CN104450902B - The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain - Google Patents
The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain Download PDFInfo
- Publication number
- CN104450902B CN104450902B CN201410712070.XA CN201410712070A CN104450902B CN 104450902 B CN104450902 B CN 104450902B CN 201410712070 A CN201410712070 A CN 201410712070A CN 104450902 B CN104450902 B CN 104450902B
- Authority
- CN
- China
- Prior art keywords
- siberian wildrye
- band
- wildrye
- siberian
- cultigen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of for siberian wildrye kind or the specific primer of ore grade indexes, and its nucleotides sequence is classified as：Sense primer Pf：AGATGAAGCTGGTAACCGAGACAG；Anti-sense primer Pr：ATTTCCTCTAATGGAAGCTCTGGC.The present invention also provides corresponding kit and its application in identification siberian wildrye kind or strain.The primer and corresponding PCR amplification programs and electrophoresis product detection method provided using the present invention, can be to 7 domestic siberian wildrye kinds（System）Carry out quick, precise Identification.Also can be by specific amplified band by above-mentioned 7 domestic siberian wildrye kinds（System）Made a distinction with wild material and nearly edge species.
Description
Technical field
The present invention relates to biotechnology assistant breeding, the specificity of more particularly to a kind of siberian wildrye kind or ore grade indexes
Primer, kit and its application in identification siberian wildrye kind or strain.
Background technology
Siberian wildrye（Elymus sibiricus L.）It is grass family（Poaceae）Tribe Triticeae（Triticeae）Elymuss
（Elymus）Perennual mesoxerophytes, be the type sepecies of Elymuss.Siberian wildrye on the Northern Hemisphere divide by Temperate Region in China
Cloth is wider, is the dispersed species of Eurasia, especially the important component of China's meadow steppe and alpine meadow community, can shape
Into sociales and constructive species.Have the advantages that winter resistance is strong, crude protein content is high due to it, good palatability, easily cultivate, siberian wildrye
One of widely used good forage in national " Natural Forest Protection Project " and " the project of grassland withdraw from grazing " is turned into.
The morphological indexes such as classification traditionally for siberian wildrye germplasm and identification Chang Yinai plant heights, spike length, tiller number, its
Planting cost is high, qualification cycle is long；Other morphological index is big by such environmental effects, with unstability, in continuous mode
Larger human error is there is also, so as to influence the reliability of qualification result.The siberian wildrye kind or cultigen promoted in production
Mostly wild material domestication, it is similar to wild material in form, it is difficult to pass through traditional morphological index be subject to accurately quickly
Identification, be unfavorable for siberian wildrye kind intellectual property protection, promote and rationally utilize.
With the fast development of Protocols in Molecular Biology, particularly molecular labeling and gene-tagging techniques foundation and into
Ripe, for development simplicity, fast and accurately Germplasm Identification technology provides effective means.SSR（Simple sequence
Repeat, simple repeated sequence）Mark is easy to because having abundant quantity, polymorphism high, codominance, amplification stabilization, primer sequence
The advantages of exchange, in paddy rice（Oryza sativa）, corn（Zea mays L.）, cotton（Gossypium herbaceum
L）, muskmelon（Cucumis melo L）, watermelon（Citrullus lanatus.）Applied in Germplasm Identification Deng crop.And
SSR molecular marker application is few in grass cultivation, is detected in lyme grass（Elymus dahuricus）, khuskhus（Stylosanthes
spp.）, alfalfa（Medicago sativa）, Korea lawn grass（Zopsia japonica）Deng a small number of grass seeds.At present, it is domestic still
The research report of molecular fingerprint map construction and quick detection without siberian wildrye kind.
The content of the invention
The present invention passes through a pair of SSR special primers（Table 1）Construct 7 siberian wildrye kinds（System）Molecular fingerprint collection of illustrative plates；Profit
7 kinds can be identified with this special primer and detection method（System）, also can be by kind and the wild siberian wildrye of other separate sources
Material and nearly edge species are distinguish between, and thus provide siberian wildrye kind（System）Molecular fingerprint collection of illustrative plates, quick detection kit and
Authentication method.
The invention provides the 1 couple specificity SSR primers for siberian wildrye kind or ore grade indexes, referring specifically to table 1.
Table 1：Specific siberian wildrye SSR primers
The present invention also provides the quick detection kit for siberian wildrye kind or ore grade indexes, by specific amplification bar
Band can quick and precisely identify siberian wildrye kind（System）, also can accurately quickly by kind（System）From the wild siberian wildrye kind of separate sources
Identified in matter and nearly edge species and.
Kit of the invention includes：Golden easy Reaction Mix premixed liquids, Taq enzyme, specificity SSR primers
Group P.Upstream and downstream primer is diluted to concentration respectively for 10 pmol/ μ L, Pf, Pr liquid are named as successively, -20 DEG C save backup.
The present invention provides siberian wildrye kind（System）Rapid identification method, the method comprises the following steps：
（1）The extraction of siberian wildrye germplasm DNA；
（2）PCR is expanded：Reaction condition is：94 DEG C of denaturation 30 sec, 65-, 61 DEG C of 30 sec of annealing, 72 DEG C of extensions
1 min, totally 5 circulations, 1 DEG C of each cycle annealing temperature reduction；94 DEG C of denaturation 30 sec, 60 DEG C of anneal 30 sec, 72
DEG C extend 1 min, totally 30 circulation；72 DEG C of 10 min of extension, 4 DEG C of holdings.
（3）Gel electrophoresis is carried out to amplified production and is dyeed；Amplified band is analyzed afterwards：With specific characteristics
Band 225bp, 170bp and 110bp's is same moral kind, and with specific characteristics band 160bp is that green grass or young crops herds kind, with spy
Different in nature characteristic bands 200bp's is Xinjiang siberian wildrye cultigen, with specific characteristics band 250bp, 219bp and 149bp
It is Inner Mongol siberian wildrye cultigen, with specific characteristics band 190bp is second Inner Mongol siberian wildrye cultigen, with special
Property characteristic bands 140bp be river No. 2 kinds of grass, with specific characteristics band 120bp is Hongyuan strain.
The present invention constructs 7 siberian wildrye kinds（System）Finger-print, referring to Fig. 2, can be with standard using the finger-print
Really efficiently to 7 siberian wildrye kinds（System）Identified.
The present invention is also provided and reflected from the wild siberian wildrye germplasm and nearly edge species of separate sources using above-mentioned finger-print
Other 7 siberian wildrye kinds（System）Method, step is as follows：
（1）Extract the extraction of germplasm DNA to be measured；
（2）PCR is expanded：Reaction condition is：94 DEG C of denaturation 30 sec, 65-, 61 DEG C of 30 sec of annealing, 72 DEG C of extensions
1 min, totally 5 circulations, 1 DEG C of each cycle annealing temperature reduction；94 DEG C of denaturation 30 sec, 60 DEG C of anneal 30 sec, 72
DEG C extend 1 min, totally 30 circulation；72 DEG C of 10 min of extension, 4 DEG C of holdings；
（3）Gel electrophoresis is carried out to amplified production and is dyeed, amplified band is analyzed afterwards：If specific characteristics bar
Band is identical with finger-print, then be 7 siberian wildrye kinds（System）In one, and then which kind of old awns be specifically judged as
Wheat variety（System）；Conversely, not being then.
The present invention is also optimized to the detection method after PCR primer gel electrophoresis, specific as follows：
Required reagent includes：
Silver staining liquid：By 0.8-1 g AgNO3 Add in 1L distilled water, be made into the silver staining liquid that concentration is 0.08 %-1 %, it is excellent
Selection of land, plus 0.9 g AgNO3The silver staining liquid best results that concentration is 0.09 % are made into in 1L distilled water.
Developer solution：The amount of each component added by preparation different volumes developer solution is as shown in table 2.
Table 2：Different volumes development liquid making method
Fixer：7% glacial acetic acid solution.
Silver staining development concrete operation step is as follows：
1）Silver staining：Be put into the glue after cleaning in the 200ml cma staining liquid put in advance in container after terminating by electrophoresis,
Dyeing 10-15 minutes；Preferably, room temperature is dyeed 10 minutes.
2）Development：Silver staining terminates rear distilled water and washes 1-2 times, development in 200 ml developer solutions of precooling is added, to bar
With high-visible.
Preferably, develop 5 minutes or so, otherwise background colour is too deep.
3）Stop showing：Stop aobvious several minutes during glue is put into 7 % HAC；（This step can be saved）
4）The glue for finishing will be dyeed to put in glass plate, digital photo camera is preserved.
Compared with conventional method, the method time is short, efficiency high, and can obtain clear electrophoresis picture.
The invention provides for identifying siberian wildrye kind（System）It is special SSR molecular marker primer, fingerprint map construction, fast
Fast detection kit and detection method.The primer provided using the present invention and corresponding PCR amplification programs and electrophoresis product are detected
Method, can be to 7 domestic siberian wildrye kinds（System）Carry out quick, precise Identification.Also can be by specific amplified band by above-mentioned 7
Domestic siberian wildrye kind（System）Made a distinction with wild material and nearly edge species.
The utilization and extention of excellent herbage variety is significant for artificial pasture organizational system and grassland agriculture development.Therefore,
Aborning, it is ensured that be particularly important using the authenticity of kind.Special primer, the varieties systematics figure provided using the present invention
Spectrum and method for quick, can rapidly and accurately by 7 of current Spread in China excellent siberian wildrye kinds（System）Identified, and
Made a distinction with other wild siberian wildrye materials and nearly edge species.The technical method is for improved seeds protection, popularization, using tool
There is significant application value.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, with reality of the invention
Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is 7 siberian wildrye kinds（System）Using the amplification electrophoresis pattern of special primer P；
Fig. 2 is domestic 7 siberian wildrye kinds（System）Molecular fingerprint collection of illustrative plates；Wherein, 1-7 is represented respectively：" same to moral " siberian wildrye,
" green grass or young crops is herded " siberian wildrye, Xinjiang siberian wildrye cultigen, Inner Mongol siberian wildrye cultigen 1, Inner Mongol siberian wildrye cultigen 2, " river grass 2 " is old
Awns wheat, " Hongyuan " siberian wildrye new lines；
Fig. 3 is special primer P in 7 siberian wildrye kinds（System）, in wild siberian wildrye germplasm and Germplasm of Elymus nutans Griseb
Amplification electrophoresis pattern.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, unless otherwise specified, is conventional method.Test material used in following embodiments, unless otherwise specified, is certainly
What routine biochemistry reagent shop was commercially available.
Embodiment 1：Siberian wildrye kind（System）Quick detection used kit, detection method are in kind（System）Answering in identification
With and fingerprint map construction
1st, test material：7 siberian wildrye kinds of Spread in China（System）, referring specifically to table 3.
Table 3：Siberian wildrye germplasm information list
2nd, key step：
（1）Vegetable material DNA is extracted
Each kind（System）25 individual plants are randomly selected, the spire mixed in equal amounts that each individual plant is gathered, using plant base
Because group DNA extraction kit extracts biased sample STb gene；The DNA of the extraction agarose gel electrophoresis and Nanodrop of 0.8 %
ND-1000 ultraviolet specrophotometers（Thermo Scientific, DE, USA）The detection of DNA concentration and purity is carried out respectively；Will
DNA sample is placed in -20 DEG C of Refrigerator stores；When experiment is started, each DNA sample taking-up part is diluted to 25 ng/ μ L,
It is put in 4 DEG C of Refrigerator stores and uses.
（2）PCR is expanded
There is provided reagent using kit of the present invention carries out siberian wildrye PCR amplifications：
15 μ LPCR amplification systems are included：Template DNA（25ng/μL）2 μ L, Golden easy Reaction Mix
7.5 μ L, special primer group Pf/Pr (10 pmol/ μ L) each 0.5 μ L, Taq enzyme (2.5U/μ L) 0.2 μ L, the μ of aqua sterilisa 4.3
L.Specific primer Pf/Pr is referring to table 1.
PCR amplification programs provide universal siberian wildrye kind using the present invention（System）Grads PCR amplification program：94
DEG C denaturation 30 sec, 61 DEG C of 65- annealing 30 sec, 72 DEG C of 1 min of extension, totally 5 circulations, each cycle annealing temperature
Reduce by 1 DEG C；94 DEG C of denaturation 30 sec, 60 DEG C of annealing 30 sec, 72 DEG C of 1 min of extension, totally 30 circulations；72 DEG C are prolonged
Stretch 10 min, 4 DEG C of holdings.
（3）Electrophoresis detection
The amplified production electrophoresis and dyeing method provided using the present invention：With 6 % polyacrylamide gel (acrylamides：
Methene=19:1,7.5 mol/L urea, 1 × TBE buffer solutions) detected.The μ L of sample point sample 6, with the D500 of Tiangeng company
Marker is to compare, the min of prerunning 30 under 200 V voltages, then the h of electrophoresis 1.5, hectograph silver staining under 400 V voltages
Liquid carries out Silver stain and is developed the color in developer solution, and gel is preserved with digital photo camera.
Wherein, silver staining liquid is by 0.9 g AgNO3It is added in 1L distilled water and is made into the silver staining liquid that concentration is 0.09 %.
The preparation method of developer solution is as follows：NaOH 15g, formaldehyde 4ml, sodium tetraborate 0.19g, plus distilled water are added to 1L.
What silver staining was developed comprises the following steps that：
（1）Silver staining：Glue after cleaning is put into container in the 200ml cma staining liquid put in advance by electrophoresis after terminating
In, dye 10 minutes；
（2）Development：Silver staining terminates rear distilled water and washes 1-2 times, development in 200 ml developer solutions of precooling is added, to bar
With high-visible, develop 5 minutes or so；
（3）Stop showing：Stop aobvious several minutes during glue is put into 7 % HAC；
（4）The glue for finishing will be dyeed to put in glass plate, gel.
（4）As a result
Testing result is as shown in figure 1, primer P can be to 7 siberian wildrye kinds（System）A plurality of spy is expanded by each material
Different band is identified.From in terms of result, every part of material and remaining 6 parts of material have obvious characteristic band, can be used for kind mirror
It is fixed.Such as No. 1 has been compared 3 obvious characteristic strip 225bp, 170bp and 110bp with other 6 materials；No. 2 and other 6 materials
Compared to there is obvious characteristic band 160bp；No. 3 have an obvious characteristic band 200bp；No. 4 have 3 characteristic strips, respectively
250bp, 219bp and 149bp；No. 51 characteristic strip 190bp；No. 6 have 1 characteristic strip 140bp；No. 7 have 1 characteristic strip 120bp.
Additionally, we construct species molecular fingerprint collection of illustrative plates using this electrophoretic band to special primer amplification（Fig. 2）, can be used for product
Plant identification and the differentiation with other siberian wildrye materials and nearly edge species.Illustrate special primer, method for quick used of the invention
With finger-print to 7 siberian wildrye kinds（System）Determination rates are high, accuracy is strong.
The siberian wildrye kind of embodiment 2（System）Finger-print and method for quick are in siberian wildrye kind and wild material and near
Application in edge species identification
1st, test material
44 parts of materials are chosen in experiment, and wherein 1-7 materials are siberian wildrye kind, and No. 8-38 is wild siberian wildrye germplasm, 39-
44 is Wild Germplasm of Elymus nutans Griseb.
2nd, DNA is extracted
It is identical with scheme one, it is not repeated.
3rd, PCR amplifications
15 μ LPCR amplification systems are included：Template DNA（25ng/μL）2 μ L, Golden easy Reaction Mix
7.5 μ L, special primer group Pf/Pr (10 pmol/ μ L) each 0.5 μ L, the μ L of Taq enzyme (2.5U/μ L) 0.2, aqua sterilisa
4.3 μL。
The universal siberian wildrye kind that PCR amplification programs are provided using the present invention（System）Grads PCR amplification program：94
DEG C denaturation, 61 DEG C of 30 sec, 65- annealing 30 sec, 72 DEG C of 1 min of extension, totally 5 circulations, each cycle annealing temperature
Reduce by 1 DEG C；94 DEG C of denaturation 30 sec, 60 DEG C of annealing 30 sec, 72 DEG C of 1 min of extension, totally 30 circulations；72 ℃
Extend 10 min, 4 DEG C of holdings.
4th, electrophoresis detection
Amplified production is with 6% polyacrylamide gel (acrylamide：Methene=19:1,7.5 mol/L urea, 1 × TBE
Buffer solution) detected.The μ L of sample point sample 6, are control, prerunning under 200 V voltages with the D500 Marker of Tiangeng company
30 min, the then h of electrophoresis 1.5 under 400 V voltages, hectograph carry out Silver stain with silver staining liquid and are developed the color in developer solution, coagulate
Glue is preserved with digital photo camera.
Wherein, silver staining liquid is by 0.9 g AgNO3It is added in 1L distilled water and is made into the silver staining liquid that concentration is 0.09 %.
The formula of developer solution is as follows：NaOH 15g, formaldehyde 4ml, sodium tetraborate 0.19g, plus distilled water is to 1L.
What silver staining was developed comprises the following steps that：
（1）Silver staining：Glue after cleaning is put into container in the 200ml cma staining liquid put in advance by electrophoresis after terminating
In, dye 10 minutes；
（2）Development：Silver staining terminates rear distilled water and washes 1-2 times, development in 200 ml developer solutions of precooling is added, to bar
With high-visible, develop 5 minutes or so；
（3）Stop showing：Stop aobvious several minutes during glue is put into 7 % HAC；
（4）The glue for finishing will be dyeed to put in glass plate, gel.
5th, result
As shown in Figure 3：Special primer is in 7 kinds（System）The band of amplification is compared not identical with other materials
Bands of a spectrum, each kind（System）Bands of a spectrum there is uniqueness, using build finger-print（Fig. 2）By 7 kinds（System）With 31
The wild siberian wildrye material of part identifies differentiation completely.While the special primer can also be used for, and siberian wildrye kind is wild with nearly edge species to hang down
The identification of fringe lyme grass.Primer P can be expanded in wild Elymus nutans kind does not have special band such as in siberian wildrye kind
105bp, the characteristic strip that can also do not have in siberian wildrye amplifies wild Elymus nutans can using the combination of these characteristic strips
Siberian wildrye kind（System）Identified with Elymus nutans.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention,
Although being described in detail to the present invention with reference to the foregoing embodiments, for a person skilled in the art, it still may be used
Modified with to the technical scheme described in foregoing embodiments, or equivalent is carried out to which part technical characteristic.
All any modification, equivalent substitution and improvements within the spirit and principles in the present invention, made etc., should be included in of the invention
Within protection domain.
Claims (6)
1. the application of specific primer or kit in siberian wildrye kind or strain Rapid identification；The siberian wildrye kind or product
System is that same moral kind, green grass or young crops herd kind, Xinjiang siberian wildrye cultigen, Inner Mongol siberian wildrye cultigen, the second siberian wildrye cultivation in Inner Mongol
Kind, river No. 2 kinds of grass and Hongyuan strain；Wherein,
The nucleotides sequence of the specific primer is classified as：
Sense primer Pf：AGATGAAGCTGGTAACCGAGACAG；
Anti-sense primer Pr：ATTTCCTCTAATGGAAGCTCTGGC；
The kit includes above-mentioned specific primer；
Specific authentication step is as follows：（1）Extracting siberian wildrye germplasm DNA and the described specific primer of application or kit is carried out
PCR is expanded；
（2）Gel electrophoresis is carried out to amplified production and is dyeed, amplified band is analyzed：With specific characteristics band
225bp, 170bp and 110bp's is same moral kind, and with specific characteristics band 160bp is that green grass or young crops herds kind, with specificity
Characteristic bands 200bp's is Xinjiang siberian wildrye cultigen, and with specific characteristics band 250bp, 219bp and 149bp is interior
Siberian wildrye cultigen is covered, with specific characteristics band 190bp is second Inner Mongol siberian wildrye cultigen, with specific special
Levy band 140bp is river No. 2 kinds of grass, and with specific characteristics band 120bp is Hongyuan strain.
2. application according to claim 1, it is characterised in that：The reaction condition of PCR amplification is：94 DEG C of denaturation 30
Sec, 65- 61 DEG C of annealing 30 sec, 72 DEG C of 1 min of extension, totally 5 circulations, 1 DEG C of each cycle annealing temperature reduction；94
DEG C denaturation 30 sec, 60 DEG C annealing 30 sec, 72 DEG C extension 1 min, totally 30 circulation；72 DEG C extend 10 min, 4
DEG C keep.
3. application according to claim 1, it is characterised in that：The preparation method of silver staining liquid used during the dyeing is：
By 0.8-1 g AgNO3 Add in 1L distilled water, be made into the silver staining liquid that concentration is 0.08 %-1 %.
4. application according to claim 1, it is characterised in that：The preparation method of developer solution used is during the dyeing：
NaOH 15g, formaldehyde 4ml, sodium tetraborate 0.19g are added into distilled water, 1L is settled to.
5. the application according to claim 1,3 or 4, it is characterised in that：The dyeing is concretely comprised the following steps：
（1）Silver staining：Be put into the glue after cleaning in the 200ml cma staining liquid put in advance in container after terminating by electrophoresis, dye
Color 10 minutes；
（2）Development：Silver staining terminates rear distilled water and washes 1-2 times, adds development in 200 ml developer solutions of precooling, clear to band
It is clear visible, develop 5 minutes；
（3）The glue for finishing will be dyeed to put in glass plate, gel is preserved with digital photo camera.
6. the finger-print of siberian wildrye kind or strain is differentiating same moral from the siberian wildrye germplasm of separate sources and nearly edge species
Kind, green grass or young crops herd kind, Xinjiang siberian wildrye cultigen, Inner Mongol siberian wildrye cultigen, second Inner Mongol siberian wildrye cultigen, river grass 2
Application in number kind and Hongyuan strain；
The finger-print of the siberian wildrye kind or strain, is that the siberian wildrye germplasm DNA of extraction is entered into performing PCR amplification, to amplification
The amplified band obtained after product gel electrophoresis and dyeing；Wherein, with specific characteristics band 225bp, 170bp and 110bp
Be same moral kind, with specific characteristics band 160bp is that green grass or young crops herds kind, is with specific characteristics band 200bp
Xinjiang siberian wildrye cultigen, with specific characteristics band 250bp, 219bp and 149bp is Inner Mongol siberian wildrye cultigen, tool
Have specific characteristics band 190bp is second Inner Mongol siberian wildrye cultigen, and with specific characteristics band 140bp is river
Careless No. 2 kinds, with specific characteristics band 120bp is Hongyuan strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410712070.XA CN104450902B (en) | 2014-12-01 | 2014-12-01 | The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410712070.XA CN104450902B (en) | 2014-12-01 | 2014-12-01 | The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450902A CN104450902A (en) | 2015-03-25 |
| CN104450902B true CN104450902B (en) | 2017-05-31 |
Family
ID=52897647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410712070.XA Expired - Fee Related CN104450902B (en) | 2014-12-01 | 2014-12-01 | The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450902B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106279B (en) * | 2019-05-24 | 2020-03-17 | 四川省草原科学研究院 | Single-site SSR primer group developed based on Miscanthus formosanus genome sequence and application thereof |
-
2014
- 2014-12-01 CN CN201410712070.XA patent/CN104450902B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450902A (en) | 2015-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105154550B (en) | A kind of method using 1217 purity of EST-SSR molecular labeling Rapid identification variety of watermelon treasure sweet tea | |
| CN102732973B (en) | Construction method for DNA fingerprint database of high flux cotton variety | |
| CN101921866A (en) | Method for identifying cotton variety by utilizing SSR core primers | |
| CN103667480B (en) | SSR core primer group developed based on sesame complete genomic sequence and application | |
| CN105624320A (en) | Method for identifying Shuchazao tea tree variety by utilizing SSR fingerprint | |
| CN105886613B (en) | Method for constructing soybean variety SSR fingerprint identification card | |
| CN101824484A (en) | DNA fingerprint detection method for authenticity identification of cotton variety | |
| CN102787172B (en) | Method for identifying barley varieties by SSR (simple sequence repeat) primers and applications of method | |
| CN109868328B (en) | SSR molecular marker for identifying paeonia rockii varieties and application | |
| CN101560556B (en) | Method for detecting DNA fingerprint purity in cotton crossbreeds | |
| Taylor et al. | Species limits in Vachellia (Acacia) karroo (Mimosoideae: Leguminoseae): Evidence from automated ISSR DNA “fingerprinting” | |
| CN108034754A (en) | Differentiate the method for purple handsome new tea cultivar using SSR finger-prints | |
| CN106244681A (en) | A kind of method and the application that utilize genome SSR and EST SSR finger printing to differentiate mung bean variety | |
| CN104928396A (en) | Method for rapidly identifying hot pepper species and golden pepper purity degree by using EST-SSR molecular markers | |
| CN106967797A (en) | The specific sequence and detection method of muskmelon seedses purity detecting and application | |
| CN104450902B (en) | The specific primer of a kind of siberian wildrye kind or ore grade indexes, kit and its application in identification siberian wildrye kind or strain | |
| CN103993070B (en) | A kind of SSR primer for exquisite joint melon hybrid seed purity qualification and method | |
| CN104004845A (en) | Method and special primer set for identifying facticity to-be-tested variety belonging to CCRI 63 | |
| Wan et al. | The karyotype, genome survey, and assembly of Mud artemisia (Artemisia selengensis) | |
| CN103937873B (en) | The DNA fingerprint detection method of cotton variety ' No. 49, CCRI ' | |
| CN104004838B (en) | Sudan. grass Varieties verity detection method and primer special | |
| CN101619358A (en) | Method for identifying breeds of Chinese cabbage and special kit thereof | |
| CN104611442B (en) | For differentiating Primer composition and its application of Rice Production in Ningxia kind | |
| CN103146832B (en) | Method for detecting or performing aided detection on sorghum sudanense nationally checked variety | |
| CN105420354A (en) | Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170531 Termination date: 20171201 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |