CN104404156A - Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method - Google Patents
Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method Download PDFInfo
- Publication number
- CN104404156A CN104404156A CN201410742192.3A CN201410742192A CN104404156A CN 104404156 A CN104404156 A CN 104404156A CN 201410742192 A CN201410742192 A CN 201410742192A CN 104404156 A CN104404156 A CN 104404156A
- Authority
- CN
- China
- Prior art keywords
- loquat
- self
- primer
- compatible
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of molecular markers and provides a rapid identification method of a self-compatible Si molecular marker, a self-compatible marker primer and a self-compatible variety of loquat. The Si molecular marker is shown in a sequence SEQ ID NO. 1, and the size is 830bp; an AS-PCR (allele-specific polymerase chain reaction) sequence of the marker primer is that a forward primer is shown in SEQ ID NO. 2, and a reverse primer is shown in SEQ ID NO. 3. According to the identification method, by using Si as the molecular marker, DNAs of different loquat varieties are amplified by using the AS-PCR of the marker primer; the DNAs are screened and the DNAS where 830bp fragment can be amplified have the Si molecular marker, which shows that the loquat variety is the self-compatible variety. The method can quickly identify the self-compatible variety of loquat without arranging a pollinate tree or manual pollination, so that the cost can be greatly lowered; the method is hardly affected by external factors, is great in precision, breaks the limitation of conventional method, and has great significance on the yield and quality of loquat.
Description
Technical field
The invention belongs to field of molecular marker, relate to a kind of Loquat Cultivars (being) self-compatible S-RNase genotype S
imolecule marker, self-compatible labeled primer and loquat self-compatible kind rapid identification method.
Background technology
Loquat (Eriobotrya Lind1.) belongs to gametophytic incompatibility (Gametophyticself-incompatibility, GSI), heredity belong to by single site (S-locus, S site) multiple allelomorphos (S-alleleor S-gene, S gene) regulation and control, when the S-allele of pollen is identical with one of S-allele in style, the growth of pollen tube in style will be suppressed, thus fertilization cannot be completed smoothly and show Self-Incompatibility phenomenon, have a strong impact on fruit yield.Therefore must plant the florescence artificial supplementary pollination of rational pollinated variety or the science of carrying out in cultivation, stable yield and quality can be obtained.Although this method is intuitively effective, not only waste time and energy, and blindness is larger, thus impact improves the quality of loquat.
If the loquat of self-compatible kind can be found, and can effectively and rapidly identify out, just do not need configuration pollinizers or carry out artificial pollination, artificial and production cost can be saved widely, have very large meaning to the yield and quality improving loquat.
The qualification of loquat self-compatible kind is a long-term application foundation Journal of Sex Research job, along with continuous incubation and the popularization of new variety, need to explore and a kind ofly Rapid identification can go out the method for loquat self-compatible kind, this can not only provide useful examination material for research loquat self incompatibility mechanism, and can provide practical help for producing.But from existing authentication method, the bagging selfing percentage of fertile fruit height mainly by field kind is determined, although intuitively effective, workload is large, and the cycle is long.
In biology field, as far back as nineteen fifty-two, Lewis has found the protein relevant to specific S-allele in root of Redsepal Eveningprimrose, after this, have people to find rich content from the plants such as Solanaceae and with the stylar glycoproteins of S site genetic linkage.Over nearly 20 years, develop rapidly along with molecular biological, now from multiple gametophytic plant, be separated more or less a hundred S nuclease.According to the result that DNA and aminoacid sequence compare, find they and fungi RNaseRh and RNaseTZ homology, and containing identical reactive site, there is nuclease, so be often called S-nuclease (S-RNase).About S-RNase is generally 250 amino acid.Relatively the protein sequence of S-RNase finds have several conserved regions and two hypervariable regions between them, Hva and Hvb majority in hypervariable region is the hydrophilic region of S mono-albumen, may be relevant with the identification of S-RNase.Conserved regions may be relevant with structure with the activity of S-RNase.As a class secretor type glycoprotein, S-RNase is specifically expressing in gynoecium, is mainly distributed in the intercellular substance of style transmission tissue, the highest in the concentration at style more than 1/3 position, and this position just Self-Incompatibility pollen growth is suppressed the region arranged the most by force.The expression of low-level S-RNase is detected in the placenta epidermic cell surrounding ovule.As can be seen here, enter the expression all having S-RNase in the tissue that ovule must pass through at pollen tube, its distributing position is consistent with the approach of pollen tube growth.Only have the threshold values that the concentration of S-RNase reaches certain, Self-Incompatibility could occur, the expression amount of S-albumen and Floral development process significant correlation.In general, S-RNase and s-site is divided into from itself not proving that it must be S gene product, because may be the expression product with S gene close linkage gene.But existing evidence proves that S-RNase is exactly the product of S site in style at present.S-protein sequence shows the otherness of height, and the polymorphism of these sequences is that molecular recognition provides possibility.
But, different for the S genotype understanding being tested and appraised kind at present, and test set, technical qualification require high, the self-compatible cultivar identification of Loquat Cultivars is in progress always very slow, therefore, the self-compatible cultivar identification of loquat is extremely weakness and a research field anxious to be strengthened.
Summary of the invention
The problems such as the qualification time for the self-compatible kind of loquat in prior art is long, technology is weak, the present invention, by providing a kind of Loquat Cultivars (being) self-compatible S-RNase genotype Si molecule marker, labeled primer and loquat self-compatible kind rapid identification method, is applicable to the qualification of loquat self-compatibility (S genotype) kind (being), instructs the selection of breeding parent.
Object of the present invention is obtained by following technique means:
1, the invention provides a kind of loquat self-compatible kind Rapid identification molecule marker, this molecule marker is loquat S-RNase genotype S
i, sequence is as shown in SEQ ID NO.1, and size is 830bp.
2, the present invention also provides a kind of loquat self-compatible kind Rapid identification molecule marker primer, and this labeled primer AS-PCR sequence is as follows: forward primer sequence is as SEQ ID NO.2; Reverse primer sequences is as shown in SEQ IDNO.3.
3, the present invention also provides a kind of loquat self-compatible kind rapid identification method, and this authentication method is with loquat S-RNase genotype S
ias molecule marker, its sequence is as shown in SEQ ID NO.1; With S
imolecule marker primer: forward primer sequence is as SEQ ID NO.2; Reverse primer sequences, as shown in SEQ ID NO.3, screens, and AS-PCR increases different Loquat Cultivars DNA, can amplify the amplified fragments of 830bp, indicate loquat S-RNase genotype S
iexistence, illustrate that this Loquat Cultivars is self-compatible kind.
4, the loquat self-compatible kind rapid identification method provided according to above-mentioned 3, wherein, the dNTPs2.0 ± 0.2 μ L containing 10 × PCR buffer 2.5 ± 0.25 μ L, 2.5mmolL-1 in 25 μ L AS-PCR amplification reaction systems, the MgCl of 2.5mmolL-1
2aS-PCR upstream and downstream primer 1 ± 0.1 μ L of 2.0 ± 0.2 μ L, 1U Tap archaeal dna polymerase 1 ± 0.1 μ L, 5pmol μ L-1.
5, the Loquat Cultivars self-compatible S provided according to above-mentioned 3
igenotype AS-PCR molecular marker identification method, wherein, amplification thermal circulation parameters is: 94 DEG C of denaturation 2min, then 94 DEG C of sex change 15s, 55 DEG C of annealing 30s, and 70 DEG C extend 2min, totally 30 circulations, and last 70 DEG C extend 7min.
6, the Loquat Cultivars self-compatible S provided according to above-mentioned 3
igenotypic AS-PCR molecular marker identification method, wherein, labeled primer amplified production detects through the agarose gel electrophoresis of 2%.
Beneficial effect:
The present invention obtains Loquat Cultivars (being) self-compatible S by experimental study
imolecule marker, based on this molecule marker, design molecule marker primer, Rapid identification loquat self-compatible kind, does not need configuration pollinizers or carries out artificial pollination, can save artificial and production cost widely; Meanwhile, be not subject to the factor impact such as external environment and breeding time, qualification tolerance range is large, and error is little, has broken the limitation of traditional method, has very large meaning to the yield and quality improving loquat.For the loquat that inbred varieties is little, if Rapid identification can go out loquat self-compatible, not only can reduce blindness during seed selection, obtain high yield and fine quality, can also enrich the germ plasm resource of loquat, be effective molecular assay method.
Accompanying drawing explanation
The sprouting state fluorogram of kind that Fig. 1 is affine and not affine kind pollination self pollen tube after 72 hours
A. Shanghai kind (affine) pollination self 72h; B. white jade (not affine) pollination self 72h
Fig. 2 utilizes the S of AS-PCR primer pair loquat
igenotype carries out the electrophorogram detected
M is DNA Marker; Swimming lane 1 ~ 13 is followed successively by Loquat Cultivars: 1 red lantern (S
6s
i), 2 Millennium jade weared by baron (S
6s
i), 3 liberation clock (S
11s
31), 4 evergreen 12 (S
2s
31), 5 Dongshan egg albumen (S
2s
31), 6 string brain (S
7s
11), 7 white jade (S
2s
31), 8 despot red (S
31s
31), 9 Western Hills egg albumen (S
31s
11), 10 rock sugar kind (S
7s
11), the beautiful (S of 11 hat
2s
8), 12 Feng Yu (S
2s
2), 13 Shanghai kind (S
7s
i)
Embodiment
Below in conjunction with embodiment, the present invention will be further described, and the experimental technique of unreceipted actual conditions in the following example, usually according to the known approaches of this area.
Embodiment 1
1. cultivar identification
Choose that red lantern, Millennium jade weared by baron, liberation clock, evergreen 12, Dongshan egg albumen, string brain, white jade, despot are red, Western Hills egg albumen, rock sugar kind, hat jade, Feng Yu, Shanghai kind 13 Loquat Cultivars (evergreen fruit trees technology popularization center, Taihu Lake, Jiangsu Province provides, with open to the society of raising variety).
With fluorescence microscopy observe 13 kind pollination selfs after 72 hours the hair-like condition of pollen tube add up percentage of fertile fruit, judge that whether kind is for inbred varieties with this, as table 1, can find out that red lantern, Millennium jade weared by baron, Shanghai kind are self-compatible kind by pollination self percentage of fertile fruit, liberation clock, evergreen 12, Dongshan egg albumen, string brain, white jade, despot are red, Western Hills egg albumen, rock sugar kind, hat are beautiful, Feng Yu is Self-Incompatibility kind.
Table 1 pollination self percentage of fertile fruit is added up
2. molecule marker obtains
1) DNA extraction
Get red lantern, Millennium jade weared by baron, liberation clock, evergreen 12, Dongshan egg albumen, string brain, No. mono-, Jin Feng, seize by force red, Western Hills egg albumen, Ninghai is white, hat jade, Feng Yu, Shanghai kind 13 kind tender leaf positions, adopt CTAB method, extract the genomic dna of above-mentioned 13 kinds respectively.
2) S-RNase genotype identification
Step 1) genomic dna of 13 Loquat Cultivars that extracts is diluted to 100ng μ L-1 respectively, and based on the conserved regions of loquat S-RNase gene, design universal primer carries out pcr amplification to the genomic dna of 13 Loquat Cultivars.
Wherein, universal primer comprises 4 pairs of primer pairs, is respectively
Primer pair 1: forward primer EjC1F ATTATCAATTTACGCAGCAATATCAG; Reverse primer EjC5R CAAATACCA ACCTCAACCAATTCAG
Primer pair 2: forward primer EjC1F ATTATCAATTTACGCAGCAATATCAG; Reverse primer EjC2/3R GGACGTTCGGCCAAATAATTACC
Primer pair 3: forward primer FTQQYQ TTTACGCAGCAATATCAG; Reverse primer IIWPNV ACRTTCGGCCAAATMATT
Primer pair 4: forward primer FTQQYQ TTTACGCAGCAATATCAG reverse primer FIDNCP (H/R) GYGGGGGCARTYTATGAA
Containing 10 × PCR buffer 2.5 μ L, 2.5mmolL-1 dNTPs2.0 μ L, MgCl in amplification reaction system (25 μ L)
2(2.5mmolL-1) 2.0 μ L, 1U Tap archaeal dna polymerase 1 μ L, AS-PCR upstream and downstream primer (5pmol μ L-1) 1 μ L; PCR parameter is: 94 DEG C of denaturation 2min, then 94 DEG C of sex change 15s, 55 DEG C of annealing 30s, and 70 DEG C extend 2min, totally 30 circulations, and last 70 DEG C extend 7min; AS-PCR amplified reaction carries out on TaKaRa PCR Thermal Cycler Dice (TP600) of Takara company.
Send after pcr amplification product is reclaimed and check order in order-checking company, with BioXM software, sequencing result is analyzed, order-checking obtains fragment and NCBI gene pool and compares, and obtains corresponding genotype, have genotype with NCBI on logged in gene same numbers and represented.After testing, 13 variety and genetypes are respectively: 1 red lantern S
6s
i; 2 Millennium jade weared by baron S
6s
i; 3 liberation clock S
11s
31; 4 evergreen 12S
2s
31; 5 Dongshan egg albumen S
2s
31; 6 string brain S
7s
11; 7 white jade S
2s
31; The red S of 8 despot
31s
31; 9 Western Hills egg albumen S
31s
11; 10 rock sugar kind S
7s
11; The beautiful S of 11 hat
2s
8; 12 Feng Yu S
2s
2; 13 Shanghai kind S
7s
i.
3) molecule marker obtains
Through step 2) after S-RNase genotype identification, determine that in genotype, Si is this experiment new discovery genotype, its sequence is as shown in SEQ ID NO.1, and size is the amplified fragments of 830bp.13 of above-mentioned acquisition genotypic types of kind SRNase to be pollinated with the field of corresponding kind and fluorescence microscopy observations is compared, we find Si gene and self-compatible closely related: 1 red lantern, 2 Millennium jade weared by barons, 13 Shanghai kinds are self-compatible kind.Design S
igene specific labeled primer AS-PCR: forward primer sequence is as shown in SEQ ID NO.2; Reverse primer sequences is as shown in SEQ ID NO.3.With step 2) amplification reaction system (25 μ L) is in the amplification of TaKaRa PCR Thermal Cycler Dice (TP600) of Takara company enterprising performing PCR, obtain pcr amplification product, on the small-sized digital display electrophoresis apparatus of JM-250A type that pcr amplification product is produced in Jing Mai bio tech ltd, Dalian, agarose gel electrophoresis through 2% is at HM-I type Multifunction horizontal electrophoresis chamber, electrophoresis 30min under 120V voltage, result as shown in Figure 2.The amplified fragments of the 830bp of Si gene all detected through agarose gel electrophoresis, and other Self-Incompatibility kinds all do not detect, can S be determined thus
igene is loquat self-compatible molecule marker.As carried out pcr amplification, this detected object is self-compatible kind to have the bands of a spectrum of 830bp size fragment then to illustrate, does not then illustrate that this detected object is Self-Incompatibility kind.
Claims (6)
1. a loquat self-compatible kind Rapid identification molecule marker, is characterized in that: this molecule marker is loquat S-RNase genotype S
i, sequence is as shown in SEQ ID NO.1, and size is 830bp.
2. a loquat self-compatible kind Rapid identification molecule marker primer, is characterized in that: this labeled primer AS-PCR sequence is as follows: forward primer sequence is as SEQ ID NO.2; Reverse primer sequences is as shown in SEQ IDNO.3.
3. a loquat self-compatible kind rapid identification method, is characterized in that: this authentication method is with loquat S-RNase genotype S
ias molecule marker, its sequence is as shown in SEQ ID NO.1; With S
imolecule marker primer: forward primer sequence is as SEQ ID NO.2; Reverse primer sequences, as shown in SEQ ID NO.3, screens, and AS-PCR increases different Loquat Cultivars DNA, can amplify the amplified fragments of 830bp, indicate loquat S-RNase genotype S
iexistence, illustrate that this Loquat Cultivars is self-compatible kind.
4. loquat self-compatible kind rapid identification method according to claim 3, it is characterized in that: containing 10 × PCR buffer 2.5 ± 0.25 μ L in 25 μ LAS-PCR amplification reaction systems, dNTPs2.0 ± 0.2 μ the L of 2.5mmolL-1, the MgCl of 2.5mmolL-1
2aS-PCR upstream and downstream primer 1 ± 0.1 μ L of 2.0 ± 0.2 μ L, 1U Tap archaeal dna polymerase 1 ± 0.1 μ L, 5pmol μ L-1.
5. loquat self-compatible kind rapid identification method according to claim 3, is characterized in that: amplification thermal circulation parameters is: 94 DEG C of denaturation 2min, then 94 DEG C of sex change 15s, 55 DEG C of annealing 30s, and 70 DEG C extend 2min, totally 30 circulations, and last 70 DEG C extend 7min.
6. loquat self-compatible kind rapid identification method according to claim 3, is characterized in that: labeled primer amplified production detects through the agarose gel electrophoresis of 2%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410742192.3A CN104404156B (en) | 2014-12-08 | 2014-12-08 | Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410742192.3A CN104404156B (en) | 2014-12-08 | 2014-12-08 | Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404156A true CN104404156A (en) | 2015-03-11 |
| CN104404156B CN104404156B (en) | 2017-05-17 |
Family
ID=52641819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410742192.3A Expired - Fee Related CN104404156B (en) | 2014-12-08 | 2014-12-08 | Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404156B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266720A (en) * | 2018-10-15 | 2019-01-25 | 华中农业大学 | The method that in vitro verifying citrus shaddock class S-RNase is selfed not affine function |
| CN110607390A (en) * | 2019-11-01 | 2019-12-24 | 华南农业大学 | Molecular marker for identifying homozygous or heterozygous type of loquat yellow meat trait gene and application thereof |
| CN110710452A (en) * | 2019-11-05 | 2020-01-21 | 南京农业大学 | Tissue culture and rapid propagation method of eriobotrya japonica |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382484A (en) * | 2013-08-01 | 2013-11-06 | 南京农业大学 | Antisense expression method for self-compatibility novel germplasm of S-RNase creation pear by utilizing pollen mediators |
-
2014
- 2014-12-08 CN CN201410742192.3A patent/CN104404156B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382484A (en) * | 2013-08-01 | 2013-11-06 | 南京农业大学 | Antisense expression method for self-compatibility novel germplasm of S-RNase creation pear by utilizing pollen mediators |
Non-Patent Citations (2)
| Title |
|---|
| REUT NISKA等: "S6-RNase Is a Marker for Self-compatibility in Loquat (Eriobotrya japonica Lindl.)", 《HORTSCIENCE》, vol. 45, no. 8, 31 August 2010 (2010-08-31), pages 1146 - 1149 * |
| 杨芩: "枇杷授粉受精生物学研究与S基因克隆", 《中国博士学位论文全文数据库农业科技辑》, no. 3, 15 March 2014 (2014-03-15), pages 048 - 9 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266720A (en) * | 2018-10-15 | 2019-01-25 | 华中农业大学 | The method that in vitro verifying citrus shaddock class S-RNase is selfed not affine function |
| CN110607390A (en) * | 2019-11-01 | 2019-12-24 | 华南农业大学 | Molecular marker for identifying homozygous or heterozygous type of loquat yellow meat trait gene and application thereof |
| CN110710452A (en) * | 2019-11-05 | 2020-01-21 | 南京农业大学 | Tissue culture and rapid propagation method of eriobotrya japonica |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404156B (en) | 2017-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104131012B (en) | Molecular marker for identifying soybean nucleus male sterility line and identification method thereof | |
| CN104004828B (en) | A kind of molecule marker and application thereof identifying onion cytoplasmic type | |
| CN102584967B (en) | Anti-soybean mosaic virus (SMV) protein in soybean and coding gene Rsv3C and application thereof | |
| CN104404156A (en) | Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method | |
| Kim et al. | Simple sequence repeat marker development from Codonopsis lanceolata and genetic relation analysis | |
| CN112695125B (en) | Katelia SSR molecular marker primer composition and application thereof | |
| Shan et al. | Sex‐linked microsatellite marker detected in the female gametophytes of Undaria pinnatifida (Phaeophyta) | |
| CN117511957A (en) | New gene Piyn for encoding NBS-LRR of rice and application of new gene Piyn in rice blast resistance breeding | |
| CN110396556B (en) | ISSR-SCAR marker for identifying Oenanthe Javanica and identification method thereof | |
| CN106893769B (en) | Recombinant nucleic acid fragment RecCR012602 and detection method thereof | |
| CN103361340B (en) | Bay scallop thermostable related heat shock protein 70 gene marker and assistant breeding method thereof | |
| CN104531886B (en) | D1 type rice cytoplasmic male sterile line and identification method of hybrid combination thereof | |
| CN107881255B (en) | Double-significance marker for accurately identifying onion S/N cytoplasm genotype and application thereof | |
| CN102690814A (en) | Molecular marker SIsv0491 closely linked with Setaria italica L. Beauv. seta color gene | |
| CN107287278B (en) | Recombinant nucleic acid fragment RecCR010169 and detection method thereof | |
| CN107287280B (en) | Recombinant nucleic acid fragment RecCR010165 and detection method thereof | |
| CN106893727B (en) | Recombinant nucleic acid fragment RecCR012600 and detection method thereof | |
| CN105567856B (en) | A kind of genotype detection method of the fad2 genes of cabbage type rape | |
| CN106480058B (en) | Recombinant nucleic acid fragment RecCR010380 and detection method thereof | |
| CN104357576B (en) | A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof | |
| CN111719009B (en) | Primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts | |
| CN108411026A (en) | A kind of method of chrysanthemum support sweet osmanthus type molecular marker assisted selection | |
| CN108165654A (en) | SSR marker SP_SSR04 and its application with spinach male close linkage | |
| CN111004858B (en) | Molecular marker primer of soybean single pod number major QTL (quantitative trait locus) locus and application thereof | |
| CN102154283B (en) | Molecular marker SIsv0046 tightly linked with bristle color gene of setaria italica L.Beauv. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170517 Termination date: 20171208 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |