CN104357576B - A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof - Google Patents
A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof Download PDFInfo
- Publication number
- CN104357576B CN104357576B CN201410693416.6A CN201410693416A CN104357576B CN 104357576 B CN104357576 B CN 104357576B CN 201410693416 A CN201410693416 A CN 201410693416A CN 104357576 B CN104357576 B CN 104357576B
- Authority
- CN
- China
- Prior art keywords
- series
- parent
- fine horse
- seq
- hybrid rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of Specific primer pair for identifying series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, including JU01, JU02, JU03 and JU04, its nucleotide sequence such as SEQ? ID? shown in NO.1��8, the present invention additionally provides the method according to above-mentioned primer sets incompatible qualification series of three-series hybrid rice kind fine horse excellent 522 and parent thereof simultaneously, step is as follows: first extract target plant genome, then with genome for template, PCR detection is carried out with the Specific primer pair described in claim 1. The present invention, according to the ISSR primer amplification primers that can identify series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, passes through pcr amplification, it is possible to quickly identify series of three-series hybrid rice kind fine horse excellent 522 and parent thereof from other rice varieties. The authentication method of series of three-series hybrid rice kind fine horse excellent 522 provided by the invention and parent thereof, can be used for the Purity of above-mentioned rice varieties, and then applies in assisting its breeding.
Description
Technical field
The present invention relates to technical field of biological, particularly to a kind of Specific primer pair for detecting series of three-series hybrid rice kind fine horse excellent 522 and parent thereof.
Background technology
China is hybrid rice seeds manufacturing country maximum in the world and country of consumption, has huge hybrid rice seeds market. Current domestic hybrid rice Annual planting area accounts for more than the 59% of Oryza sativa L. year total cultivated area, makes rice yield increase substantially, and the grain security for ensureing China is made that significant contribution. Obtaining highly purified hybrid seed is the basis giving full play to hybrid vigor yield potential. Mechanical admixture and biology hybrid are the main sources of series of three-series hybrid rice parent's hybrid strain. Seed purity is to weigh the leading indicator of Seed Quality of Hybrid Rice, and the lower general who has surrendered of purity causes the obvious reduction of crop yield and quality. The hybrid rice seeds of low-purity, verity difference brings extreme loss to agricultural production, is seed quality testing department, breeding research unit, production of hybrid seeds unit and seeds company's questions of common interest.
Series of three-series hybrid rice sterile line " fine horse 1A " is independently cultivated for the applicant, rice varieties " fine horse excellent 172 " in the triple crossing that sterile line " fine horse 1A " and restorer " R0172 " combo are bred as, and rice varieties " fine horse excellent 522 " in the triple crossing precocity of sterile line " fine horse 1A " and the incubation of restorer " R522 " combo, all have passed through Hubei Province's variety certification, blast resisting, rice is of fine quality, is the new crop varieties being suitable for Enshi State of Hubei Province plantation.
State in realization in the process of research and development, inventors herein have recognized that prior art at least there is problems in that
Do not identify the special primer of series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, it is impossible to distinguished with its parent by above-mentioned rice varieties, it is impossible to it is carried out the work such as quick seed purity molecular markers for identification and relevant molecular mark.
Summary of the invention
The invention provides a kind of Specific primer pair for identifying series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, solve the problem in background technology, adopt this combination of primers fast and accurately series of three-series hybrid rice kind fine horse excellent 522 and parent thereof to be identified.
Realizing the technical scheme that above-mentioned purpose of the present invention adopts is:
A kind of Specific primer pair for identifying series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, including including JU01, JU02, JU03 and JU04, wherein JU01 forward primer such as SEQ ID NO.1:CACACACACACACACAGAGAACAG;
JU01 reverse primer such as SEQ ID NO.2:CACACACACAGAGAGGGAAAGA;
JU02 forward primer such as SEQ ID NO.3:GGATAATCCGCATCAAGAAGAT;
JU02 reverse primer such as SEQ ID NO.4:GGTCACCCGAGAATTGCATT;
JU03 forward primer such as SEQ ID NO.5:TGAGGCAACAATGCCTATTGCGGA;
JU03 reverse primer such as SEQ ID NO.6:TATGAGTTCACTATGTGGAGGCTC;
JU04 forward primer such as SEQ ID NO.7:AACAATGCCCAAACTTGAGAG;
JU04 reverse primer such as SEQ ID NO.8:CGGGTCCACATGTCAGTGAG.
The present invention additionally provides the method according to above-mentioned primer sets incompatible qualification series of three-series hybrid rice kind fine horse excellent 522 and parent thereof simultaneously, step is as follows: first extract target plant genome, then with genome for template, PCR detection is carried out with the Specific primer pair described in claim 1.
Described PCR reaction condition is: 95 DEG C of 5min; 95 DEG C of degeneration 30s, 65 DEG C of annealing 40s, wherein each circulation reduces by 0.7 DEG C, and 72 DEG C extend 1min30s, 15 circulations;
94 DEG C of degeneration 30s, 55 DEG C of annealing 45s, 72 DEG C extend 2min, 25 circulations; 10min is extended after 72 DEG C.
Described PCR reaction system is: DNA profiling 0.8 �� l, 10 �� PCR buffer 1 �� l, 2.5mMdNTPs0.8 �� l, 10 ��Ms of each 0.2 �� l of forward and reverse primer of 50ng/ �� l, archaeal dna polymerase 0.5U, ddH2O complements to 10 �� l.
Present invention also offers a kind of detection kit containing above-mentioned Specific primer pair.
Mentioned reagent box can be applied identifying the purity of series of three-series hybrid rice kind fine horse excellent 522 and parent thereof and assisting in its breeding.
The present invention, according to the ISSR primer amplification primers that can identify series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, passes through pcr amplification, it is possible to quickly identify series of three-series hybrid rice kind fine horse excellent 522 and parent thereof from other rice varieties. The authentication method of series of three-series hybrid rice kind fine horse excellent 522 provided by the invention and parent thereof, can be used for the Purity of above-mentioned rice varieties, and then applies in assisting its breeding.
Accompanying drawing explanation
Fig. 1 is by the PCR amplification figure A reacted in Oryza sativa L. in the present embodiment;
Fig. 2 is by the PCR amplification figure B reacted in Oryza sativa L. in the present embodiment.
Detailed description of the invention
Below in conjunction with accompanying drawing and specific embodiment, the present invention done detailed specific description, but protection scope of the present invention is not limited to following example.
The experimental technique of unreceipted actual conditions in following example, generally conventionally condition, " molecular cloning: laboratory manual " (NewYork:ColdSpringHarborLaboratoryPress of such as Sambrook etc., 2001) condition described in, or according to instrument or reagent manufacturer it is proposed that condition.Agents useful for same is commercial goods.
The Specific primer pair for identifying series of three-series hybrid rice kind fine horse excellent 522 and parent thereof that the present embodiment provides, including JU01, JU02, JU03 and JU04, wherein JU01 forward primer such as SEQ ID NO.1:CACACACACACACACAGAGAACAG;
JU01 reverse primer such as SEQ ID NO.2:CACACACACAGAGAGGGAAAGA;
JU02 forward primer such as SEQ ID NO.3:GGATAATCCGCATCAAGAAGAT;
JU02 reverse primer such as SEQ ID NO.4:GGTCACCCGAGAATTGCATT;
JU03 forward primer such as SEQ ID NO.5:TGAGGCAACAATGCCTATTGCGGA;
JU03 reverse primer such as SEQ ID NO.6:TATGAGTTCACTATGTGGAGGCTC;
JU04 forward primer such as SEQ ID NO.7:AACAATGCCCAAACTTGAGAG;
JU04 reverse primer such as SEQ ID NO.8:CGGGTCCACATGTCAGTGAG. The method adopting above-mentioned primer sets incompatible qualification series of three-series hybrid rice kind fine horse excellent 522 and parent thereof in the present embodiment, step is as follows:
1. experiment material
1.1 vegetable materials
Middle fine horse excellent 1 and parent sterile line 418A thereof, keep being 418B and restorer R964, nine A and keep nine B in system in the similar origin sterile line of middle fine horse excellent 1; Fine horse excellent 522 and parent sterile line fine horse 1A thereof, keep being fine horse 1B and restorer R522, fine horse excellent 522 similar origin sterile line Fuyi No.A and maintenance be her B of good fortune.
1.2 enzymes and reagent
Molecular biology reagents, TAKARArTaqDNA polymerase, 10 �� PCR buffer, dNTPMixture (2.5mM) is purchased from Dalian treasured biotech firm.
Other biochemical reagents are import subpackage or domestic analytical pure. Primer is synthesized by Nanjing Genscript Biotechnology Co., Ltd..
1.3 experimental apparatus
The broken instrument (Geno/grinder, USA) of vibration;
PCR amplification instrument: PTC-100TM (MJ, USA);
Nucleic acid electrophoresis apparatus: DYYIII type YY0115-94 (Liuyi Instruments Plant, Beijing);
DNA electrophoretic analysis system: GeneSnap Labworks image acquisition and analysis software;
Other Instruments includes: thermostat water bath, electronic balance, centrifuge, vortex instrument, pure water instrument, constant incubator etc.
2. experimental technique
The extraction of 2.1 oryza sativa genomic dnas
Single-seed rice is planted, take young leaflet tablet as DNA extraction material, extract the STb gene of rice material according to " molecular cloning " book published with reference to CSH Press (ColdSpringHarborLaboratoryPress), NinaIrwin and KaarenA.Janssen writes.
2.2PCR expands
Special primer according to the ISSR primer amplification sequential design that can identify series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, utilizes this 4 pairs of combination of primers, carries out pcr amplification with oryza sativa genomic dna for template.
PCR amplification system is: 10 �� PCR buffer 1 �� l, 2.5mMdNTPs0.6 �� l, 10 ��Ms of each 0.2 �� l of forward and reverse primer, and archaeal dna polymerase 0.5U, 50ng/ �� lDNA template 0.5 �� l, ddH2O complement to 10 �� l.
Pcr amplification program: 95 DEG C of 5min; 95 DEG C of degeneration 30s, 65 DEG C of annealing 40s, (wherein each circulation reduces by 0.7 DEG C) 72 DEG C of extension 1min30s, 15 circulations; 94 DEG C of degeneration 30s, 55 DEG C of annealing 45s, 72 DEG C extend 2min, 25 circulations; 10min is extended after 72 DEG C.
3. experimental result
Amplification is all with sterilized water for negative control, only when negative control expands without any banding pattern, then PCR reliable results is described.The amplified band of the detected material of statistics, feminine gender is calculated as 0, and the positive is calculated as 1. Shown in statistical result and cluster analysis result such as following table and Fig. 1 and Fig. 2. It is shown that series of three-series hybrid rice kind fine horse excellent 522 and parent thereof can be distinguished by the 4 of the present invention pairs of molecular marker combinations.
4 pairs of molecular marker combination of primers expand the finger printing statistics of 2 series of three-series hybrid rice combinations
| Amplified band | In nine A | In nine B | 418A | 418B | R964 | Middle fine horse excellent 1 | Fuyi No.A | Her B of good fortune | Fine horse 1A | Fine horse 1B | R522 | Fine horse excellent 522 |
| 1 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| 2 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
| 3 | 1 | 0 | 1 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 1 |
| 4 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 5 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 3 --> |
| 6 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 0 | 1 |
| 7 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 |
Claims (6)
1. the Specific primer pair being used for identifying series of three-series hybrid rice kind fine horse excellent 522 and parent thereof, it is characterized in that: include JU01, JU02, JU03 and JU04, wherein JU01 forward primer such as SEQ ID NO.1:CACACACACACACACAGAGAACAG;
JU01 reverse primer such as SEQ ID NO.2:CACACACACAGAGAGGGAAAGA;
JU02 forward primer such as SEQ ID NO.3:GGATAATCCGCATCAAGAAGAT;
JU02 reverse primer such as SEQ ID NO.4:GGTCACCCGAGAATTGCATT;
JU03 forward primer such as SEQ ID NO.5:TGAGGCAACAATGCCTATTGCGGA;
JU03 reverse primer such as SEQ ID NO.6:TATGAGTTCACTATGTGGAGGCTC;
JU04 forward primer such as SEQ ID NO.7:AACAATGCCCAAACTTGAGAG;
JU04 reverse primer such as SEQ ID NO.8:CGGGTCCACATGTCAGTGAG.
2. the method identifying series of three-series hybrid rice kind fine horse excellent 522 and parent thereof based on the combination of primers described in claim 1, it is characterized in that step is as follows: first extract target plant genome, then with genome for template, PCR detection is carried out with the Specific primer pair described in claim 1.
3. the method for qualification series of three-series hybrid rice kind fine horse excellent 522 according to claim 2 and parent thereof, it is characterised in that: described PCR reaction condition is: 95 DEG C of 5min; 95 DEG C of degeneration 30s, 65 DEG C of annealing 40s, wherein each circulation reduces by 0.7 DEG C, and 72 DEG C extend 1min30s, 15 circulations;
94 DEG C of degeneration 30s, 55 DEG C of annealing 45s, 72 DEG C extend 2min, 25 circulations; 10min is extended after 72 DEG C.
4. the method identifying series of three-series hybrid rice kind fine horse excellent 522 and parent thereof according to Claims 2 or 3, it is characterized in that: described PCR reaction system is: the DNA profiling 0.8 �� l of 50ng/ �� l, 10 �� PCR buffer 1 �� l, 2.5mMdNTPs0.8 �� l, 10 ��Ms of each 0.2 �� l of forward and reverse primer, archaeal dna polymerase 0.5U, ddH2O complements to 10 �� l.
5. the detection kit containing Specific primer pair described in claim 1.
6. test kit described in claim 5 is being identified the purity of series of three-series hybrid rice kind fine horse excellent 522 and parent thereof and is being assisted the application in its breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410693416.6A CN104357576B (en) | 2014-11-26 | 2014-11-26 | A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410693416.6A CN104357576B (en) | 2014-11-26 | 2014-11-26 | A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104357576A CN104357576A (en) | 2015-02-18 |
| CN104357576B true CN104357576B (en) | 2016-06-08 |
Family
ID=52524882
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410693416.6A Expired - Fee Related CN104357576B (en) | 2014-11-26 | 2014-11-26 | A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104357576B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086205A (en) * | 2016-07-20 | 2016-11-09 | 湖南省农业生物技术研究中心 | Utilize the method that parents' hybrid dna identifies rice varieties sibship |
-
2014
- 2014-11-26 CN CN201410693416.6A patent/CN104357576B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104357576A (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lu et al. | Cultivar identification and genetic diversity analysis of broccoli and its related species with RAPD and ISSR markers | |
| CN103361425B (en) | Primer and method for identifying purity of cucumber 'Yuexiu No.3' hybrid seed | |
| CN103194539B (en) | Method for identifying ramie variety by simple sequence repeat (SSR) molecular marker | |
| CN106367491A (en) | Kit for detecting deafness susceptibility genes | |
| CN102321767A (en) | Simple sequence repeat-polymerase chain reaction (SSR-PCR)-based hybrid rape seed purity detection method | |
| CN104004828B (en) | A kind of molecule marker and application thereof identifying onion cytoplasmic type | |
| CN105063035A (en) | Molecular markers of xanthomonas oryzae pv oryzae and applications thereof | |
| CN104805212B (en) | PCR label for screening fertility restorer gene Rfo of Ogura cytoplasmic sterile line of Brassica oleracea var.capitata L. | |
| CN103276054B (en) | Primer for auxiliary detection of soybean hundred-grain weight, and detection method thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN104357576B (en) | A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof | |
| CN117106967A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN101880725B (en) | Polymerase chain reaction (PCR) detection method for trans-cry2A-genic rice line T2A-1 and application thereof | |
| Arya et al. | Diagnostic set of microsatellite markers for hybrid purity testing and molecular identification of hybrids and parental lines in sorghum | |
| CN101974618B (en) | Transformant specific polymerase chain reaction (PCR) detection method for transgenic rice strain T1c-19 with cry1C gene | |
| CN105695454A (en) | Molecular marker for identifying sesame male sterile line of sesame and identifying method thereof | |
| CN104404156A (en) | Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method | |
| CN104404147B (en) | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice | |
| CN104293887A (en) | Identification method and identification kit for genetic relationships among different species among sections of populus | |
| CN109402231A (en) | A kind of method of Rapid identification hybrid rice seeds purity | |
| CN102618534A (en) | Functional specific molecular marker PikFNP for resistance genes Pik of rice blast and method and application of functional specific molecular marker PikFNP | |
| Chen et al. | Development and verification of SSR markers from drought stress-responsive miRNAs in common wild rice | |
| CN103088109A (en) | Method for auxiliary identification of corn haploid induction line, and special primer pair thereof | |
| CN101709330B (en) | Rice molecular identification method for sterile line mixed with fertile plant comprsing recovery gene | |
| CĂPRAR et al. | Evaluation of genetic diversity by DNA barcoding of local tomato populations from North-Western Romania |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160608 Termination date: 20191126 |