO:3, note is made UIL.Be convenient to purifying in order to make fused protein, can include but not limited to poly Histidine (Poly-His is generally 6 Histidines), poly arginine (Poly-Arg is generally 5-6 arginine) etc. at amino (N) end or the terminal upper amino acid label that connects of carboxyl (C).
Another aspect of the present invention also provides the dna molecular of the fusion rotein of the present invention of encoding.Owing to the degeneracy of codon, can there be the nucleotide sequence of a variety of specific proteins of the present invention of can encoding.In one embodiment, the invention provides to encode contains dna molecular just like the fusion rotein of the described aminoacid sequence of SEQ IDD NO:3, and its nucleotide sequence is shown in SEQ IDD NO:4.
In order to produce fusion rotein of the present invention, the dna molecular of encoding fusion protein is integrated in the expression cassette, and expression cassette is inserted into suitable expression vector subsequently.Then, this expression vector is changed over to host cell or animal is used for expression of recombinant proteins.
Expression cassette comprises following content at least: can the encode dna molecular of fusion rotein of the present invention of (1) transcription initiation region, (2), this is transcribed is to carry out under the regulation and control at transcription initiation region, and (3) transcription pausing district.
According to the difference of the host cell that is used for protein expression, transcription initiation region and transcription pausing district can be natural existence or artificial constructed sequence, and this sequence is suitable for the genetic transcription in eucaryon or the prokaryotic cell prokaryocyte.This type of sequence is well known in the present technique field.The suitable DNA sheet that contains transcriptional initiation sequence is connected with the dna fragmentation of encoding fusion protein with the suitable dna fragmentation that contains the transcription pausing district.This method of attachment is well known in the present technique field, such as, select suitable digestion with restriction enzyme and connection.
The present invention further provides has recombinated the encode expression vector of dna molecular of fusion rotein of the present invention and the cell and transgenic animal of expressing described fusion rotein.Described expression vector preferred plasmid or virus.Described cell can be mammalian cell, insect cell, yeast or bacterium.Transgenic animal can be transgenic sheeps, ox, or the like.
In an embodiment of the present invention, a kind of intestinal bacteria of dna molecular of fusion rotein of the present invention of encoding of having recombinated specifically are provided, described intestinal bacteria are deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 24th, 2010, and deposit number is CGMCC No.3868.
In addition, the present invention also provides the production method of described fusion rotein, may further comprise the steps: the cell or the transgenic animal of the dna molecular that contains the fusion rotein of the present invention of encoding are provided, make this cell or transgenic animal express described fusion rotein and separate described fusion rotein.Experiment shows, fusion rotein of the present invention can be by activating NK cell, CTL cell, LAK cell at tumor tissues/position, improve the ability of immunity system killing tumor cell, fusion rotein anti-tumor in vivo activity research proof UIL low dose group drug effect of the present invention is better than the interleukin II low dose group, therefore the present invention also provides the application of described fusion rotein, promptly is used for the treatment of the purposes in the medicine of the disorders such as cancers that disease that cell hyperplasia causes or preparation treatment cell hyperplasia cause.
Biological preservation explanation
Classification name: colon bacillus, Escherichia coli. is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 24th, 2010, the address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.3868.
Description of drawings:
Fig. 1 shows fusion rotein structural representation of the present invention.
A: target land; B: joining region; C: people source interleukin II.
Fig. 2 shows the SDS-PAGE qualification result behind the fusion rotein UIL expression and purification of the present invention.
Swimming lane 1: molecular weight Marker; Be followed successively by 97.0kDa, 66.0kDa, 45.0kDa, 30.0kDa, 20.1kDa, 14.4kDa from top to bottom.
Swimming lane 2: the host bacterium lysate of expressed fusion protein;
Swimming lane 3: the inclusion body of final washing;
Swimming lane 4: through the target protein of Ni Sepharose High Performance protein affinity purification.
Fig. 3 shows the SDS-PAGE result of fusion rotein UIL renaturation of the present invention.
The non-reduced electrophoresis of O:UIL;
M: molecular weight Marker is followed successively by 97.0kDa, 66.0kDa, 43.0kDa, 30.0kDa, 20.1kDa, 14.4kDa from top to bottom;
R:UIL reduces electrophoresis;
Fig. 4 shows fusion rotein UIL carbon 18 reversed phase high efficiency liquid phase analysis figure (C18RP-HPLC) of the present invention, chromatography column: ZORBA 300SB-C185um, 4.6*250mm; Detect wavelength: 280nm; Purity: 96.7%.
The external target of Fig. 5 fusion rotein UIL of the present invention is in conjunction with experimental result.
Fig. 6 fusion rotein UIL of the present invention anti-tumor in vivo activity test criterion is from left to right for tumour gets nowhere, tumour does not have obvious progress, the tumour major progress.
Embodiment:
The invention discloses a kind of interleukin 8 plain fusion protein and preparation and its application at field of medicaments, those skilled in the art can use for reference this paper content, suitably improve processing parameter and realize.Special needs to be pointed out is that all similarly replace and change apparent to those skilled in the art, they all are regarded as being included in the present invention.Product of the present invention, method and application are described by preferred embodiment, the related personnel obviously can change or suitably change and combination methods and applications as herein described in not breaking away from content of the present invention, spirit and scope, realizes and use the technology of the present invention.
According to the present invention, a kind of fusion rotein of interleukin-of target is held to C end from N to comprise the target land of (1) specificity in conjunction with tumour cell or tumor vascular endothelial cell; (2) no more than 10 amino acid whose joining regions according to circumstances can be arranged; (3) interleukin-aminoacid sequence
In one embodiment, the target land can be to comprise being no less than 3 but no more than 50 amino acid whose aminoacid sequences in the fusion rotein of the present invention, preferred sequence contains no more than 15 aminoacid sequences of urokinase homologous, in a preferred embodiment, the target land of fusion rotein of the present invention contains the described aminoacid sequence just like SEQ ID NO:2, wherein the N end can have the methionine(Met) of the initiator codon translation of escherichia coli expression, may be excised by heterogeneity in translation process.
The target land of fusion rotein of the present invention can directly connect together by peptide bond or by the joining region with interleukin-.Depend on the needs, the joining region can have 2 to 10 amino acid to connect target land and interleukin II.
In one embodiment, there are three amino acid the joining region: glycine-glycine-Serine-(GGS), 6 amino acid glycine-glycine-Serine-glycine-glycine-Serines (GGSGGS) are arranged in another embodiment.
In a preferred embodiment, fusion rotein of the present invention contains the described aminoacid sequence just like SEQ IDDNO:4, and note is made UIL.
In a preferred embodiment, fusion rotein of the present invention contains the described aminoacid sequence just like SEQ IDDNO:3.
Another aspect of the present invention also provides the dna molecular of the above-mentioned fusion rotein of code book invention.Owing to the degeneracy of codon, can there be the nucleotide sequence of a variety of specific proteins of the present invention of can encoding.In one embodiment, the invention provides to encode contains dna molecular just like the fusion rotein of the described aminoacid sequence of SEQ IDD NO:3, and its nucleotide sequence is shown in SEQ IDD NO:4.
In order to produce fusion rotein of the present invention, the dna molecular of encoding fusion protein is integrated in the expression cassette, and expression cassette is inserted into suitable expression vector subsequently.Then, this expression vector is changed over to host cell or animal is used for expression of recombinant proteins.
Expression cassette comprises following content at least: can the encode dna molecular of fusion rotein of the present invention of (1) transcription initiation region, (2), this is transcribed is to carry out under the regulation and control at transcription initiation region, and (3) transcription pausing district.
According to the difference of the host cell that is used for protein expression, transcription initiation region and transcription pausing district can be natural existence or artificial constructed sequence, and this sequence is suitable for the genetic transcription in eucaryon or the prokaryotic cell prokaryocyte.This type of sequence is well known in the present technique field.The suitable DNA sheet that contains transcriptional initiation sequence is connected with the dna fragmentation of encoding fusion protein with the suitable dna fragmentation that contains the transcription pausing district.This method of attachment is well known in the present technique field, such as, select suitable digestion with restriction enzyme and connection.
Expression cassette can be integrated the insertion expression vector, and this expression vector is changed over to host cell or animal subsequently.Generally speaking, expression vector also will comprise the replication initiation sequence, and selection markers, and for example, for the protein expression of bacterium, plasmid is a kind of carrier on way of great use.The a variety of plasmid vectors that can be used for this purpose well known are arranged in the present technique field, comprise, but be not limited only to pET15b, pET22b, pET25b, pET28b or the like.If come recombinant expressed fusion rotein by yeast cell, Yeast expression carrier, such as pPIC9, pAO815, pPICZ or the like can be used as expression vector.If carry out protein expression, a lot of suitable expression of recombinant proteins carriers are arranged also by mammalian cell.Be used for the dna sequence dna that the proteic expression vector of mammalian cell expression comprises, need to be fit to integrate the insertion host cell chromosome in the homologous recombination mode.Mammalian cell expression vector, such as pcDNA3.1, pSI or the like.For coming expressed fusion protein by animal, be used to produce the technique means of the transgenic animal that contain expression cassette (transgenic sheep, ox, or the like), well known in the present technique field.Such as pBLG or the like, can be used as the carrier that transgenic animal are expressed.
After obtaining transformed host cells or transgenic animal, can under the condition that is fit to expression fusion rotein of the present invention, give expression to fusion rotein.Difference by its physico-chemical property and other characteristic is used various separation method separation and purification fusion roteins.These methods are well-known to those skilled in the art, for example: the combination of conventional purification process such as conventional sex change renaturation handles, centrifugal, ultrasonication, ultrafiltration membrance filter, metal affinity chromatography, ion exchange chromatography, gel permeation chromatography, dialysis, high performance liquid chromatography and these methods.
Fusion rotein of the present invention is by activating the ability that NK cell, CTL cell, LAK cell etc. improve local organization and/or organ immunity system killing tumor cell at tumor tissues/position.Another aspect of the present invention also provides the medicinal use of described fusion rotein, maybe can produce the medicine that is used for the treatment of a kind of disease, be preferred for treating the purposes in the medicine of the disorders such as cancers that disease that cell hyperplasia causes or preparation treatment cell hyperplasia cause.
Below in conjunction with embodiment, further set forth the present invention.
N-terminal and N-terminal aminoacid sequence and the additional target of N-terminal land amino acid to be added based on fusion rotein, by IL-2 sequence and the sequence that contains urokinase and land of increasing respectively, then by overlapping PCR link target sequence and IL-2 sequence.Mainly finish by following 3 steps:
(1) amplification of IL2 sequence
The design primer sequence is as follows:
5 upstream primer sequence: GCACCTACTTCAAGTTCTACAAAGAAAAC (shown in SEQ ID NO:5); Wherein contain the interleukin II anneal sequence;
3 (downstream) primer sequence:
CCCAAGCTT
CAAGTCAGTGTTGAGATGATGCTTTGAGAAAAG (shown in SEQ IDNO:6); Wherein contain anneal sequence, terminator codon and subsequent HindIII site, the amplification dna sequence dna of human interleukin-12 (IL-2) that obtains encoding from people's liver cDNA library, also directly the dna sequence dna of composite coding human interleukin-12 (C125S) as template, go out IL-2 by pcr amplification, reclaim the PCR product.
(2) synthetic urokinase target peptide and the joining region dna sequence dna of containing
The following sequence of chemosynthesis at first: comprise NdeI site, initiator codon and urokinase sequence and link zone aminoacid sequence;
CGCCATGGGTCATATGGATTGTCTAAATGGAGGCACGGCAGTATCAAACAAGTACT TCTCCAACATCCACTGGTGTAACGGTGGCAGCGGCGGTAGC (shown in SEQ ID NO:7)
5 upstream primer sequence: CGCCATGGGTCATATGGATTGTCTAAATGGAGG (shown in SEQ ID NO:8) with urokinase;
The anneal sequence that wherein contains NdeI site and initiator codon and urokinase, 3 (downstream) primer sequence
AGAACTTGAAGTAGGTGCGCTACCGCCGCTGCCACCGTTACACCAGTG (shown in SEQ ID NO:9) (wherein contains partly and IL-2 paired zone: TTGAA), dna sequence dna with above-mentioned chemosynthesis is template pcr amplification urokinase and link zone sequence, reclaims the PCR product.
(3) connect target peptide and IL-2 by overlapping PCR
3 (downstreams) end primer with urokinase 5 (upstream) end primer and IL-2 is that template amplification goes out full length fragment with the recovery PCR product that (1), (2) operation obtain.
((toolenzyme is all available from Takara company to cut pcr amplification product and pET25b empty plasmid with NdeI and HindIII enzyme, plasmid is available from Novage company), above-mentioned endonuclease bamhi all reclaims the fragment of corresponding size with sepharose, connect each fragment with the T4DNA ligase enzyme, the recombinant plasmid of gained is interleukin-Expression of Fusion Protein carrier, called after pET-U-IL.The fusion rotein structure as shown in Figure 1.At first, in containing the substratum of penicillin, after the incubated overnight, select positive bacterium colony and therefrom prepare DNA in a large number ligation mixture transformed into escherichia coli XL-1Blue.Through dna sequence analysis gas nucleotide sequence shown in SEQ ID NO:4, after further confirming the sequence exactness, with this recombinant plasmid transformed in competence e. coli bl21 (DE3) bacterial strain (Novagen) that carries the T7 promoter gene, be the engineering bacteria (UIL-BL21) of expressing corresponding protein, this project bacterium classification name: colon bacillus, Escherichia coli. is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 24th, 2010, the address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.3868.
Embodiment 2: Expression of Fusion Protein of the present invention and purifying
The e. coli bl21 that recombinant plasmid pET-S-IL transforms is cloned cultivation (37 ℃) in the culturing bottle that is added in the LB substratum, treat that bacterial density reaches OD600 ≈ 4-6, carry out the 5L fermentor cultivation by inoculum size 5-10%, treat OD600 ≈ 10-20, in substratum, add 0.5-1mM isopropyl-(IPTG) and carry out abduction delivering, to inducing back OD600 no longer to increase following jar, with 10,000g * (15 minutes) centrifugal results thalline.
The thalline of results is resuspended in the 3M urea 100mM phosphoric acid 20mM Tris pH8.0 damping fluid (buffer), and room temperature was placed 1 hour, and with cell supersound process 3 times, 20, the centrifugal collection inclusion body of 000g.Then solubilization of inclusion bodies was placed 4 hours in 8M urea 100mM sodium phosphate 50mM mercaptoethanol Tris (pH 8.0) buffering, collected supernatant in centrifugal 20 minutes with 20000g.
Supernatant liquor is splined on Ni Sepharose HighPerformance (GE company) the affinity post of crossing with above-mentioned damping fluid pre-equilibration, carry out the pH wash-out that successively decreases with 8M urea 100mM sodium phosphate 20mM imidazole buffer with pH 8.0-4.0, obtain purity during pH4.0 greater than 90% recombinant protein, as shown in Figure 2, its aminoacid sequence is shown in SEQ ID NO:3.
Will be as stated above from Ni
+The eluate that contains the purpose fusion rotein that the affinity post elutes, by 1: 10 volume ratio be diluted in rapidly contain 3M urea, 100mM NaCl, 20mMTris-HCl (pH 8.0), 5mM also in the solution of ortho states gsh and 0.05mM oxidation state gsh so that protein refolding (renaturation).Dialyse in PBS after placing 48 hours through 4 ℃, and be that 5000 daltonian ultra-filtration membranes are concentrated, carry out the purity of protein analysis, as shown in Figure 3 and Figure 4 with molecular weight cut-off.
Embodiment 3: the external target Journal of Sex Research of fusion rotein of the present invention
With human hepatoma cell strain SMMC-772 vitro culture, digest centrifugal, above-mentioned cell is inoculated into respectively in the 12 porocyte culture plates, treat that cell grows to culture plate about 70%, add the interleukin II of different concns and fusion rotein U-interleukin-22 of the present invention (UIL) sample (final concentration is respectively 2000IU/ml, 1000IU/ml, 500IU/ml) of embodiment 1-2 preparation, if PBS negative control group, abandon supernatant behind the about 4h of effect after the dosing, with PBS continuous wash three times, rinse the back well and add density 30 * 10
4IL-2 dependent form mouse T lymphocyte (CTLL-2) the cell 1ml of/ml, incubated overnight, microscopically was observed in second day, when treating the basic apoptosis of negative control hole CTLL-2 cell, every hole adds the about 100ul of tetramethyl-tetrazolium bromide (MTT) of 5mg/ml, acts on about 4h, adds the SDS-HCl lysate and spends the night, microplate reader 570nm surveys the OD value down, calculates the CTLL-2 proliferation rate.
Calculation formula: CTLL-2 proliferation rate=(OD
The dosing group/ OD
Blank group-1) * 100%
The result shows: the interleukin II (IL-2) of no target land and gastric carcinoma cells (SGC-7901) debond, UIL can be with it in conjunction with and be dosage correlation, the MTT result consistent with the microscopically observations (as Fig. 5) that develops the color, tumour cell and endotheliocyte expression urokinase receptor is described, though the target land combination with it of variant fusion rotein.
Embodiment 4: fusion rotein anti-tumor in vivo activity research of the present invention
With kunming mice abdominal cavity inoculation rat liver cancer cell H22, inoculum density 1 * 10
6/ ml, volume 0.2ml/ only, inoculate back second day and begin the administration of dividing into groups, being divided into is 5 groups, is respectively: the fusion rotein UIL high dose group of the present invention (8000IU/ only) of physiological saline group, interleukin II high dose group (8000IU/ only), interleukin II low dose group (4000IU/ only), embodiment 1-2 preparation, the fusion rotein UIL low dose group of the present invention (4000IU/ only) of embodiment 1-2 preparation; Every group of 10 mouse, every day intraperitoneal administration once, successive administration stopped administration after 12 days, observation to 20 day, the record experimental result, the tumour that is considered as that mouse web portion is smooth gets nowhere, and the mouse web portion medicine-feeding part causes being considered as that local subcutaneous heaves not have obvious progress because knurl liquid oozes out, the obvious enlargement of the whole belly of mouse be considered as tumour major progress (referring to Fig. 6), statistics is respectively organized the tumour progression situation respectively; Net result is all obviously enlargements of 10 mouse web portions of physiological saline group, and major progress all appears in tumour; The interleukin II high dose group has 5 major progress to occur, and 5 get nowhere or obviously make progress; The interleukin II low dose group has 7 major progress to occur, and 3 get nowhere or obviously make progress; The UIL high dose group has 6 major progress to occur, and 4 get nowhere or obviously make progress; The UIL low dose group has 5 major progress to occur, and 5 get nowhere or obviously make progress; Final result proves that UIL low dose group drug effect is better than interleukin II low dose group (as shown in table 1).
Table 1, fusion rotein anti-tumor in vivo test-results of the present invention
| Evaluation index | Tumour has major progress (only) | Tumour gets nowhere or obviously makes progress (only) |
| The |
10 | 0 |
| (8000IU/ only-d) for IL-2 | 5 | 5 |
| (4000IU/ only-d) for IL-2 | 7 | 3 |
| (8000IU/ only-d) for |
6 | 4 |
| (4000IU/ only-d) for |
5 | 5 |
The above only is a preferred implementation of the present invention; should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the principle of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (20)
1. fusion rotein, comprising: (1) specificity is in conjunction with the target land of tumour cell or tumor vascular endothelial cell; (2) interleukin-.
2. fusion rotein as claimed in claim 1 is characterized in that, described fusion rotein also comprises by no more than 10 joining regions that amino acid is formed, and is used to connect described target land and interleukin-.
3. fusion rotein as claimed in claim 1 is characterized in that, described interleukin-behaviour source interleukin II has the aminoacid sequence shown in SEQ ID NO:1.
4. as claim 1 or 2 or 3 described fusion roteins, it is characterized in that described target land is for being no less than 3 but no more than 50 amino acid whose aminoacid sequences.
5. fusion rotein as claimed in claim 4 is characterized in that, behaviour source, described target land aminoacid sequence.
6. fusion rotein as claimed in claim 4 is characterized in that, described target land and urokinase homology.
7. fusion rotein as claimed in claim 6 is characterized in that, the aminoacid sequence and the urokinase homology of described target land are not less than 60%.
8. as claim 6 or 7 described fusion roteins, it is characterized in that, the aminoacid sequence of described target land is shown in SEQ ID NO:2, or for the aminoacid sequence shown in the SEQ ID NO.2 has 80% consistence at least through replacing, lacking or add one or several amino acid derived aminoacid sequence with shown in the SEQ ID NO.2, and has the activity of specific combination tumour cell or tumor vascular endothelial cell.
9. as each described fusion rotein of claim 1-8, it is characterized in that wherein said fusion rotein contains the aminoacid sequence just like SEQ ID NO:3.
10. the dna molecular of each described fusion rotein of coding claim 1-9.
11. dna molecular according to claim 10 is characterized in that, it contains just like the nucleotide sequence shown in the SEQ IDNO:4.
12. an expression cassette comprises: transcription initiation region; Be subjected to the dna molecular of each described fusion rotein of coding claim 1-9 of transcription initiation region regulation and control; And transcription pausing district.
The expression vector of each described fusion rotein dna molecular of coding claim 1-9 13. recombinated.
14. expression vector as claimed in claim 13 is characterized in that, described expression vector is plasmid or virus.
The cell of the dna molecular of each described fusion rotein of coding claim 1-9 15. recombinated.
16. cell as claimed in claim 15 is characterized in that, described cell is mammalian cell, insect cell, yeast or bacterium.
17. cell according to claim 15 is characterized in that, described cell belongs to intestinal bacteria, is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center, and deposit number is CGMCC No.3868.
18. transgenic animal is characterized in that, transfection each described fusion rotein of coding claim 1-9 dna molecular and express described fusion rotein.
19. the preparation method of each described fusion rotein of claim 1-9 comprises:
Each described cell of claim 15-17 or the described transgenic animal of claim 18 are provided;
Make cell or transgenic animal express described fusion rotein; And separate described fusion rotein.
20. as claim 1-9 fusion rotein purposes in the medicine of making the disease that the treatment cell hyperplasia causes as described in each.
21 purposes as claimed in claim 20 is characterized in that, described disease is a cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105985711A CN102260353A (en) | 2010-05-28 | 2010-12-21 | Targeted interleukin fusion protein and preparation method as well as application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010185504 | 2010-05-28 | ||
| CN201010185504.7 | 2010-05-28 | ||
| CN2010105985711A CN102260353A (en) | 2010-05-28 | 2010-12-21 | Targeted interleukin fusion protein and preparation method as well as application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102260353A true CN102260353A (en) | 2011-11-30 |
Family
ID=45007210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105985711A Pending CN102260353A (en) | 2010-05-28 | 2010-12-21 | Targeted interleukin fusion protein and preparation method as well as application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102260353A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103990121A (en) * | 2013-12-06 | 2014-08-20 | 上海联合赛尔生物工程有限公司 | Antigen chimera, antigen composition, vaccine and preparation method and kit thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997012905A1 (en) * | 1993-04-02 | 1997-04-10 | The General Hospital Corporation | Urokinase plasminogen activator fragments |
| US20040249178A1 (en) * | 2001-05-18 | 2004-12-09 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| CN101182349A (en) * | 2007-10-08 | 2008-05-21 | 王自正 | Recombinant octreotide and uses thereof |
-
2010
- 2010-12-21 CN CN2010105985711A patent/CN102260353A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997012905A1 (en) * | 1993-04-02 | 1997-04-10 | The General Hospital Corporation | Urokinase plasminogen activator fragments |
| US20040249178A1 (en) * | 2001-05-18 | 2004-12-09 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| CN101182349A (en) * | 2007-10-08 | 2008-05-21 | 王自正 | Recombinant octreotide and uses thereof |
Non-Patent Citations (4)
| Title |
|---|
| GENBANK ACCESSION: "3INK_C", 《GENBANK》, 10 July 2009 (2009-07-10) * |
| GENBANK ACCESSION: "AAS17753.1", 《GENBANK》, 15 February 2004 (2004-02-15) * |
| JULIANA HAMZAH ET AL.: "Vascular targeting of anti-CD40 antibodies and IL-2 into autochthonous tumors enhances immunotherapy in mice", 《THE JOURNAL OF CLINICAL INVESTIGATION》, 30 May 2008 (2008-05-30) * |
| KARINE PERON ET AL.: "Targeting of a novel fusion protein containing methioninase to the urokinase receptor to inhibit breast cancer cell migration and proliferation", 《CANCER CHEMOTHER PHARMACOL》, 31 December 2003 (2003-12-31) * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103990121A (en) * | 2013-12-06 | 2014-08-20 | 上海联合赛尔生物工程有限公司 | Antigen chimera, antigen composition, vaccine and preparation method and kit thereof |
| CN103990121B (en) * | 2013-12-06 | 2015-07-08 | 上海联合赛尔生物工程有限公司 | Antigen chimera, antigen composition, vaccine and preparation method and kit thereof |
| US10513543B2 (en) | 2013-12-06 | 2019-12-24 | Shanghai United Cell Biotechnology Co., Ltd. | Antigen chimera, antigen composition, vaccine, method of preparing the same and cassette thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20190216898A1 (en) | Interleukin Combination and Use Thereof | |
| WO1996010089A1 (en) | Modification of peptide and protein | |
| CN102898526A (en) | Tumor necrosis factor-related apoptosis-inducing ligand fusion protein, its preparation and application | |
| ES2326347T3 (en) | METHOD TO REGULATE THE PRODUCTION OF NITRIC OXIDE. | |
| EP2343081A1 (en) | Interferon analogs | |
| CN102250254A (en) | Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) fusion protein, its preparation and applications | |
| CN102775502A (en) | Alpha-interferon fusion protein | |
| CN102260352B (en) | Targeted interleukin fusion protein as well as preparation method thereof and application thereof | |
| CN100537765C (en) | The preparation technology of recombinant human blood vessel chalone K1-3 and the application of goods in anti-tumor medicine thereof | |
| CN102286490A (en) | Preparation and renaturation method of chicken interferon gamma | |
| CN102260353A (en) | Targeted interleukin fusion protein and preparation method as well as application thereof | |
| CN101407546B (en) | Human anti-human tumor necrosis factor-alpha single chain antibody | |
| CN101875923A (en) | Fusion protein of human serum albumin and urate oxidase and preparation method thereof | |
| Danley et al. | Crystallizable HIV-1 protease derived from expression of the viral pol gene in Escherichia coli | |
| CN109776653B (en) | Human serum albumin adhesion peptide and application thereof | |
| CN103755813A (en) | Targeting anti-tumor fusion protein, and encoding gene and expression plasmid thereof | |
| CN102391377A (en) | Fusion protein capable of inducing and activating cancer targeting T-cells as well as preparation method and application of the fusion protein | |
| CN101456913B (en) | Anti-tumor fusion protein and use thereof | |
| Hwang et al. | A 20 amino acid synthetic peptide of a region from the 55 kDa human TNF receptor inhibits cytolytic and binding activities of recombinant human tumour necrosis factor in vitro | |
| CN103232543B (en) | Recombinant protein Tumstatin-CD137L4 with Tumstatin activities as well as preparation method and application thereof | |
| CN104530212A (en) | Immunoregulation peptide, and preparation method and application thereof | |
| CN101705240A (en) | Synthesis of batroxobin gene and preparation method of expression product thereof | |
| CN102585013B (en) | Fusion protein containing omega interferon and method for preparing same | |
| CN101070547B (en) | Recombined protein carrier PEA II-HphA of actively carrying exogenic gene, its preparing method and use | |
| CN108864298A (en) | A kind of canine recombinant long-acting interferon and the fusion protein for preparing this long-acting interferon and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20111130 |