CN104404147B - Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice - Google Patents
Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice Download PDFInfo
- Publication number
- CN104404147B CN104404147B CN201410693230.0A CN201410693230A CN104404147B CN 104404147 B CN104404147 B CN 104404147B CN 201410693230 A CN201410693230 A CN 201410693230A CN 104404147 B CN104404147 B CN 104404147B
- Authority
- CN
- China
- Prior art keywords
- seq
- series
- hybrid rice
- primer
- sterile line
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention provides a specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice. The specific primer combination comprises ZJJU01, ZJJU02, ZJJU03 and ZJJU04, the nucleotide sequences of which are as shown in SEQ ID NO.1-8. The invention further provides a method of utilizing the primer combination to identify the sterile line Jun 1A of the three-line hybrid rice. The method comprises the following steps: firstly extracting a targeted plant genome, using the genome as a template, and using the specific primer combination claimed in the claim 1 to perform PCR (Polymerase Chain Reaction). The primer disclosed by the invention is designed according to the ISSR (Inter-simple Sequence Repeat) primer amplification sequence capable of identifying the sterile line Jun 1A of the three-line hybrid rice, and can be used for quickly identifying the sterile line Jun 1A of the three-line hybric rice from rice varieties through PCR amplification. The method for identifying the sterile Jun 1A of the three-line hybrid rice provided by the invention can be used for purity identification of the rice variety, and further can be applied to assist breeding the rice variety.
Description
Technical field
The present invention relates to technical field of biological, it is used for detecting series of three-series hybrid rice sterile line fine horse 1A particularly to one kind
Specific primer pair.
Background technology
China is hybrid rice seeds producing country maximum in the world and country of consumption, has huge hybrid rice seeds city
?.Domestic hybrid rice Annual planting area accounts for more than the 59% of paddy rice year total cultivated area at present, makes rice yield significantly
Improve, the grain security for ensureing China is made that significant contribution.Obtaining highly purified hybrid seed is that to give full play to hybrid excellent
The basis of gesture yield potential.Mechanical admixture and biology hybrid are the main sources of series of three-series hybrid rice parent's hybrid strain.Seed is pure
Degree is the leading indicator weighing Seed Quality of Hybrid Rice, and the lower general who has surrendered of purity leads to the obvious reduction of crop yield and quality.
Low-purity, the hybrid rice seeds of authenticity difference bring extreme loss to agricultural production, are seed quality testing department, breeding research list
Position, production of hybrid seeds unit and seeds company's questions of common interest.The purity of series of three-series hybrid rice sterile line is restriction Cross-incompatibility groups
Key factor.
Series of three-series hybrid rice sterile line " fine horse 1A " is the autonomous cultivation of the applicant, sterile line " fine horse 1A " and restorer
Rice varieties " excellent 172 " of fine horse, and sterile line " fine horse 1A " and restorer " R522 " combo in the triple crossing that " R0172 " combo is bred as
In the triple crossing precocity being bred as, " Hubei Province's variety certification, blast resisting are all passed through, rice is of fine quality, is in excellent 522 " of fine horse to rice varieties
The new crop varieties of suitable Enshi State of Hubei Province plantation.
During stating research and development in realization, inventors herein have recognized that at least there is problems with prior art：
Do not identify the special primer of series of three-series hybrid rice sterile line " fine horse 1A " it is impossible to by above-mentioned rice varieties and its parent
Distinguish it is impossible to it is carried out with the work such as quick seed purity molecular markers for identification and related molecular mark.
Content of the invention
The invention provides a kind of Specific primer pair for identifying series of three-series hybrid rice sterile line fine horse 1A, solve the back of the body
Problem in scape technology, can fast and accurately be identified to series of three-series hybrid rice sterile line fine horse 1A using the combination of this primer.
Realizing the technical scheme that above-mentioned purpose of the present invention adopted is：
A kind of Specific primer pair for identifying series of three-series hybrid rice sterile line fine horse 1A, including ZJJU01, ZJJU02,
SEQ ID NO.1 in ZJJU03 and ZJJU04, wherein ZJJU01 forward primer such as sequence table：
GAGAGAGAGAGAGAGACACTATTAACG；
SEQ ID NO.2 in ZJJU 01 reverse primer such as sequence table：GAGAGAGAGAGAGAGACGGAGG；
SEQ ID NO.3 in ZJJU 02 forward primer such as sequence table：TCTCTCTCTCTCTCTCAAACAGAA；
SEQ ID NO.4 in ZJJU 02 reverse primer such as sequence table：CTCTCTCTCTCTCTCACTGTCG；
SEQ ID NO.5 in ZJJU 03 forward primer such as sequence table：TCAGTAGCTGTGTCTCAGAACTATGAC；
SEQ ID NO.6 in ZJJU 03 reverse primer such as sequence table：GTACCTCTTTTCGGCCAGGA；
SEQ ID NO.7 in ZJJU 04 forward primer such as sequence table：GGATAATCCGCATCAAGAAG；
SEQ ID NO.8 in ZJJU 04 reverse primer such as sequence table：GGTCACCCGAGAATTGCAT.
The present invention additionally provides the method according to the combination of above-mentioned primer to identify series of three-series hybrid rice sterile line fine horse 1A simultaneously,
Step is as follows：Extract target plant genome first, then with genome as template, with the special primer described in claim 1
Combine into performing PCR detection.
Described PCR reaction condition is：95℃5min；95 DEG C of denaturation 30s, 65 DEG C of annealing 40s, wherein each circulation reduce
0.7 DEG C, 72 DEG C of extension 1min30s, 15 circulations；
94 DEG C of denaturation 30s, 55 DEG C of annealing 45s, 72 DEG C of extension 2min, 25 circulations；Extend 10min after 72 DEG C.
Described PCR reaction system is：The DNA profiling 0.8 μ l of 50ng/ μ l, 10 × PCR buffer solution 1 μ l, 2.5mM
DNTPs 0.8 μ l, each 0.2 μ l of 10 μM of forward and reverse primers, archaeal dna polymerase 0.5U, ddH2O complements to 10 μ l.
Present invention also offers a kind of detection kit containing above-mentioned Specific primer pair.
Mentioned reagent box can be carried out in the purity and assisting in its breeding of identification series of three-series hybrid rice sterile line fine horse 1A
Application.
The present invention, according to the ISSR primer amplification primers that can identify series of three-series hybrid rice sterile line fine horse 1A, passes through
PCR expands, and quickly can identify series of three-series hybrid rice sterile line fine horse 1A from other rice varieties.The three of present invention offer are miscellaneous
Hand over the authentication method of rice sterile line fine horse 1A, can be used for the Purity of above-mentioned rice varieties, and then enter in assisting its breeding
Row application.
Brief description
Fig. 1 is the amplification figure being reacted in paddy rice by PCR in the present embodiment；
Fig. 2 is the cluster analysis result figure being obtained by amplification and finger-print statistics.
Specific embodiment
Below in conjunction with the accompanying drawings and specific embodiment does detailed specific description to the present invention, but the protection model of the present invention
Enclose and be not limited to following examples.
The experimental technique of unreceipted actual conditions in following examples, generally according to normal condition, such as Sambrook etc.
's《Molecular cloning：Laboratory manual》(New York：Cold Spring Harbor Laboratory Press, 2001) in
Described condition, or according to the condition proposed by instrument or reagent manufacturer.Agents useful for same is commercial goods.
The Specific primer pair for identifying series of three-series hybrid rice sterile line fine horse 1A that the present embodiment provides, including
SEQ ID NO.1 in ZJJU01, ZJJU02, ZJJU03 and ZJJU04, wherein ZJJU01 forward primer such as sequence table：
GAGAGAGAGAGAGAGACACTATTAACG；
SEQ ID NO.2 in ZJJU 01 reverse primer such as sequence table：GAGAGAGAGAGAGAGACGGAGG；
SEQ ID NO.3 in ZJJU 02 forward primer such as sequence table：TCTCTCTCTCTCTCTCAAACAGAA；
SEQ ID NO.4 in ZJJU 02 reverse primer such as sequence table：CTCTCTCTCTCTCTCACTGTCG；
SEQ ID NO.5 in ZJJU 03 forward primer such as sequence table：TCAGTAGCTGTGTCTCAGAACTATGAC；
SEQ ID NO.6 in ZJJU 03 reverse primer such as sequence table：GTACCTCTTTTCGGCCAGGA；
SEQ ID NO.7 in ZJJU 04 forward primer such as sequence table：GGATAATCCGCATCAAGAAG；
SEQ ID NO.8 in ZJJU 04 reverse primer such as sequence table：GGTCACCCGAGAATTGCAT.
In the present embodiment, the method to identify series of three-series hybrid rice sterile line fine horse 1A is combined using above-mentioned primer, step is such as
Under：
1. experiment material
1.1 vegetable material
Middle fine horse excellent 1 and its parent sterile line 418A, maintainer 418B and restorer R964, the similar origin of middle fine horse excellent 1 is not
Educate be in nine B in nine A and maintainer；Fine horse excellent 522 and its parent sterile line fine horse 1A, maintainer fine horse 1B and restorer R522, fine horse is excellent
522 similar origin sterile line Fuyi No.A and her B of maintainer good fortune.
1.2 enzymes and reagent
Molecular biology reagents, TAKARA rTaq archaeal dna polymerase, 10 × PCR buffer solution, dNTP Mixture
(2.5mM) it is purchased from Dalian treasured biotech firm.
Other biochemical reagents are import packing or domestic pure analysis pure.Primer is by Nanjing Genscript Biotechnology Co., Ltd.
Synthesis.
1.3 laboratory apparatus
The broken instrument (Geno/grinder, USA) of vibration；
PCR amplification instrument：PTC-100TM(MJ,USA)；
Nucleic acid electrophoresis apparatus：DYYIII type YY0115-94 (Liuyi Instruments Plant, Beijing)；
DNA electrophoretic analysis system：GeneSnap Labworks image acquisition and analysis software；
Other Instruments includes：Thermostat water bath, electronic balance, centrifuge, vortex instrument, pure water meter, constant incubator etc..
2. experimental technique
The extraction of 2.1 oryza sativa genomic dnas
Single-seed rice is planted, and takes young leaflet tablet to extract material as DNA, according to reference to CSH Press
(Cold Spring Harbor Laboratory Press) publishes, Nina Irwin and Kaaren A.Janssen writes
《Molecular cloning》One book extracts the STb gene of rice material.
2.2PCR amplification
Special according to the ISSR primer amplification sequences Design that can identify series of three-series hybrid rice sterile line fine horse 1A and combinations thereof
Primer, using this 4 pairs of primer combinations, enters performing PCR amplification with oryza sativa genomic dna for template.
PCR amplification system is：10 × PCR buffer solution 1 μ l, 2.5mM dNTPs 0.6 μ l, 10 μM of forward and reverse primers each 0.2
μ l, archaeal dna polymerase 0.5U, 50ng/ μ l DNA profiling 0.5 μ l, ddH 2O complement to 10 μ l.
PCR amplification program：95℃5min；95 DEG C of denaturation 30s, 65 DEG C of annealing 40s, (wherein each circulation reduces by 0.7 DEG C)
72 DEG C of extension 1min30s, 15 circulations；94 DEG C of denaturation 30s, 55 DEG C of annealing 45s, 72 DEG C of extension 2min, 25 circulations；After 72 DEG C
Extend 10min.
3. experimental result
All with sterilized water as negative control, only when negative control expands no any banding pattern, then explanation PCR result can for amplification
Lean on.The amplified band of the detected material of statistics, feminine gender is calculated as 0, and the positive is calculated as 1.Statistics and cluster analysis result such as following table with
And shown in Fig. 1 and Fig. 2.Result shows, the 4 pairs of molecular labelings combination of the present invention can by series of three-series hybrid rice sterile line fine horse 1A with
A combination thereof distinguishes.
The finger-print statistics of 4 pairs of molecular labeling primer 2 series of three-series hybrid rice combinations of combination amplification
Claims (6)
1. a kind of Specific primer pair for identifying series of three-series hybrid rice sterile line fine horse 1A it is characterised in that：Including ZJJU01,
SEQ ID NO.1 in ZJJU02, ZJJU03 and ZJJU04, wherein ZJJU01 forward primer such as sequence table：
GAGAGAGAGAGAGAGACACTATTAACG；
SEQ ID NO.2 in ZJJU 01 reverse primer such as sequence table：GAGAGAGAGAGAGAGACGGAGG；
SEQ ID NO.3 in ZJJU 02 forward primer such as sequence table：TCTCTCTCTCTCTCTCAAACAGAA；
SEQ ID NO.4 in ZJJU 02 reverse primer such as sequence table：CTCTCTCTCTCTCTCACTGTCG；
SEQ ID NO.5 in ZJJU 03 forward primer such as sequence table：TCAGTAGCTGTGTCTCAGAACTATGAC；ZJJU 03
SEQ ID NO.6 in reverse primer such as sequence table：GTACCTCTTTTCGGCCAGGA；
SEQ ID NO.7 in ZJJU 04 forward primer such as sequence table：GGATAATCCGCATCAAGAAG；
SEQ ID NO.8 in ZJJU 04 reverse primer such as sequence table：GGTCACCCGAGAATTGCAT.
2. a kind of method of the identification series of three-series hybrid rice sterile line fine horse 1A based on the primer combination described in claim 1, it is special
Levy and be that step is as follows：Extract target plant genome first, then with genome as template, with the spy described in claim 1
Different primer combination carries out PCR detection.
3. identification series of three-series hybrid rice sterile line fine horse 1A according to claim 2 method it is characterised in that：Described
PCR reaction condition is：95℃5min；95 DEG C of denaturation 30s, 65 DEG C of annealing 40s, wherein each circulation reduce by 0.7 DEG C, 72 DEG C of extensions
1min30s, 15 circulations；
94 DEG C of denaturation 30s, 55 DEG C of annealing 45s, 72 DEG C of extension 2min, 25 circulations；Extend 10min after 72 DEG C.
4. the identification series of three-series hybrid rice sterile line fine horse 1A according to Claims 2 or 3 method it is characterised in that：Described
PCR reaction system be：The DNA profiling 0.8 μ l of 50ng/ μ l, 10 × PCR buffer solution 1 μ l, 2.5mM dNTPs0.8 μ l, 10 μM
The each 0.2 μ l of forward and reverse primer, archaeal dna polymerase 0.5U, ddH2O complements to 10 μ l.
5. a kind of detection kit containing Specific primer pair described in claim 1.
6. kit described in claim 5 in the purity identifying series of three-series hybrid rice sterile line fine horse 1A and assists in its breeding
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410693230.0A CN104404147B (en) | 2014-11-26 | 2014-11-26 | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410693230.0A CN104404147B (en) | 2014-11-26 | 2014-11-26 | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404147A CN104404147A (en) | 2015-03-11 |
| CN104404147B true CN104404147B (en) | 2017-02-22 |
Family
ID=52641810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410693230.0A Expired - Fee Related CN104404147B (en) | 2014-11-26 | 2014-11-26 | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404147B (en) |
-
2014
- 2014-11-26 CN CN201410693230.0A patent/CN104404147B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 运用ISSR标记鉴别水稻品种的初步研究;黄光文等;《杂交水稻》;20061231;第21卷(第3期);摘要，第64页左栏第二段、第1.3.1-1.3.3节,表2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404147A (en) | 2015-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103361425B (en) | Primer and method for identifying purity of cucumber 'Yuexiu No.3' hybrid seed | |
| CN105063035B (en) | The molecular labeling of Xanthomonas oryzae pv oryzae and its application | |
| CN104004828B (en) | A kind of molecule marker and application thereof identifying onion cytoplasmic type | |
| CN109234423B (en) | Application of soybean molecular marker and polymorphism thereof in identification of soybean branch number traits | |
| CN109868324A (en) | One species-specific primer and its detection method | |
| CN105713990A (en) | Wheat molecular marker and application thereof in identifying wheat yield related traits | |
| CN103789419B (en) | Co-dominance tag primer group for identifying allele type of rice photo-thermo-sensitive genic male-sterile gene p/tms12-1, and applications thereof | |
| CN102304587A (en) | Method for rapidly identifying erect panicle of rice | |
| Arya et al. | Diagnostic set of microsatellite markers for hybrid purity testing and molecular identification of hybrids and parental lines in sorghum | |
| CN102732511A (en) | Functional specificity molecule marker Pi7FNP of blast-resistance gene Pi7, method and application thereof | |
| CN104404156B (en) | Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method | |
| CN104404147B (en) | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice | |
| CN104357576B (en) | A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof | |
| CN105695454A (en) | Molecular marker for identifying sesame male sterile line of sesame and identifying method thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN112695125B (en) | Katelia SSR molecular marker primer composition and application thereof | |
| CN105861498B (en) | One kind SNP marker relevant to rubber tree dry incineration method and its application | |
| CN106755558A (en) | A set of primer special and its application for willow improved seeds Genetic identification | |
| CN107881252A (en) | Identify dCAPS marks, primer and its acquisition methods and the application of watermelon blight | |
| CN102618534A (en) | Functional specific molecular marker PikFNP for resistance genes Pik of rice blast and method and application of functional specific molecular marker PikFNP | |
| Park et al. | Rapid identification of Amaranthus caudatus and Amaranthus hypochondriacus by sequencing and PCR–RFLP analysis of two starch synthase genes | |
| CĂPRAR et al. | Evaluation of genetic diversity by DNA barcoding of local tomato populations from North-Western Romania | |
| CN106399513A (en) | Wheat gene TaSPL20-7D molecular marker and application thereof in identifying wheat yield related characters | |
| CN105420354A (en) | Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks | |
| CN105039526B (en) | Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170222 Termination date: 20201126 |