CN104558141A - Recombinant antibacterial peptide, and preparation method and application of recombinant antibacterial peptide - Google Patents

Abstract

The invention belongs to the field of medicine and discloses recombinant antibacterial peptide, and a preparation method and an application of the recombinant antibacterial peptide. An amino acid sequence of the recombinant antibacterial peptide is as shown as SEQ ID NO: 1 (Sequence Identifier Number 1). The polypeptide has a better broad-spectrum antibacterial action and can be used for preparing an antibacterial medicine.

Description

A kind of recombinant antibacterial peptide and its preparation method and application

Technical field

The invention belongs to field of medicaments, relate to a kind of recombinant antibacterial peptide and its preparation method and application.

Background technology

Through the evolution of 200,000,000 years, the product breast milk of breast-feeding and its uniqueness was still fed and is protect newborn baby.Albumen a large amount of in breast milk is inhibited to pathogenic bacterium, virus and fungi.Some of them albumen can play a role separately, and other albumen then must be worked in coordination with and be played a role.It is a kind of redundancy seemingly that Multiple components acts on same pathogenic bacteria, and it is actual is a kind of multiple-protection system.The hydrolytic action of body endoproteinase creates a large amount of breast milk polypeptide, the physiological function that these breast milk polypeptide also play a role as nutrition except providing amino acid.Further research finds that a large amount of breast milk polypeptide shows multiple anti-microbial effect, for new life provides immunoprotection.

Along with antibiotic extensive application, the generation of bacterial drug resistance and new life's antibiotic screening bottleneck make antibiotic application be subject to certain restriction.Research in recent years finds, antibacterial peptide (Antimicrobal peptides, AMPs) becomes the ideal medicament being expected to alternative conventional antibiotic with the mechanism of action of its uniqueness and molecular characterization.As a kind of novel antibacterial material, AMP has broad spectrum antibiotic activity, can kill bacterium fast, and to the pathogenic agent of some clinical relevant caused severe infections and Resistant strain effective.Breast milk, as valuable source, becomes the object of everybody research containing the abundant polypeptide with potential antibacterial.

We isolate in breast milk the polypeptide moiety being less than 10KDa by ultra-filtration technique, carry out identification and analysis further by tandem mass spectrum technology to its concrete composition.Found that these polypeptide mainly from the fragment that people's beta-casein (Homo sapiens betacasein, gene No. Bank: NM_001891) Fracture gets off, to be naturally present in breast milk.The report do not studied further these segments and function thereof in prior art, for this reason, we have screened some polypeptide and have carried out deep research.

Summary of the invention

The object of the invention is to provide a kind of recombinant antibacterial peptide for above-mentioned technical problem.

Another object of the present invention is to provide the preparation method of above-mentioned recombinant antibacterial peptide.

A further object of the invention is to provide the application of above-mentioned recombinant antibacterial peptide.

The object of the invention is to be realized by following technical proposal:

A kind of recombinant antibacterial peptide, its aminoacid sequence is as shown in SEQ ID NO:1.Called after Casein 41.

Express the gene of above-mentioned antibacterial peptide, its nucleotide sequence is as shown in SEQ ID NO:2.

The amplimer of described polypeptide, wherein the nucleotide sequence of upstream primer is as shown in SEQ ID NO:3, and the nucleotide sequence of downstream primer is as shown in SEQ ID NO:4.

The preparation method of described antibacterial peptide, the method comprises the following steps:

A. the expression vector pSUMO of aforementioned polypeptides is built;

The abduction delivering of b.pSUMO fusion rotein;

The purifying of c.pSUMO fusion rotein, collection;

D. the purifying of recombinant antibacterial peptide, collection.

Described preparation method, the method comprises the following steps:

A. the expression vector pSUMO of aforementioned polypeptides (SEQ ID NO:1) is built:

This polypeptide-nucleic acid sequence of synthetic, this polypeptide-nucleic acid fragment utilizing above-mentioned upstream and downstream primer to be amplified containing BsaI, HindIII restriction enzyme site by round pcr carries out glue recovery, is loaded into pSUMO carrier after reclaiming product double digestion;

The abduction delivering of b.pSUMO fusion rotein:

1) the correct plasmid that checks order proceeds to e. coli bl21, and the LB nutrient solution be inoculated in containing kantlex is cultivated;

2) collect thalline, add IPTG after resuspended and induce pSUMO expressing fusion protein;

The purifying of c.pSUMO fusion rotein:

After bacterium liquid precipitate Ni-NTA Binding-Buffer after abduction delivering is resuspended, ultrasonication, centrifugal, get supernatant, supernatant liquor loading is to Ni-NTA affinity column, and wash-out pSUMO fusion rotein, collects elutriant, SDS-PAGE electrophoretic analysis;

D. the purifying of recombinant antibacterial peptide, collection:

Adopt SUMO enzyme to carry out enzyme to pSUMO fusion rotein to cut, utilize Ni-NTA affinity column remove SUMO label or there is no cut SUMO fusion rotein, wash-out recombinant antibacterial peptide, electrophoretic analysis, collect recombinant antibacterial peptide.

The application of described recombinant antibacterial peptide in preparation antibacterials.Described antibacterials for germ be pathogenic bacterium intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, Klebsiella Pneumoniae and staphylococcus epidermidis.

Beneficial effect of the present invention:

Polypeptide provided by the invention has good Anti-bacterium effect, can be used for preparing antibacterial medicine.

Polypeptide provided by the invention also can be obtained by chemosynthesis, but the cost of synthesis is high, and is unfavorable for prepared by scale operation.Therefore, present invention also offers the gene recombination technology preparation method of this polypeptide, this preparation method is simple, and cost is low, is easy to commercial application.

Because SUMO is except the characteristic of promotion solubility with traditional fusion tag, also there is molecular chaperone function, the feature such as correct folding of target protein can be promoted, have very strong resistance to heat and proteolytic enzyme simultaneously, be conducive to the stability keeping target protein.In this research, we successfully construct polypeptide and SUMO fusion expression vector, and table is optimized to its expression condition, fusion rotein is cut through SUMO enzyme enzyme, can obtain soluble polypeptide in a large number, with chemosynthesis than greatly reducing the cost obtaining polypeptide after column purification.

Along with antibiotic a large amount of use, bacterium produces resistance widely.In the present invention, antibacterial peptide all has lethal effect to Penicillin-resistant streptococcus aureus and cynnematin resistance Klebsiella Pneumoniae.Therefore, the desirable alternative medicine becoming alternative conventional antibiotic is expected to.

Accompanying drawing explanation

Fig. 1: SUMO fusion protein S DS-PAGE.

Wherein: M: albumen Marker; 1: broken supernatant; 2: effluent liquid; 3: washings; 4: elutriant.

Fig. 2: the recombinant polypeptide Tricine/SDS-PAGE electrophoresis after cutting after purifying.

Wherein: 1: albumen Marker; 2: the recombinant polypeptide after cutting.

Fig. 3: recombinant antibacterial peptide is to the killing activity of streptococcus aureus and Klebsiella pneumoniae Resistance bacterium.

Embodiment

The invention will be further elaborated by the following examples.

Embodiment 1

1. this polypeptide has sequence signature:

Aminoacid sequence: ELLLNPTHQIYPVTQPLAPVHNPIS (SEQ ID NO:1)

Nucleotide sequence:

GAACTTCTACTTAACCCCACCCACCAGATCTACCCTGTGACTCAGCCACTTGCCCCAGTTCATAACCCCATTAGT(SEQ ID NO：2)

There is iso-electric point (pI): 5.99, molecular weight (Mw): 2792.23.

2. the foundation of recombination and preparation

2.1 vector constructions:

This polypeptide-nucleic acid sequence of synthetic, utilizes primer below by round pcr:

NO1-F：CATATC GGTCTCGAACTTCTACTTAACCCCA(SEQ ID NO：3)

BsaI

NO1-R：CCC AAGCTTACTAATGGGGTTATGAACTG(SEQ ID NO：4)

HindIII

This polypeptide-nucleic acid fragment amplified containing above-mentioned restriction enzyme site carries out glue recovery, is loaded into pSUMO carrier (Lifesensors, USA), proceeds to DH5a competent cell after reclaiming product double digestion, extracts the order-checking of plasmid Hou Song company.

The abduction delivering of 2.2 pSUMO fusion roteins

1. the correct plasmid that checks order proceeds to e. coli bl21 (DE3) coated plate, and the mono-clonal on picking transformation plate is inoculated in the test tube containing the 3ml LB nutrient solution of 30 μ g/ml Kan (kantlex), and 37 DEG C of 200rpm joltings are spent the night;

2. be inoculated in by 1:100 in the 50ml LB nutrient solution of 30 μ g/ml kantlex next day, 37 DEG C of 200rpm joltings are 0.6 (about 2.5h) to thalline OD600;

3. take out 200 μ l cultures, the centrifugal 2min of 12000g room temperature, abandons supernatant, with 20 μ l 2 × sample-loading buffers (0.5MNaCl, 20mM Tris, 20mM imidazoles) resuspended bacterial sediment;

4. in remaining culture, add IPTG is 0.2mmol/l to final concentration, 25 DEG C of 220rpm jolting 6h, and induction pSUMO fusion rotein (called after pSUMO-NO:1 fusion rotein) is expressed;

5. take out 200 μ l cultures, the centrifugal 3min of 12000g room temperature, abandons supernatant, with the resuspended bacterial sediment of 20 μ l 2 × sample-loading buffer, remains culture 4 DEG C of centrifugal 20min of 5000g, abandons supernatant, put-80 DEG C frozen.

The purifying of 2.3 pSUMO fusion roteins

Ni-NTA affinity column and supporting damping fluid are all purchased from Sepharose.

1. by the bacterium liquid precipitate of 500mL abduction delivering 20ml Ni-NTA Binding-Buffer (20mM Tris, 500mM NaCl, and 20mM imidazole (imidazoles), pH 8.0) resuspended after, ultrasonication (power 200W, work 4sec, interval 8sec, 20min altogether), 4 DEG C of centrifugal 20min of 12000g, get supernatant;

2. with the Ni-NTA affinity column of Ni-NTA Binding-Buffer pre-equilibration, supernatant liquor with 0.6ml/min flow velocity loading to affinity column;

3. rinse with 1.0ml/min flow velocity with Ni-NTA Binding-Buffer, arrive baseline to effluent liquid OD280 value;

4. rinse with 1.0ml/min flow velocity with Ni-NTA Washing-Buffer (20mM Tris, 500mM NaCl, and 50mM imidazole, pH7.0), arrive baseline to effluent liquid OD280 value, collect effluent liquid;

5. use Ni-NTA Elution-Buffer (20mM Tris, 500mM NaCl, and 250mM imidazole, pH7.0) with 1.0ml/min flow velocity wash-out target protein, collect effluent liquid; Obtain pSUMO-NO:1 fusion rotein.

6. carry out 12%SDS-PAGE electrophoretic analysis.

The results are shown in Figure 1 (in Fig. 11: broken supernatant; 2: effluent liquid; 3: washings; 4: elutriant.Corresponding 1,3,4,5 steps respectively)

Result shows, under 0.2mmol/l IPTG, 25 DEG C and 220rpm inductive condition, pSUMO-NO:1 fusion rotein can in intestinal bacteria great expression; Rinse through 50mM imidazole and remove a large amount of impurity protein on pillar, high purity pSUMO-NO:1 fusion rotein can be obtained under 250mM imidazole.

2.4 fusion rotein cutting and target protein purifying

PSUMO-NO:1 fusion rotein is loaded in dialysis tubing, dialysed overnight in PBS (pH7.0); Cut handbook according to SUMO enzyme (GeneCopoeia, the U.S.) enzyme to carry out enzyme to pSUMO-NO:1 fusion rotein and cut, actual conditions is as follows: survey pSUMO-NO.1 concentration, add 1U SUMO enzyme by 50 μ g fusion roteins, 30 DEG C of enzymes cut 60min.Due to SUMO label and fusion protein S UMO containing 6 histidine protein labels (these His labels are that pSUMO plasmid inherently contains), so continue to utilize Ni ²⁺-NTA affinity chromatography is to remove SUMO label or not have cut SUMO fusion rotein, specific as follows:

1. with the Ni-NTA-Sepharose CL-6B affinity column of PBS (pH7.0) pre-equilibration, enzyme cut after sample mix liquid with 0.6ml/min flow velocity loading to Ni-NTA, collect effluent liquid;

2. rinse with 0.6ml/min flow velocity with Elution-Buffer (20mM Tris, 500mM NaCl, and 250mM imidazole, pH 7.0), collect elutriant.

3. pair enzyme cut after sample eluent (Elution) carry out Tricine/SDS-PAGE electrophoretic analysis.

The results are shown in Figure 2.

Result show, through SUMO enzyme enzyme cut with column purification after can obtain highly purified recombinant antibacterial peptide Casein 41.

3. the Analysis of Antimicrobial Activity of recombinant antibacterial peptide

Micro-dilution method is used to measure the minimal inhibitory concentration (MIC) of recombinant antibacterial peptide Casein 41 for intestinal bacteria (Escherichia coli), streptococcus aureus (Staphylococcus aureus), Pseudomonas aeruginosa (Pseudomonas aeruginosa), Klebsiella Pneumoniae (Klebsiela pneumoniae) and staphylococcus epidermidis (Taphylococcus epidermidis).Each bacterium counts with under blood cell counting plate mirror after cultivating 24h respectively, and adjusts concentration to 1000 ~ 5000/ml with LB nutrient solution.Get aseptic 96 orifice plates, add LB 100 microlitre make blank in often arranging No. 1 hole; 3 ~ No. 12 holes respectively add freshly prepared bacterium liquid 100 microlitre; No. 2 holes add bacterium liquid 180 microlitre and antibacterial peptide 20 microlitre respectively.2 ~ No. 11 2 grades, hole doubling dilutions, make the final antibacterial peptide concentration in each hole be respectively 50,25,12.5,6.25,3.125,1.563,0.781,0.391,0.195 and 0.0975 μ g/ml; No. 12 hole not drug containing, make positive control.Each 96 orifice plates survey each hole OD value with enzyme micro-plate reader in 600nm after cultivating 24-48h in 37 DEG C.

Agarose cavity diffusion method is adopted to measure the anti-microbial activity of recombinant antibacterial peptide Casein 41 pairs of intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, Klebsiella Pneumoniae and staphylococcus epidermidis.Inoculation intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, Klebsiella Pneumoniae and staphylococcus epidermidis are in LB liquid medium, 37 DEG C of 200rpm are cultured to logarithmic phase, add to (35-50 DEG C) in the LB agarose media of thawing by 1% bacterium amount, after mixing, be laid on aseptic disposable plate by 10ml/ ware.After solidifying, aseptically punch, add sample (20 μm of ol/L) to be measured and be placed on 37 DEG C of incubators 8 hours, observe bacteriostatic activity.

Simultaneously we adopt above-mentioned inhibition zone method further, have detected the lethal effect of Casein 41 to clinical common Resistant strain streptococcus aureus and Klebsiella pneumoniae Resistance bacterium.

The results are shown in Table 1, Fig. 3.

Result shows, and recombinant antibacterial peptide Casein 41 pairs of intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, Klebsiella Pneumoniae and staphylococcus epidermidiss all have lethal effect (table 1), illustrate that it has the anti-microbial effect of wide spectrum; And Casein 41 pairs of Resistant strain streptococcus aureuses and Klebsiella pneumoniae Resistance bacterium have lethal effect (Fig. 3) equally.Along with antibiotic generation of spreading unchecked use and pathogenic bacterium resistance, Casein 41 is expected to become desirable antibacterials undoubtedly.

Table 1: recombinant antibacterial peptide Casein 41 is to different pathogenic bacterium anti-microbial activity.

Claims (7)

1. a recombinant antibacterial peptide, its aminoacid sequence is as shown in SEQ ID NO:1.

2. express the gene of antibacterial peptide described in claim 1, its nucleotide sequence is as shown in SEQ ID NO:2.

3. the amplimer of polypeptide described in claim 1, it is characterized in that the nucleotide sequence of upstream primer is as shown in SEQ ID NO:3, the nucleotide sequence of downstream primer is as shown in SEQ ID NO:4.

4. the preparation method of antibacterial peptide described in claim 1, is characterized in that the method comprises the following steps:

A. the expression vector pSUMO of polypeptide described in claim 1 is built;

The abduction delivering of b.pSUMO fusion rotein;

The purifying of c.pSUMO fusion rotein, collection;

D. the purifying of recombinant antibacterial peptide, collection.

5. preparation method according to claim 4, is characterized in that the method comprises the following steps:

A. the expression vector pSUMO of polypeptide described in claim 1 is built:

This polypeptide-nucleic acid sequence of synthetic, this polypeptide-nucleic acid fragment utilizing the upstream and downstream primer described in claim 3 to be amplified containing BsaI, HindIII restriction enzyme site by round pcr carries out glue recovery, is loaded into pSUMO carrier after reclaiming product double digestion;

The abduction delivering of b.pSUMO fusion rotein:

1) the correct plasmid that checks order proceeds to e. coli bl21, and the LB nutrient solution be inoculated in containing kantlex is cultivated;

2) collect thalline, add IPTG after resuspended and induce pSUMO expressing fusion protein;

The purifying of c.pSUMO fusion rotein:

After bacterium liquid precipitate Ni-NTA Binding-Buffer after abduction delivering is resuspended, ultrasonication, centrifugal, get supernatant, supernatant liquor loading is to Ni-NTA affinity column, and wash-out pSUMO fusion rotein, collects elutriant, SDS-PAGE electrophoretic analysis;

D. the purifying of recombinant antibacterial peptide, collection:

Adopt SUMO enzyme to carry out enzyme to pSUMO fusion rotein to cut, utilize Ni-NTA affinity column remove SUMO label or there is no cut SUMO fusion rotein, wash-out recombinant antibacterial peptide, electrophoretic analysis, collect recombinant antibacterial peptide.

6. the application of recombinant antibacterial peptide according to claim 1 in preparation antibacterials.

7. application according to claim 6, it is characterized in that antibacterials for germ be pathogenic bacterium intestinal bacteria, streptococcus aureus, Pseudomonas aeruginosa, Klebsiella Pneumoniae and staphylococcus epidermidis.