CN104450902A - Specific primer and kit for identifying siberian wildrye varieties or strains and application of specific primer and kit in identification of siberian wildrye varieties or strains - Google Patents
Specific primer and kit for identifying siberian wildrye varieties or strains and application of specific primer and kit in identification of siberian wildrye varieties or strains Download PDFInfo
- Publication number
- CN104450902A CN104450902A CN201410712070.XA CN201410712070A CN104450902A CN 104450902 A CN104450902 A CN 104450902A CN 201410712070 A CN201410712070 A CN 201410712070A CN 104450902 A CN104450902 A CN 104450902A
- Authority
- CN
- China
- Prior art keywords
- laomangmai
- band
- specific characteristics
- cultivar
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a specific primer for identifying siberian wildrye varieties or strains. Nucleotide sequences of the specific primer are as follow: an upstream primer Pf: AGATGAAGCTGGTAACCGAGACAG, and a downstream primer Pr: ATTTCCTCTAATGGAAGCTCTGGC. The invention also provides a corresponding kit and an application of the kit in identification of the siberian wildrye varieties or strains. By adopting the primer, the corresponding PCR amplification program and an electrophoresis product detection method provided by the invention, seven domestic siberian wildrye varieties (strains) can be rapidly and accurately identified, and can also be distinguished from wild materials and related species through specific amplified bands.
Description
Technical field
The present invention relates to biotechnology assistant breeding, particularly relate to the Auele Specific Primer of a kind of Laomangmai kind or ore grade indexes, test kit and its qualification Laomangmai kind or strain in application.
Background technology
Laomangmai (
elymus sibiricusl.) be Gramineae (Poaceae) Tribe Triticeae (Triticeae) Elymus (
elymus) Perennual mesoxerophytes, be the type species of Elymus.Laomangmai on the Northern Hemisphere Temperate Region in China is distributed more widely, is the cosmopolitan species of Eurasia, and the especially important component part of China's meadow steppe and alpine meadow community, can form sociales and constructive species.Have the advantages such as winter resistance is strong, crude protein content is high, good palatability, easily cultivation due to it, Laomangmai has become one of widely used good forage in country's " Natural Forest Protection Project " and " the project of grassland withdraw from grazing ".
Traditionally for morphological indexes such as the classification of Laomangmai kind matter and qualification Chang Yinai plant height, spike length, tiller numbers, its planting cost is high, qualification cycle is long; Morphological index is large by such environmental effects in addition, has unstable, in mensuration process, also there is larger personal errors, thus affect the reliability of qualification result.The Laomangmai kind that production is promoted or cultivar mostly are the domestication of wild material; similar to wild material in form; be difficult to be identified quickly and accurately by traditional morphological index, be unfavorable for the intellectual property protection of Laomangmai kind, popularization and Appropriate application.
Along with foundation and the maturation of the fast development of Protocols in Molecular Biology, particularly molecule marker and gene-tagging techniques, for develop easy, fast and accurately Idioplasm identification technology provide effective means.SSR(Simple sequence repeat, simple repeated sequence) quantity is abundant, polymorphism is high because having for mark, codominance, amplification are stablized, primer sequence is easy to the advantages such as interchange, paddy rice (
oryza sativa), corn (
zea maysl.), cotton (
gossypium herbaceuml), muskmelon (
cucumis melol), watermelon (
citrullus lanatus.) etc. crop Idioplasm identification in apply.And SSR molecular marker application is few in grass cultivation, be detected in lyme grass (
elymus dahuricus), khuskhus (
stylosanthesspp.), alfalfa (
medicago sativa), jielu grass (
zopsia japonica) etc. minority grass seeds.At present, the research of domestic the molecular fingerprint map construction and rapid detection that there is no Laomangmai kind is reported.
Summary of the invention
The present invention constructs 7 Laomangmai kind (being) molecular fingerprint collection of illustrative plates by a pair SSR special primer (table 1); Utilize this special primer and detection method can identify 7 kinds (being), also the wild Laomangmai material of kind and other different sourcess and nearly edge species can be distinguished, be thus provided Laomangmai kind (being) molecular fingerprint collection of illustrative plates, quick detection kit and authentication method.
The invention provides 1 pair of specificity SSR primer for Laomangmai kind or ore grade indexes, specifically see table 1.
Table 1: specificity Laomangmai SSR primer
The present invention is also provided for the quick detection kit of Laomangmai kind or ore grade indexes, quick and precisely can identify Laomangmai kind (being) by specific amplification band, also can accurately quick kind (being) be identified out from the wild Laomangmai kind matter and nearly edge species of different sources.
Test kit of the present invention comprises: Golden easy Reaction Mix premixed liquid, Taq enzyme, specificity SSR primer sets P.Upstream and downstream primer being diluted to respectively concentration is 10 pmol/ μ L, successively called after Pf, Pr liquid, and-20 DEG C save backup.
The invention provides the rapid identification method of Laomangmai kind (being), the method comprises the following steps:
(1) extraction of Laomangmai kind matter DNA;
(2) pcr amplification: reaction conditions is: 94 DEG C of sex change 30 sec, 65-61 DEG C anneal 30 sec, 72 DEG C extend 1 min, totally 5 circulations, and each cycle annealing temperature reduces by 1 DEG C; 94 DEG C of sex change 30 sec, 60 DEG C of annealing 30 sec, 72 DEG C extend 1 min, totally 30 circulations; 72 DEG C extend 10 min, 4 DEG C of maintenances.
(3) gel electrophoresis carried out to amplified production and dye; Afterwards amplified band is analyzed: what have specific characteristics band 225bp, 170bp and 110bp is same moral kind, what have specific characteristics band 160bp is that green grass or young crops herds kind, what have specific characteristics band 200bp is Xinjiang Laomangmai cultivar, what have specific characteristics band 250bp, 219bp and 149bp is Inner Mongol Laomangmai cultivar, what have specific characteristics band 190bp is the second Inner Mongol Laomangmai cultivar, what have specific characteristics band 140bp is river grass No. 2 kinds, and what have specific characteristics band 120bp is Hongyuan strain.
The present invention constructs the finger printing of 7 Laomangmai kinds (being), and see Fig. 2, applying this finger printing can the identifying 7 Laomangmai kinds (being) of accurate quick.
The present invention also provides the above-mentioned finger printing of application from the wild Laomangmai kind matter and nearly edge species of different sources, differentiate the method for 7 Laomangmai kinds (being), and step is as follows:
(1) extraction of to be measured kind of matter DNA is extracted;
(2) pcr amplification: reaction conditions is: 94 DEG C of sex change 30 sec, 65-61 DEG C anneal 30 sec, 72 DEG C extend 1 min, totally 5 circulations, and each cycle annealing temperature reduces by 1 DEG C; 94 DEG C of sex change 30 sec, 60 DEG C of annealing 30 sec, 72 DEG C extend 1 min, totally 30 circulations; 72 DEG C extend 10 min, 4 DEG C of maintenances;
(3) gel electrophoresis carried out to amplified production and dye, afterwards amplified band is analyzed: if specific characteristics band and in finger printing are identical, be then in 7 Laomangmai kinds (being), and then be specifically judged as which kind of Laomangmai kind (being); Otherwise, be not then.
The present invention is also optimized the detection method after PCR primer gel electrophoresis, specific as follows:
Required reagent comprises:
Silver dye liquor: by 0.8-1 g AgNO
3add in 1L distilled water, be made into the silver-colored dye liquor that concentration is 0.08 %-1 %, preferably, add 0.9 g AgNO
3the silver-colored dye liquor best results that concentration is 0.09 % is made in 1L distilled water.
Developing solution: the amount of each component added by preparation different volumes developing solution is as shown in table 2.
Table 2: different volumes developing solution compound method
Stationary liquid: the glacial acetic acid solution of 7%.
Silver dye development concrete operation step is as follows:
1) silver dye: after electrophoresis terminates, the glue after cleaning is put into the 200ml cma staining liquid container put in advance, dyeing 10-15 minute; Preferably, room temperature dyes 10 minutes.
2) develop: silver dye terminates rear distilled water washing 1-2 time, then develops in the 200 ml developing solutions adding precooling, high-visible to band.
Preferably, develop about 5 minutes, otherwise background colour is too dark.
3) stop showing: glue is put in 7 % HAC and stop aobvious several minutes; (this step can be economized)
4) put on glass plate by the complete glue of dyeing, digital photo camera is preserved.
Compare with traditional method, the method time is short, efficiency is high, and can obtain clear electrophoresis picture.
The invention provides for the identification of the special SSR molecular marker primer of Laomangmai kind (being), fingerprint map construction, quick detection kit and detection method.Adopt primer provided by the invention and corresponding pcr amplification program and electrophoresis product detection method, can carry out fast 7 Domestic Old awns wheat varieties (being), precise Identification.Also by specific amplified band, above-mentioned 7 Domestic Old awns wheat varieties (being) and wild material and nearly edge species are distinguished.
The utilization and extention of excellent herbage variety develops significant for artificial pasture organizational system and grassland agriculture.Therefore, aborning, the verity of kind is guaranteed to utilize to seem particularly important.Adopt special primer provided by the invention, Variety fingerprinting and method for quick, rapidly and accurately 7 of current Spread in China excellent Laomangmai kinds (being) can be identified, and distinguish with other wild Laomangmai materials and nearly edge species.This technological method has significant application value for improved seeds protection, popularization, utilization.
Accompanying drawing explanation
Accompanying drawing is used to provide a further understanding of the present invention, and forms a part for specification sheets, together with embodiments of the present invention for explaining the present invention, is not construed as limiting the invention.In the accompanying drawings:
Fig. 1 is the amplification electrophoretogram of 7 Laomangmai kind (being) application special primer P;
Fig. 2 is domestic 7 Laomangmai kind (being) molecular fingerprint collection of illustrative plates; Wherein, 1-7 represents respectively: " same to moral " Laomangmai, " green grass or young crops is herded " Laomangmai, Xinjiang Laomangmai cultivar, Inner Mongol Laomangmai cultivar 1, Inner Mongol Laomangmai cultivar 2, " No. 2, river grass " Laomangmai, " Hongyuan " Laomangmai new lines;
Fig. 3 is the amplification electrophoretogram of special primer P in 7 Laomangmai kinds (being), wild Laomangmai kind matter and Germplasm of Elymus nutans Griseb.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.
embodiment 1: Laomangmai kind (being) rapid detection used kit, detection method kind (being) qualification in application and fingerprint map construction
1, test materials: 7 Laomangmai kinds (being) of Spread in China, specifically see table 3.
Table 3: Laomangmai kind matter information list
2, key step:
(1) vegetable material DNA extraction
Each kind (being) random selecting 25 individual plants, the spire balanced mix gathered by each individual plant, adopts plant genome DNA to extract test kit and extracts biased sample STb gene; The DNA the extracted agarose gel electrophoresis of 0.8 % and Nanodrop ND-1000 ultraviolet spectrophotometer (Thermo Scientific, DE, USA) carry out the detection of DNA concentration and purity respectively; DNA sample is placed in-20 DEG C of Refrigerator stores; In time starting to test, each DNA sample is taken out a part and is diluted to 25 ng/ μ L, be put in 4 DEG C of Refrigerator stores and use.
(2) pcr amplification
Test kit of the present invention is adopted to provide reagent to carry out Laomangmai pcr amplification:
15 μ LPCR amplification systems comprise: template DNA (25ng/ μ L) 2 μ L, Golden easy Reaction Mix 7.5 μ L, special primer group Pf/Pr (10 pmol/ μ L) each 0.5 μ L, Taq enzyme (2.5U/μ L) 0.2 μ L, aqua sterilisa 4.3 μ L.Auele Specific Primer Pf/Pr is see table 1.
Pcr amplification program adopts and the invention provides the grads PCR amplification program of universal Laomangmai kind (being): 94 DEG C of sex change 30 sec, 65-61 DEG C anneals 30 sec, 72 DEG C of extensions 1 min, totally 5 circulations, and each cycle annealing temperature reduces by 1 DEG C; 94 DEG C of sex change 30 sec, 60 DEG C of annealing 30 sec, 72 DEG C extend 1 min, totally 30 circulations; 72 DEG C extend 10 min, 4 DEG C of maintenances.
(3) electrophoresis detection
Adopt amplified production electrophoresis provided by the invention and dyeing method: detect with 6 % polyacrylamide gels (acrylamide: methene=19:1,7.5 mol/L urea, 1 × TBE damping fluid).Sample point sample 6 μ L, with the D500 Marker of Tian Gen company for contrast, prerunning 30 min under 200 V voltages, then electrophoresis 1.5 h under 400 V voltages, hectograph carries out Silver stain with silver-colored dye liquor and develops the color in developing solution, and gel digital photo camera is preserved.
Wherein, silver-colored dye liquor is by 0.9 g AgNO
3join in 1L distilled water and be made into the silver-colored dye liquor that concentration is 0.09 %.
The preparation method of developing solution is as follows: add NaOH 15g, formaldehyde 4ml, and sodium tetraborate 0.19g, adding distil water is to 1L.
The concrete steps of silver dye development are as follows:
(1) silver dye: after electrophoresis terminates, the glue after cleaning is put into the 200ml cma staining liquid container put in advance, dye 10 minutes;
(2) develop: silver dye terminates rear distilled water washing 1-2 time, then develops in the 200 ml developing solutions adding precooling, high-visible to band, develops about 5 minutes;
(3) stop showing: glue is put in 7 % HAC and stop aobvious several minutes;
(4) the complete glue of dyeing is put on glass plate, gel.
(4) result
As shown in Figure 1, primer P can be identified by many specific bands that increase at each material 7 Laomangmai kinds (being) detected result.From result, every part of material and all the other 6 parts of materials have obvious characteristic band, can be used for cultivar identification.3 obvious characteristic strip 225bp, 170bp and 110bp have been compared with other 6 materials as No. 1; An obvious characteristic band 160bp has been compared for No. 2 with other 6 materials; No. 3 have an obvious characteristic band 200bp; No. 4 have 3 characteristic strips, are respectively 250bp, 219bp and 149bp; No. 51 characteristic strip 190bp; No. 6 have 1 characteristic strip 140bp; No. 7 have 1 characteristic strip 120bp.In addition, we utilize this to the electrophoretic band of specific primers amplify, construct species molecular fingerprint collection of illustrative plates (Fig. 2), can be used for cultivar identification and the differentiation with other Laomangmai material and nearly edge species.Illustrate that the present invention's special primer used, method for quick and the finger printing determination rates to 7 Laomangmai kinds (being) is high, accuracy is strong.
embodiment 2 Laomangmai kind (being) finger printing and the application of method for quick in Laomangmai kind and wild material and nearly edge species identification
1, test materials
44 parts of materials are chosen in test, and wherein 1-7 material is Laomangmai kind, and No. 8-38 is wild Laomangmai kind matter, and 39-44 is Wild Germplasm of Elymus nutans Griseb.
2, DNA extraction
Identical with scheme one, no longer repeat.
3, PCR amplification
15 μ LPCR amplification systems comprise: template DNA (25ng/ μ L) 2 μ L, Golden easy Reaction Mix 7.5 μ L, special primer group Pf/Pr (10 pmol/ μ L) each 0.5 μ L, Taq enzyme (2.5U/μ L) 0.2 μ L, aqua sterilisa 4.3 μ L.
Pcr amplification program adopts the grads PCR amplification program of universal Laomangmai kind (being) provided by the invention: 94 DEG C of sex change, and 30 sec, 65-61 DEG C anneal 30 sec, 72 DEG C of extensions 1 min, totally 5 circulations, and each cycle annealing temperature reduces by 1 DEG C; 94 DEG C of sex change 30 sec, 60 DEG C of annealing 30 sec, 72 DEG C extend 1 min, totally 30 circulations; 72 DEG C extend 10 min, 4 DEG C of maintenances.
4, electrophoresis detection
Amplified production 6% polyacrylamide gel (acrylamide: methene=19:1,7.5 mol/L urea, 1 × TBE damping fluid) detects.Sample point sample 6 μ L, with the D500 Marker of Tian Gen company for contrast, prerunning 30 min under 200 V voltages, then electrophoresis 1.5 h under 400 V voltages, hectograph carries out Silver stain with silver-colored dye liquor and develops the color in developing solution, and gel digital photo camera is preserved.
Wherein, silver-colored dye liquor is by 0.9 g AgNO
3join in 1L distilled water and be made into the silver-colored dye liquor that concentration is 0.09 %.
The formula of developing solution is as follows: NaOH 15g, formaldehyde 4ml, and sodium tetraborate 0.19g, adding distil water is to 1L.
The concrete steps of silver dye development are as follows:
(1) silver dye: after electrophoresis terminates, the glue after cleaning is put into the 200ml cma staining liquid container put in advance, dye 10 minutes;
(2) develop: silver dye terminates rear distilled water washing 1-2 time, then develops in the 200 ml developing solutions adding precooling, high-visible to band, develops about 5 minutes;
(3) stop showing: glue is put in 7 % HAC and stop aobvious several minutes;
(4) the complete glue of dyeing is put on glass plate, gel.
5, result
As shown in Figure 3: the band that special primer increases 7 kinds (being) is compared with other materials does not have identical bands of a spectrum, the bands of a spectrum of each kind (being) have uniqueness, can utilize the finger printing of structure (Fig. 2) that 7 kinds (being) and 31 parts of wild Laomangmai materials are identified differentiation completely.This special primer also can be used for the qualification of Laomangmai kind and nearly edge species wild Elymus nutans simultaneously.Primer P can increase in wild Elymus nutans kind does not have special band as 105bp in Laomangmai kind, also can amplify at Laomangmai the characteristic strip do not had in wild Elymus nutans, utilizing these characteristic strips to combine can by Laomangmai kind (being) and Elymus nutans qualification.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (10)
1., for an Auele Specific Primer for Laomangmai kind or ore grade indexes, it is characterized in that: the nucleotides sequence of described Auele Specific Primer is classified as:
Upstream primer Pf:AGATGAAGCTGGTAACCGAGACAG;
Downstream primer Pr:ATTTCCTCTAATGGAAGCTCTGGC.
2., for a test kit for Laomangmai kind or ore grade indexes, it is characterized in that: described test kit comprises Auele Specific Primer according to claim 1.
3. Auele Specific Primer according to claim 1, the application of test kit according to claim 2 in Laomangmai kind or strain Rapid identification.
4. application according to claim 3, is characterized in that: concrete steps are as follows: (1) extracts Laomangmai kind matter DNA and application rights requires that the Auele Specific Primer described in 1 or test kit according to claim 2 carry out pcr amplification;
(2) gel electrophoresis carried out to amplified production and dye, amplified band is analyzed: there is specific characteristics band 225bp, 170bp's and 110bp is same moral kind, what have specific characteristics band 160bp is that green grass or young crops herds kind, what have specific characteristics band 200bp is Xinjiang Laomangmai cultivar, there is specific characteristics band 250bp, 219bp's and 149bp is Inner Mongol Laomangmai cultivar, what have specific characteristics band 190bp is the second Inner Mongol Laomangmai cultivar, what have specific characteristics band 140bp is river grass No. 2 kinds, what have specific characteristics band 120bp is Hongyuan strain.
5. application according to claim 4, is characterized in that: the reaction conditions of described pcr amplification is: 94 DEG C of sex change 30 sec, 65-61 DEG C anneal 30 sec, and 72 DEG C extend 1 min, totally 5 circulations, and each cycle annealing temperature reduces by 1 DEG C; 94 DEG C of sex change 30 sec, 60 DEG C of annealing 30 sec, 72 DEG C extend 1 min, totally 30 circulations; 72 DEG C extend 10 min, 4 DEG C of maintenances.
6. application according to claim 4, is characterized in that: the preparation method of silver-colored dye liquor used during described dyeing is: by 0.8-1 g AgNO
3add in 1L distilled water, be made into the silver-colored dye liquor that concentration is 0.08 %-1 %; Preferably, concentration is 0.09 %.
7. application according to claim 4, is characterized in that: the preparation method of developing solution used during described dyeing is: be added in distilled water by NaOH 15g, formaldehyde 4ml, sodium tetraborate 0.19g, be settled to 1L.
8. the application according to claim 4,6 or 7, is characterized in that: the concrete steps of described dyeing are:
(1) silver dye: after electrophoresis terminates, the glue after cleaning is put into the 200ml cma staining liquid container put in advance, dye 10 minutes;
(2) develop: silver dye terminates rear distilled water washing 1-2 time, then develops in the 200 ml developing solutions adding precooling, high-visible to band, develops about 5 minutes;
(3) put on glass plate by the complete glue of dyeing, gel digital photo camera is preserved.
9. the finger printing of Laomangmai kind or strain, is characterized in that: be that the Laomangmai kind matter DNA of extraction is carried out pcr amplification, to the amplified band obtained after amplified production gel electrophoresis also dyeing; Wherein, what have specific characteristics band 225bp, 170bp and 110bp is same moral kind, what have specific characteristics band 160bp is that green grass or young crops herds kind, what have specific characteristics band 200bp is Xinjiang Laomangmai cultivar, what have specific characteristics band 250bp, 219bp and 149bp is Inner Mongol Laomangmai cultivar, what have specific characteristics band 190bp is the second Inner Mongol Laomangmai cultivar, what have specific characteristics band 140bp is river grass No. 2 kinds, and what have specific characteristics band 120bp is Hongyuan strain.
10. the finger printing of Laomangmai kind according to claim 9 or strain differentiating same moral kind from the Laomangmai kind matter and nearly edge species of different sources, green grass or young crops herds kind, Xinjiang Laomangmai cultivar, Inner Mongol Laomangmai first cultivar, Inner Mongol Laomangmai second cultivar, application in river grass No. 2 kinds and Hongyuan strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410712070.XA CN104450902B (en) | 2014-12-01 | 2014-12-01 | The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410712070.XA CN104450902B (en) | 2014-12-01 | 2014-12-01 | The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450902A true CN104450902A (en) | 2015-03-25 |
| CN104450902B CN104450902B (en) | 2017-05-31 |
Family
ID=52897647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410712070.XA Expired - Fee Related CN104450902B (en) | 2014-12-01 | 2014-12-01 | The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450902B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106279A (en) * | 2019-05-24 | 2019-08-09 | 四川省草原科学研究院 | Unit point SSR primer sets and its application based on the exploitation of siberian wildrye genome sequence |
-
2014
- 2014-12-01 CN CN201410712070.XA patent/CN104450902B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| HTTP://TITAN.BIOTEC.UIUC.EDU/LEYMUS/RESOURCES/: "Elymus_ssr_primer.xls", 《HTTP://TITAN.BIOTEC.UIUC.EDU/LEYMUS/RESOURCES/》 * |
| 杨培浩: "不同小麦品种的细胞遗传学研究及SSR遗传多样性分析", 《中国优秀硕士学位论文全文数据库》 * |
| 谢文刚: "鸭茅杂交种的SSR 分子标记鉴定及其遗传变异分析", 《草业学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106279A (en) * | 2019-05-24 | 2019-08-09 | 四川省草原科学研究院 | Unit point SSR primer sets and its application based on the exploitation of siberian wildrye genome sequence |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450902B (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101824484B (en) | DNA fingerprint detection method for authenticity identification of cotton variety | |
| CN102732973B (en) | Construction method for DNA fingerprint database of high flux cotton variety | |
| CN101921866A (en) | Method for identifying cotton variety by utilizing SSR core primers | |
| CN105886613B (en) | Method for constructing soybean variety SSR fingerprint identification card | |
| CN101560556B (en) | Method for detecting DNA fingerprint purity in cotton crossbreeds | |
| CN106521024B (en) | M. truncatula microRNA-SSR molecular labeling primer and the application in alfalfa variety identification | |
| CN104651515A (en) | Method for constructing DNA fingerprint spectrum of tea tree | |
| CN108396075B (en) | The application of molecular labeling pPGPseq2A5 relevant to peanut oil content | |
| CN102146448A (en) | DNA finger prints of 30 main cultivars of upland cotton | |
| CN104846081A (en) | SSR labels of brassica oleracea red leaf gene Re and application thereof | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| CN104450902A (en) | Specific primer and kit for identifying siberian wildrye varieties or strains and application of specific primer and kit in identification of siberian wildrye varieties or strains | |
| CN103911435A (en) | Method of identifying the purity of sugarcane hybrid seeds by utilization of SSR marking and capillary electrophoresis | |
| CN103740812A (en) | Method for identification of Avena species A genome and C genome | |
| CN103923910A (en) | Rapid identification method of siberian wildrye germplasm as well as EST-SSR molecular marker specific primer group and special kit of siberian wildrye germplasm | |
| CN103937873A (en) | DNA fingerprint detection method of cotton variety 'Zhongmiansuo No.49' | |
| CN113265481A (en) | Lycoris fluorescent EST-SSR molecular marker primer, method for identifying lycoris interspecific hybrid F1 generation and application thereof | |
| CN110484644B (en) | Fingerprint construction method and application of larch germplasm | |
| CN104004838B (en) | Sudan. grass Varieties verity detection method and primer special | |
| CN103276097A (en) | PCR detection method for identifying germplasms of four populations of Pelodiscus sinensis, primer group and kit | |
| CN105420354A (en) | Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks | |
| CN102776271A (en) | Molecular marking method for identifying tea clonal variety of tea trees | |
| CN103451184A (en) | Schizaphis graminum specific SS-COI primers, kit comprising primers and detection method of schizaphis graminum | |
| CN102586242A (en) | Transgenic soybean BPS-CV127-9 transformation event exogenous insertion carrier flanking gene and application thereof | |
| CN108220471B (en) | Molecular specific marker primer for identifying national-grade tea tree improved variety Fuyun No. 6 and identification method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170531 Termination date: 20171201 |