CN108218978B - Recombinant interleukin 18 and preparation method and application thereof - Google Patents
Recombinant interleukin 18 and preparation method and application thereof Download PDFInfo
- Publication number
- CN108218978B CN108218978B CN201611146887.0A CN201611146887A CN108218978B CN 108218978 B CN108218978 B CN 108218978B CN 201611146887 A CN201611146887 A CN 201611146887A CN 108218978 B CN108218978 B CN 108218978B
- Authority
- CN
- China
- Prior art keywords
- recombinant interleukin
- seq
- rhil
- cells
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The invention relates to the technical field of biology, in particular to recombinant interleukin 18 and a preparation method and application thereof. The rhIL-18 provided by the invention is mutated into a hydroxylated amino acid residue from serine at the 10 th site of the N end, and experiments are carried out by using the hrIL-18 shown as SEQ ID NO. 1, so that the defects of low solubility, poor stability, low biological activity and the like of the wild type IL-18 are overcome, and the hrIL-18 shown as SEQ ID NO. 1 is easier to purify and is suitable for industrial production. The rhIL-18 provided by the invention can inhibit the generation of human endothelial cell microtubules, can promote the activity of NK cells and promote the formation of IFN-gamma; the rhIL-18 can be used as a medicine for treating fundus neovascular diseases and/or malignant tumors.
Description
Technical Field
The invention relates to the technical field of biology, in particular to recombinant interleukin 18 and a preparation method and application thereof.
Background
Abnormal neovascularization behind the macular retina occurs, known as wet age-related macular degeneration (AMD); specific ocular fundus lesions in diabetic microangiopathies, such as retinal neovascularization, are known as Diabetic Retinopathy (DR). 9300 million global Diabetic Retinopathy (DR) patients in 2013, wherein 1700 million Proliferative DR (PDR) patients, 2100 million diabetic macular edema patients and 2800 million vision-threatening DR patients. The incidence rate of diabetic retinopathy is 25 percent after 5 years of diabetes attack, the incidence rate is increased to 60 percent after 10 years, and the incidence rate can reach 75 to 80 percent after 15 years. Therefore, the preparation method accelerates the development of a novel preparation for treating fundus vasculopathy, and has social benefits and huge economic benefits.
Currently, symptomatic or adjuvant therapy is mainly used clinically to control or delay the progression of AMD or DR for the lack of ideal treatment of AMD or DR, and commonly used therapeutic methods include hypoglycemic drugs, anti-inflammatory drugs, topical TNF- α antagonists, fenofibrate, Vascular Endothelial Growth Factor (VEGF) antagonists, RAS system inhibitors, non-enzymatic glycosylation inhibitors, combination therapies and laser treatments.
IL-18 was reported as an IFN γ -inducing factor in 1995, and it was subsequently demonstrated that systemic injection of IL-18 (50. mu.g/kg) into mice for 6 days had an inhibitory effect on FGF-induced corneal capillary formation. It has also been reported that IL-18 has a regulatory effect on the production of pathological neovasculature of the retina in an oxygen-induced model of mouse retinopathy. Doyle et al have recently reported that intraocular or systemic injection of murine IL-18(SB-528775) can prevent experimentally induced CNV. Therefore, IL-18 is feasible either alone or in combination with anti-neovascular drugs to reduce the frequency of intraocular injections. The authors also demonstrated that recombinant IL-18, both murine and human, was very safe for retinal pigment epithelial cells (RPE), a key cell for dysfunction in AMD. When patients with high IL-18 content in aqueous humor receive Lucentis monoclonal antibody to treat macular edema and retinal vein embolism, the patients can obviously improve visual effect, the patients simultaneously prove that VEGF regulates and controls IL-18 content in a mutual inhibition mode, a plurality of retina/CNV models prove that recombinant IL-18 can regulate fundus exudation of pathological models, the patients propose that IL-18 can possibly become a new method for regulating and controlling pathological angiogenesis of eyes, and the result is consistent with the reports of Doyle and the like.
In 2006, recombinant human IL-18 (trade name: Iboktadekin) was introduced into clinical trials as an antitumor agent, developed by GlaxoSmithKline. There have been many papers reporting that IL-18 is safe in human testing and no reports have been made about ocular side effects. In addition, systemic injection of IL-18 in rodents has been reported to detect higher levels of IL-18 in the retina, which suggests bioavailability of IL-18 in the retina. IL-18 administration to patients may cause transient fever of grade 1-2, but may provide rapid relief. No significant side effects were observed on the eyes of the patients at doses up to 2000. mu.g/kg. The research result of the recombinant IL-18 in ophthalmology indicates that the IL-18 may have application value to ocular pathological neovascular diseases. Since the clinical trial of IL-18 has been proven safe, IL-18 can be used in the study of adjunctive therapy for CNV and wet AMD, and it is worth further investigation as to whether it is an effective drug.
At present, the preparation of recombinant human IL-18 is mainly carried out in a bioengineering way, but due to the structural particularity of an IL-18 sequence, the recombinant human IL-18 is not easy to purify in the biosynthesis process and has low activity after the synthesis. Therefore, the problems of low purity, low recovery rate, and low yield, etc., lead to an increase in the production cost of IL-18, which in turn leads to an increase in the price.
Disclosure of Invention
In view of this, the technical problem to be solved by the present invention is to provide a recombinant interleukin 18, and a preparation method and applications thereof. The recombinant interleukin 18 provided by the invention has higher biological activity.
The invention provides a recombinant human interleukin 18, wherein the 10 th site of the N end of the recombinant human interleukin 18 is mutated into hydroxylated amino acid residue from serine.
In the embodiment of the invention, the amino acid sequence of the recombinant interleukin 18 is shown as SEQ ID NO. 1.
The recombinant interleukin 18 provided by the invention is recombinant human interleukin 18, which is marked as rhIL-18. On the basis of wild human IL-18, the 10 th amino acid with serine (Ser) is mutated into a hydroxylated amino acid residue. The hydroxylated amino acid residue comprises Pro or Lys, Pro in the protein is hydroxylated after translation, the solubility of the protein can be improved, and the stability of the protein can be increased. In the examples of the present invention, serine (Ser) at amino acid position 10 was mutated to proline (Pro) (shown in SEQ ID NO: 1). Experiments show that the hrIL-18 shown in SEQ ID NO. 1 solves the defects of low solubility, poor stability, low biological activity and the like of wild type IL-18, the hrIL-18 shown in SEQ ID NO. 1 is easier to purify and suitable for industrial production, and the prepared hrIL-18 sample has stronger inhibiting effect on the generation of new blood vessels.
The invention also provides a DNA molecule for encoding the recombinant interleukin 18.
Due to codon degeneracy, can exist in the coding of the invention of the hrIL-18 nucleotide sequence.
In some embodiments, the DNA molecule encoding the recombinant interleukin-18 of the present invention has the nucleotide sequence shown in SEQ ID NO. 2.
The DNA molecule for coding the hrIL-18 provided by the invention can be obtained by adopting an artificial synthesis mode and can also be obtained by an in vitro amplification method. The invention is obtained by adopting an in vitro amplification mode. Preferably, the nucleotide sequence encoding the hrIL-18 is obtained by RT-PCR using a primer pair containing codons corresponding to mutated amino acids and using human cell mRNA as a template. The sequence of the primer pair containing the codon corresponding to the mutant amino acid is shown as SEQ ID NO. 3-4. The human body cells are: peripheral blood lymphocytes, lymph node cells, tonsil cells, hepatocytes, spleen cells, thymocytes, bone marrow cells, and/or kidney cells.
The invention also provides a primer pair consisting of the upstream primer shown in SEQ ID NO. 3 and the downstream primer shown in SEQ ID NO. 4.
The invention provides an expression vector, which comprises a framework and a DNA molecule for encoding the recombinant interleukin 18.
In some embodiments, the nucleotide sequence encoding the recombinant interleukin 18 of the present invention is set forth in SEQ ID NO 2.
In some embodiments, the backbone is the pBV220 plasmid.
The construction method of the expression vector comprises the steps of adding restriction enzyme cutting sites at two ends of a DNA molecule encoding the recombinant interleukin 18 of the invention through PCR, carrying out enzyme cutting on the obtained fragments, and connecting the fragments with an enzyme-cut framework.
In some embodiments, the insertion sites of the nucleotide sequence shown in SEQ ID NO. 2 in the expression vector are EcoRI and BamHI.
The invention also provides host cells transfected or transformed with the expression vectors of the invention.
In some embodiments, the host cell is escherichia coli.
In some embodiments, the host cell is e.coli DH5 α.
In the embodiment of the invention, the host cell is obtained by transforming Escherichia coli with the expression vector provided by the invention.
The invention also provides a preparation method of the recombinant interleukin 18, which is used for fermenting the host cell.
The rhIL-18 is induced and expressed in the fermentation process, and the induction mode is temperature induction.
The culture medium for each liter of fermentation comprises:
the concentration of the bacterial liquid when the induction expression is started is OD600 of 2.0; the temperature for regulating the induction expression is 42 ℃, the time is 4h, the pH value is regulated to 7.0 by ammonia water, and the expression is started.
The method of the present invention can obtain great amount of rhIL-18 in short period, but the rhIL-18 exists in inclusion body form. Therefore, renaturation and purification are needed after fermentation induction expression.
Preferably, the fermentation also comprises a renaturation and purification step.
The purification comprises the following steps:
breaking the fermented host cells, and collecting the precipitate;
washing the precipitate with inclusion body washing liquid, adding inclusion body dissolving liquid, stirring at 4 deg.c for over 4hr, centrifuging and collecting supernatant;
mixing the supernatant with a renaturation solution, stirring at room temperature for 4 hours, carrying out renaturation at 4 ℃ for more than 20 hours, and loading the obtained solution to a balanced hydroxyapatite chromatographic column at the flow rate of 10 ml/min;
fully eluting the hybrid protein with the equilibrium solution to a baseline, eluting with the equilibrium solution containing 0.1mol/L NaCl, and collecting the eluate;
and after the eluent is subjected to ultrafiltration concentration, loading the eluent to a well-balanced Sephacryl S-200-HR gel chromatographic column, collecting a protein peak containing rhIL-18 under ultraviolet detection at the flow rate of 2ml/min, and obtaining the purified rhIL-18.
Experiments show that the rhIL-18 prepared by the method provided by the invention has the mass of the rhIL-18 (inclusion body) which is 25 percent of the mass of the total protein of the thalli, the recovery rate of the rhIL-18 can reach 5 percent after renaturation and purification, and the purity of the rhIL-18 obtained by identification is more than 97 percent.
The recombinant interleukin 18 provided by the invention is applied to the preparation of a preparation for promoting IFN-gamma generation.
In some embodiments, rhIL-18 promotes the production of IFN- γ in human leukemia cell KG 1. Experiments show that when the recombinant interleukin 18 provided by the invention is added into a culture solution of human leukemia cells KG1, results show that rhIL-18 with the concentration of 2.5ng/mL can stimulate KG1 cells to generate IFN-gamma, and that the rhIL-18 can promote the generation of the IFN-gamma.
The recombinant interleukin 18 provided by the invention is applied to the preparation of a preparation for enhancing the activity of NK cells.
In some embodiments, rhIL-18 is added to PBMCs at concentrations of: 0.1ng/mL,1ng/mL,10ng/mL and 100ng/mL, and the results show that rhIL-18 with different concentrations can play a role in enhancing the activity of the NK cells, and can increase the activity of the NK cells to 81.7%. The effect is better than that of wild IL-18.
The recombinant interleukin 18 provided by the invention is applied to preparation of a preparation for inhibiting the production of human endothelial cell microtubules.
In some examples, EA.hy926 cells were treated with rhIL-18 at different concentrations (0.1ng/ml,1ng/ml,10ng/ml,100ng/ml) for 48h in advance, and then human endothelial cell microtubule formation was observed and microtubule-like structures were counted. The results show that different concentrations of IL-18 can inhibit the formation of microtubules in human endothelial cells. The effect is better than that of wild IL-18.
The recombinant interleukin 18 provided by the invention is applied to the preparation of medicines for treating fundus neovascular diseases and/or malignant tumors.
Human retinal pigment epithelial cells were treated with different concentrations of rhIL-18(0.1ng/ml,1ng/ml,10ng/ml,100ng/ml and 1000ng/ml), and then the activity of each group of cells was calculated. The results showed that rhIL-18 did not adversely affect the activity of human retinal pigment epithelial cells even at high concentrations of 1000 ng/ml. The rhIL-18 provided by the invention can inhibit the generation of human endothelial cell microtubules, promote the activity of NK cells and promote the formation of IFN-gamma; without affecting the activity of human retinal pigment epithelial cells. The rhIL-18 can be used as a medicine for treating fundus neovascular diseases and/or malignant tumors.
In the invention, the fundus neovascular disease is wet age-related macular degeneration, diabetic retinopathy and/or corneal vascular hyperplasia. The malignant tumor is leukemia.
The invention also provides a medicament which comprises the recombinant interleukin 18 provided by the invention.
The medicine provided by the invention also comprises pharmaceutically acceptable auxiliary materials, and the dosage forms of the medicine are freeze-dried powder injection and water injection.
The invention provides a recombinant interleukin 18 and a preparation method and application thereof, and the 10 th site of the N end of the rhIL-18 provided by the invention is mutated from serine into a hydroxylated amino acid residue. The hrIL-18 shown in SEQ ID NO. 1 is used for experiments, which solves the defects of low solubility, poor stability, low biological activity and the like of wild type IL-18, and the hrIL-18 shown in SEQ ID NO. 1 is easier to purify and is suitable for industrial production. The rhIL-18 provided by the invention can inhibit the generation of human endothelial cell microtubules, promote the activity of NK cells and promote the formation of IFN-gamma; without affecting the activity of human retinal pigment epithelial cells. The rhIL-18 can be used as a medicine for treating fundus neovascular diseases and/or malignant tumors.
Drawings
FIG. 1 shows a pBV220-IL-18 prokaryotic expression vector construction scheme;
FIG. 2 shows the PCR of the expression vector, indicated as: m: the molecular weight standard is 10000, 7000, 4000, 2000, 1000, 500 and 250bp from large to small; lane 1 shows the vector pBV220 control, and lane 2 shows the PCR results for the expression vector pBV 220-IL-18;
FIG. 3 shows the results after purification in a hydroxyapatite chromatography column; the designations in the figures are respectively: m: the molecular weight standard is 97.2kDa, 66.7kDa, 44.3kDa and 29.8kDa from large to small; lane 1 shows 0.1M NaCl elution peak; lane 2 shows 0.2M NaCl elution peak; lane 3 shows the 0.5M NaCl elution peak;
FIG. 4 shows the results of Sephacryl S-200-HR gel column purification, which are indicated as: m: the molecular weight standard is 97.2kDa, 66.7kDa, 44.3kDa, 29.8kDa, 20.0kDa and 14.0kDa from large to small; lanes 1-5 show the removed heteroproteins, lane 6 shows the sample after purification, lane 8 shows the sample before purification;
FIG. 5 shows that hrIL-18 induces INF γ production by KG1 cells; wherein the bar graph shows the IFN γ content in pg/mL; the broken line shows the concentration of hriL-18 in ng/mL;
FIG. 6 shows that hrIL-18 induces NK cell proliferation; wherein, figure 6-a shows the not adding the HRIL-18 induced NK cell proliferation effect, figure 6-b shows the adding the invention of the HRIL-18 induced NK cell proliferation effect;
FIG. 7 shows the effect of hrIL-18 on the rate of activity of RPE cells;
FIG. 8 shows inhibition of human endothelial cell microtubule formation by hrIL-18; FIG. 8-a shows the human endothelial cell microtubule formation without the addition of hrIL-18, and FIG. 8-b shows the inhibition of human endothelial cell microtubule formation by hrIL-18 of the present invention.
Detailed Description
The invention provides a recombinant interleukin 18 and a preparation method and application thereof, and a person skilled in the art can realize the recombinant interleukin 18 by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
On the basis of wild human IL-18, the invention mutates serine (Ser) at the 10 th amino acid position into hydroxylated amino acid residue to obtain rhIL-18. The preparation method of the rhIL-18 adopts a genetic engineering method.
The technical scheme comprises the following specific steps: (1) obtaining a target gene: human cells are obtained, total RNA is extracted by a conventional method, and the cDNA of the rhIL-18 is obtained by RT-PCR amplification by using the RNA as a template and using an upstream primer 1(TACTTTGGCAAGCTTGAATCTAAATTACCAGTC, SEQ ID NO:3) and a downstream primer (CGGGATCCCTAGTCTTCGTTTTG, SEQ ID NO: 4). Using the above cDNA as a template, a cDNA fragment was amplified by PCR using the upstream primer 2(CGGAATTTCATGTACTTTGGCAAGCTT, SEQ ID NO:5) and the downstream primer (CGGGATCCCTAGTCTTCGTTTTG, SEQ ID NO:4) to carry the corresponding endonuclease site. (2) Constructing an expression vector: the cDNA of the rhIL-18 of the invention is cut by endonuclease in a corresponding expression vector, DNA ligase is used for connecting a target gene and the expression vector and transforming or transfecting cells, and the rhIL-18 gene engineering cell strain of the invention is obtained. (3) Fermentation of the genetically engineered cell line: inoculating the engineering strain preserved at-70 ℃ to an Amp-containing nutrient agar plate culture medium, and culturing at 37 ℃; selecting a single colony, inoculating the single colony into an LB liquid culture medium containing Amp, and performing shake culture at 37 ℃; inoculating the bacterial liquid into an Amp-containing fermentation medium according to a certain proportion, and performing shake culture at 32 ℃; inoculating the bacterial liquid into a fermentation tank in proportion, and culturing at 32 ℃; after the concentration of the bacterial liquid reaches OD600 of about 2.0, the temperature is raised to 42 ℃ for induced culture for 4 hours, simultaneously 1000ml of filler liquid is continuously added in small amount, the pH value is automatically adjusted to 7.0 by ammonia water, and the thalli are collected by centrifugation. (4) Purification of recombinant IL-18 protein: suspending thalli of the genetic engineering cell strain by using TE buffer solution, homogenizing and crushing the thalli under high pressure under the ice bath condition, and centrifugally collecting precipitates to obtain inclusion bodies; weighing a proper amount of inclusion bodies, adding an inclusion body washing solution for washing, adding an inclusion body dissolving solution, and magnetically stirring and dissolving for more than 12 hours at the temperature of 4 ℃; centrifuging and collecting supernatant; slowly adding the renaturation solution according to the proportion, and magnetically stirring at room temperature for dissolving for 4 hours; renaturation is carried out for more than 20h at 4 ℃; collecting rhIL-18 protein peak through hydroxyapatite chromatography column balanced by balancing liquid; and then the target peak is ultrafiltered and concentrated, and then is put on a gel chromatographic column which is well balanced by a balance liquid, and the rhIL-18 protein peak is collected, namely the target protein rhIL-18, and the protein recovery rate can reach 5%. Packaging the purified protein into a hydro-acupuncture preparation or a freeze-dried preparation.
The primers, the reagents and the test materials adopted by the invention are all common commercial products and can be purchased in the market.
The formula range of the related culture medium or buffer solution is as follows:
LB liquid medium: prepared according to the following proportion by taking 1000ml as a unit, and is sterilized by high pressure after being dissolved.
Tryptone 10g
Yeast extract 5g
NaCl 10g
Fermentation medium: prepared according to the following proportion by taking 1000ml as a unit, and is sterilized by high pressure after being dissolved.
The filler liquid is prepared by taking 1000ml as a unit according to the following proportion, and is sterilized under high pressure after being dissolved.
Tryptone 100g
Yeast extract 50g
Glucose 100g (115 ℃, high pressure alone)
20mmol of PB buffer (pH7.2) was prepared in 1000ml units in the following proportions:
sodium dihydrogen phosphate 2H2O 3.12g
Disodium hydrogen phosphate 12H2O 7.16g
EDTA 0.37g
Inclusion body wash: namely 20mmol of PB buffer solution
The inclusion body dissolving solution is prepared by taking 1000ml as a unit according to the following proportion:
480g of 8mol urea
10mM DTT 1.65g
Diluting to 1000mL with 20mmol PB buffer (pH7.2)
The renaturation liquid is prepared by taking 1000ml as a unit according to the following proportion:
20mmol PB buffer (pH8.0) 1000ml
DTT(20mM) 3.1g
20mmol PB buffer (pH7.2) 1000ml
0.1mol NaCl 5.8g
20mmol PB buffer (pH7.2) 1000ml
0.2mol NaCl 11.6g
20mmol PB buffer (pH7.2) 1000ml
0.5mol NaCl 29.0g
Hydroxyapatite chromatography column equilibrium liquid: namely 20mmol of PB buffer solution
Sephacryl S-200-HR gel chromatography column equilibrium: namely 20mmol of PB buffer solution
The invention is further illustrated by the following examples:
EXAMPLE 1A prokaryotic expression vector pBV220-IL-18 for IL-18 was constructed.
The gene (SEQ ID NO:2) containing IL-18 obtained by RT-PCR is subjected to double enzyme digestion by EcoRI and BamHI, and then is connected with a vector pBV220 subjected to double enzyme digestion by EcoRI and BamHI, a prokaryotic expression vector pBV220-IL-18 containing the IL-18 gene is constructed, escherichia coli DH5 α is transformed, and an engineering strain DH5 α -pBV220IL-18 is constructed (figure 1-2).
Example 2 fermentation and high expression of hIL-18
Activating, fermenting and inducing engineering bacteria and recovering inclusion bodies: inoculating the engineering strain preserved at-70 ℃ to an Amp-containing nutrient agar plate culture medium, and culturing at 37 ℃ for more than 12 h; selecting a single colony, inoculating the single colony into an LB liquid culture medium containing Amp, and performing shake culture at 37 ℃ for more than 12 hours; inoculating the bacterial liquid into an Amp-containing fermentation medium according to the proportion of 1:100, and performing shake culture at 32 ℃ for more than 12 h; inoculating the bacterial liquid into a fermentation tank according to the proportion of 1:10, and culturing at 32 ℃; when the concentration of the bacteria liquid reaches OD600After about 2.0, the temperature is raised to 42 ℃ for induced culture for 4 hours, meanwhile, a small amount of filler liquid is continuously added, and the pH value is automatically adjusted to 7.0 by ammonia water. After the culture is finished, the thalli are collected by centrifugation, suspended by TE buffer solution, homogenized and crushed under high pressure under the ice bath condition, and repeated for 4 times. And centrifuging the crushed thalli, and collecting precipitates to obtain the inclusion bodies.
Example 3 renaturation and purification of hIL-18
3.1 washing, solubilization and renaturation of Inclusion bodies: weighing a proper amount of inclusion bodies, adding an inclusion body washing solution, washing for 2 times, adding an inclusion body dissolving solution according to a proportion of 2%, and magnetically stirring and dissolving for more than 4 hours at the temperature of 4 ℃; centrifuging at 4 deg.C and 9000rpm for 10min, and collecting supernatant; slowly adding the renaturation solution according to the proportion of 1:8 to reduce the protein concentration to 0.2%, and magnetically stirring and dissolving for 4 hours at room temperature; renaturation is carried out for more than 20h at 4 ℃; and (5) immediately purifying.
3.2 purification of hrIL-18: balancing the hydroxyapatite chromatographic column by using a balance liquid, and completely loading the diluted renaturation liquid at the flow rate of 10 ml/min; eluting the impurity proteins with balance solution to baseline, eluting with balance solution containing 0.1, 0.2, 0.5 and 1.0M NaCl, collecting eluate, and performing SDS protein electrophoresis to identify the target protein in 0.1NaCl eluate (FIG. 3); ultrafiltering and concentrating the 0.1M NaCl elution peak sample, adding Sephacryl S-200-HR gel chromatographic column balanced with balancing solution according to 3% of bed volume, eluting with balancing solution at flow rate of 2 ml/min; collecting target protein peaks step by step, and storing at-20 ℃ for identification.
3.3 the purified prourokinase is identified by SDS protein electrophoresis, the expression quantity of IL-18 (inclusion body) can reach 25 percent of the total protein quantity of the thalli; the inclusion body purification recovery rate can reach 5 percent; the purity is more than 97 percent; the protein content was determined using an ultraviolet spectrophotometer to be about 0.5 mg/ml.
Example 4 hIL-18 bioactivity assay
4.1 subculturing human leukemia cell KG 1: using 10% FCS in RPMI1640 medium, 5% CO2Culturing U937 cells at 37 ℃; when the cell density reaches 2X 106Passage at individual cells/ml; the density of the passage cells is 4 multiplied by 105Cells/ml.
4.2 preparing the hrIL-18 into 100ng/ml of serum-free RPMI1640 medium for standby; the cell density of 96-well cell culture plates prepared by adding 100ul of 20% FCS 1640 medium to each well of the first 5 columns was 2X 106Cells/ml, A, B, C, D supplemented with ConA (Canavalid protein A) to a final concentration of 0.5 mg/L; E. f, G, H wells were not added ConA. Adding 100ul of 2-fold diluted hriL-18 into each of the wells of columns 1-5, and mixing to obtain column 1 final concentration of 40 ng/ml; (4 wells per dilution). After mixing, the cell culture plate was placed at 37 ℃ in 5% CO2Incubating for 24 h;
4.3 collecting the culture supernatant, measuring the IFN-gamma content by ELISA method (figure 5);
TABLE 1 Effect of different concentrations of hriL-18 on the IFN-. gamma.potency of cells
The results show that rhIL-18 can promote the expression of IFN-gamma of cells.
Example 5rhIL-B enhancement of NK cell Activity
The direct fluorescence flow cytometry method is adopted to determine the activity experiment of the NK cells:
preparation of PBMCs: mixing anticoagulated whole blood with equal amount of physiological saline, adding equal amount of 50ml centrifuge tube (or 10ml) containing lymphocyte separation solution, centrifuging at 2000rpm (horizontal rotor) for 10min, collecting lymphocyte layer, washing with physiological saline for 2 times at 1500rpm for 10min, adjusting cell concentrationDegree of 1X 106Per ml; adding IL-2 or IL-12(100u/ml) into the cell suspension, and adding into a 25ml culture bottle with 8 bottles in total; IL-18 (commercially available wild-type IL-18 and rhIL-18 of the invention) was diluted with 1640-10% FCS at concentrations of: 0.1ng/ml,1ng/ml,10ng/ml and 100 ng/ml. Add 1 vial per titer to the PBMCs cells containing PBMCs described above. 5% CO at 37 ℃2Incubating for 24h, and collecting cells for culture; after washing with the medium, the cell concentration was adjusted to 2X 106And/ml. Respectively labeling with fluorescently labeled anti-CD 56 monoclonal antibody and CD69 monoclonal antibody; incubate at 37 ℃ for 2 h. The percentage of CD56, CD69 cells was determined by flow cytometry. Calculating the percentage of CD56 and CD69 cells in each group, the NK activity can be increased to 81.7% (FIG. 6);
TABLE 2 percentage of NK-active cells
The result shows that the rhIL-18 provided by the invention can more effectively promote the activity of NK cells.
Example 6 Effect of rhIL-B on human retinal pigment epithelial cells (ARPE-19) (MTT method)
ARPE-19 cells: ARPE-19 cells (American Type Culture Collection CRL2302, LGC Promochem) were purchased, cultured in DMEM medium-10% FCS at 37 ℃ in 5% CO2 incubator, and subcultured; making the above cells to have a cell concentration of 1 × 105Adding 96-well culture plate into the suspension; IL-18 (commercially available wild-type IL-18 and rhIL-18 of the invention) was diluted with 1640-10% FCS at concentrations of: 0.1ng/ml,1ng/ml,10ng/ml,100ng/ml and 1000 ng/ml. Toxicity controls were made with 0.1% SDS and added to the above-mentioned cells at 4 wells per titer. 5% CO at 37 ℃2After 24h of incubation, the viability of each group of cells was determined by the MTT method, the survival percentage of each IL-18 group of cells was calculated, and a specific activity curve was plotted. Percent cell survival ═ 100% x (experimental a value-background)/(control a value-background). The activity of ARPE-19 cells was calculated for each group, and the results showed that IL-18 was active on RPE cellsThe rate had no effect (fig. 7).
Example 7 inhibition assay of rhIL-18 on human endothelial cell microtubule formation
EA.hy926 cells were treated with different concentrations (0.1ng/ml,1ng/ml,10ng/ml,100ng/ml) of IL-18 for 48h in advance. Mixing Matrigel artificial Matrigel with a serum-free 1640 medium pre-cooled at 4 ℃ according to the ratio of 1: mixing at a ratio of 1, spreading on the bottom of a 24-well plate at a volume of 300 μ L per well, and adding 5% CO2Curing the glue in a constant temperature incubator at 37 ℃ for 30 min. IL-18 treated EA.hy926 cells were taken and adjusted to 1.2X 10 concentration with serum-free 1640 medium5After being inoculated into the 24-well plate paved with the glue, 1mL of the solution is cultured for 16 h in a conventional way, the formation of the microtubular structure is observed every 4h, and 5 visual fields are randomly taken to take pictures under an optical microscope (100 times). Images were analyzed using Microvision Saisam software and fig. 8 was counted for microtube-like structures of 5 fields per well.
TABLE 3 number of microtubular structures
The results show that the rhIL-18 provided by the invention can inhibit the generation of microtubule-like structures.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.
SEQUENCE LISTING
<110> He Wei
<120> recombinant interleukin 18, preparation method and application thereof
<130>MP1621783
<160>5
<170>PatentIn version 3.3
<210>1
<211>157
<212>PRT
<213> Artificial sequence
<400>1
Tyr Phe Gly Lys Leu Glu Ser Lys Leu Pro Val Ile Arg Asn Leu Asn
1 5 10 15
Asp Gln Val Leu Phe Ile Asp Gln Gly Asn Arg Pro Leu Phe Glu Asp
20 25 30
Met Thr Asp Ser Asp Cys Arg Asp Asn Ala Pro Arg Thr Ile Phe Ile
35 40 45
Ile Ser Met Tyr Lys Asp Ser Gln Pro Arg Gly Met Ala Val Thr Ile
50 55 60
Ser Val Lys Cys Glu Lys Ile Ser Thr Leu Ser Cys Glu Asn Lys Ile
65 70 75 80
Ile Ser Phe Lys Glu Met Asn Pro Pro Asp Asn Ile Lys Asp Thr Lys
85 90 95
Ser Asp Ile Ile Phe Phe Gln Arg Ser Val Pro Gly His Asp Asn Lys
100 105 110
Met Gln Phe Glu Ser Ser Ser Tyr Glu Gly Tyr Phe Leu Ala Cys Glu
115 120 125
Lys Glu Arg Asp Leu Pro Lys Leu Ile Leu Lys Lys Glu Asp Glu Leu
130 135 140
Gly Asp Arg Ser Ile Met Phe Thr Val Gln Asn Glu Asp
145 150 155
<210>2
<211>474
<212>DNA
<213> Artificial sequence
<400>2
tactttggca agcttgaatc taaattacca gtcataagaa atttgaatga ccaagttctc 60
ttcattgacc aaggaaatcg gcctctattt gaagatatga ctgattctga ttgtagagat 120
aatgcacccc ggaccatatt tattataagt atgtataaag atagccagcc tagaggtatg 180
gctgtaacta tctctgtgaa gtgtgagaaa atttcaactc tctcctgtga gaacaaaatt 240
atttccttta aggaaatgaa tcctcctgat aacatcaagg atacaaaaag tgacatcata 300
ttctttcaga gaagtgtccc aggacatgat aataagatgc aatttcaatc ttcatcatac 360
gaaggatact ttctagcttg tgaaaaagag agagaccttt ttaaactcat tttgaaaaaa 420
gaggatgaat tgggggatag atctataatg ttcactgttc aaaacgaaga ctag 474
<210>3
<211>33
<212>DNA
<213> Artificial sequence
<400>3
tactttggca agcttgaatc taaattacca gtc 33
<210>4
<211>23
<212>DNA
<213> Artificial sequence
<400>4
cgggatccct agtcttcgtt ttg 23
<210>5
<211>27
<212>DNA
<213> Artificial sequence
<400>5
cggaatttca tgtactttgg caagctt 27
Claims (17)
1. The recombinant human interleukin 18 is characterized in that the amino acid sequence is shown as SEQ ID NO. 1.
2. A DNA molecule encoding the recombinant interleukin 18 of claim 1.
3. The DNA molecule of claim 2, wherein the nucleotide sequence is set forth in SEQ ID NO 2.
4, a primer pair consisting of an upstream primer shown by SEQ ID NO. 3 and a downstream primer shown by SEQ ID NO. 4.
5. An expression vector comprising a backbone and the DNA molecule of claim 2 or 3.
6. The expression vector of claim 5, wherein the backbone is the pBV220 plasmid.
7. A host cell transfected or transformed with the expression vector of claim 5 or 6.
8. The host cell of claim 7, wherein the host cell is E.coli.
9. The method for producing the recombinant interleukin 18 according to claim 1, wherein the host cell according to claim 7 or 8 is fermented.
10. The method of claim 9, further comprising the steps of renaturation and purification after the fermentation.
11. Use of the recombinant interleukin 18 of claim 1 in the preparation of a formulation for promoting IFN- γ production.
12. Use of the recombinant interleukin 18 of claim 1 in the preparation of a formulation for enhancing NK cell activity.
13. Use of the recombinant interleukin 18 of claim 1 in the preparation of a formulation for inhibiting microtubule production in human endothelial cells.
14. The use of the recombinant interleukin 18 of claim 1 in the manufacture of a medicament for the treatment of ocular fundus neovascular disease and/or malignant tumor.
15. Use according to claim 14, the ocular fundus neovascular disease being wet age-related macular degeneration, diabetic retinopathy and/or corneal vascular proliferation.
16. A medicament comprising the recombinant interleukin 18 of claim 1.
17. The medicine of claim 16, wherein the dosage form is freeze-dried powder injection or water injection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611146887.0A CN108218978B (en) | 2016-12-13 | 2016-12-13 | Recombinant interleukin 18 and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611146887.0A CN108218978B (en) | 2016-12-13 | 2016-12-13 | Recombinant interleukin 18 and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108218978A CN108218978A (en) | 2018-06-29 |
| CN108218978B true CN108218978B (en) | 2020-05-12 |
Family
ID=62638229
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611146887.0A Active CN108218978B (en) | 2016-12-13 | 2016-12-13 | Recombinant interleukin 18 and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108218978B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111825757A (en) * | 2020-08-04 | 2020-10-27 | 沈阳何氏眼产业集团有限公司 | Method for removing heat source in recombinant IL-18 and product prepared by method |
| CN112746056A (en) * | 2021-03-17 | 2021-05-04 | 辽宁盛京干细胞科技有限公司 | Culture solution for enhancing NK (natural killer) cytotoxic effect and preparation method thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101089181A (en) * | 2006-06-13 | 2007-12-19 | 上海新生源医药研究有限公司 | Production method of recombination human interleukin-4 |
| CN101228188A (en) * | 2005-06-21 | 2008-07-23 | 佐马技术有限公司 | IL-1 beta binding antibodies and fragments thereof |
| CN102140487A (en) * | 2010-01-29 | 2011-08-03 | 东莞太力生物工程有限公司 | Method for preparing recombinant human interleukin-11 |
| CN102260352A (en) * | 2010-05-28 | 2011-11-30 | 山东先声麦得津生物制药有限公司 | Targeted interleukin fusion protein as well as preparation method thereof and application thereof |
| CN104640879A (en) * | 2012-09-07 | 2015-05-20 | 诺华股份有限公司 | Il-18 binding molecules |
| CN105907789A (en) * | 2016-03-14 | 2016-08-31 | 紫程瑞生会(北京)生物技术发展有限公司 | Preparation method and kit of cytokine-induced killing cell for inducing antibody-dependent cellular cytotoxicity |
-
2016
- 2016-12-13 CN CN201611146887.0A patent/CN108218978B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101228188A (en) * | 2005-06-21 | 2008-07-23 | 佐马技术有限公司 | IL-1 beta binding antibodies and fragments thereof |
| CN101089181A (en) * | 2006-06-13 | 2007-12-19 | 上海新生源医药研究有限公司 | Production method of recombination human interleukin-4 |
| CN102140487A (en) * | 2010-01-29 | 2011-08-03 | 东莞太力生物工程有限公司 | Method for preparing recombinant human interleukin-11 |
| CN102260352A (en) * | 2010-05-28 | 2011-11-30 | 山东先声麦得津生物制药有限公司 | Targeted interleukin fusion protein as well as preparation method thereof and application thereof |
| CN104640879A (en) * | 2012-09-07 | 2015-05-20 | 诺华股份有限公司 | Il-18 binding molecules |
| CN105907789A (en) * | 2016-03-14 | 2016-08-31 | 紫程瑞生会(北京)生物技术发展有限公司 | Preparation method and kit of cytokine-induced killing cell for inducing antibody-dependent cellular cytotoxicity |
Non-Patent Citations (2)
| Title |
|---|
| 《Chain A, Solution Structure Of The Human Interleukin-18》;Kato,Z.等;《GenBank》;20090710;全文 * |
| 《人白细胞介素-18突变体的虚拟筛选及其活性》;杨京生等;《中国生物制品学杂质》;20080831;第21卷(第8期);第641-646页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108218978A (en) | 2018-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2436616T3 (en) | Stable protein formulations | |
| CN109153709B (en) | Nerve growth factor mutant | |
| US20240075105A1 (en) | Fusion Protein of Human Serum Albumin and Interleukin-2, and Use Thereof | |
| JP7153726B2 (en) | HM-3 fusion protein and its application | |
| US10875903B2 (en) | Bifunctional fusion proteins to inhibit angiogenesis in tumor microenvironment and to activate adaptive immune responses and the genes and uses thereof | |
| KR20130094337A (en) | Improved iduronate-2-sulfatase and use thereof | |
| CN108066755B (en) | Genetic engineering subunit vaccine for resisting sheep echinococcosis infection and preparation method and application thereof | |
| CN108218978B (en) | Recombinant interleukin 18 and preparation method and application thereof | |
| CN100457778C (en) | Mutant of ciliary nerves trophic factor (CNTF), producing method and usage | |
| US9127075B2 (en) | Analgesic active peptide VGG, preparation and use thereof | |
| CN108440673A (en) | Fc fusion proteins PD1/FGFR1 and its application | |
| EP3885357A1 (en) | Interleukin 21 protein (il21) mutant and use thereof | |
| CN110172103A (en) | GLP-1 analog-Fc fusion protein and its preparation method and application | |
| JP6375112B2 (en) | Pharmaceutical composition of tenecteplase | |
| WO2008120263A2 (en) | Prokineticins receptors antagonists, derivatives and uses thereof | |
| CN111909246B (en) | AAV mutants highly efficient in infecting supporting cells | |
| CN113501862A (en) | Polypeptide and application thereof in preparation of immunoregulation medicament | |
| US20220233715A1 (en) | Aav mutant that efficiently infects supporting cells | |
| CN101921820B (en) | Preparation method of recombinant tumor specificity antiapoptotic factors with activity and application of products thereof | |
| CN102690342B (en) | Anti-cancer analgesic peptide VKVR, its preparation method and application | |
| CN101875688B (en) | Folic acid modification step of method for preparing recombinant tumor specific apoptosis factor and application of products of recombinant tumor specific apoptosis factor | |
| CN113813375A (en) | Composition of novel anti-new coronavirus compound and application of composition in medicine for preventing and treating coronavirus infection diseases | |
| CN109111527A (en) | GIP34-VP3 fusion protein of targeting specific inducing apoptosis of tumour cell and its preparation method and application | |
| WO2023016419A1 (en) | New mutant of recombinant ganoderma lucidum immunoregulatory protein and application thereof | |
| US20220088139A1 (en) | Nerve growth factor mutant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200226 Address after: No. 66, Sishui street, Dongling District, Shenyang, Liaoning 110034 Applicant after: Shenyang He's Eye Industry Group Co., Ltd. Address before: 110034 Shenyang North Eye Hospital, 128 the Yellow River North Street, Shenyang, Liaoning 702 Applicant before: He Wei |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |