CN111719009B - Primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts - Google Patents
Primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts Download PDFInfo
- Publication number
- CN111719009B CN111719009B CN201910222663.0A CN201910222663A CN111719009B CN 111719009 B CN111719009 B CN 111719009B CN 201910222663 A CN201910222663 A CN 201910222663A CN 111719009 B CN111719009 B CN 111719009B
- Authority
- CN
- China
- Prior art keywords
- apomixis
- primer
- filial generation
- amplification
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer group, a kit and a method for authenticating apomixis filial generation authenticity of a juglans sigillata, belonging to the technical field of crop apomixis filial generation authentication, wherein the primer group comprises one or more of the following primer pairs: YAFW01-F and YAFW01-R; YAFW02-F and YAFW02-R; YAFW03-F and YAFW03-R; YAFW04-F and YAFW04-R; YAFW05-F and YAFW05-R; YAFW06-F and YAFW06-R; the nucleotide sequence of the primer pair is shown as SEQ ID NO:1 to 12. The primer pair in the primer group is an SSR primer which has polymorphism and is highly stable; the method can specifically amplify the allelic loci of the female parent and the filial generation, and judges whether the filial generation is apomictic generation through comparison of the amplification products, and has the advantages of simple operation, short time consumption and high accuracy.
Description
Technical Field
The invention belongs to the technical field of crop apomixis progeny identification, and particularly relates to a primer group, a kit and a method for identifying authenticity of apomixis progeny of a kiskatom.
Background
Apomixis refers to the mode of reproduction in which a plant produces new individuals (seeds) without gamete (sperm cell) fusion. In 1841, the female plant of this heterogynic plant was found to seed without pollen donor in the Euphorbiaceae family of Hibiscus sabdariffa L. In 1921, naturally occurring haploids were found in Datura. Apomixis occurs mostly in plants of Compositae, rosaceae and Gramineae, and according to incomplete statistics, over 400 plants of 52 families have apomixis phenomenon, wherein about 100 plants can naturally generate haploid plants, but the occurrence frequency is extremely low.
Apomixis has the characteristics of fixing heterosis, increasing the probability of selecting excellent gene types, simply, conveniently and quickly obtaining pure lines, shortening the breeding period and the like, is highly valued by crop breeders, and is researched on crops such as rice, sorghum, corn, wheat, cotton, rape and the like in China. Different plants have great difference in the mechanism of apomixis, and the technology for inducing apomixis by artificial intervention also has difference. The induction of apomixis of walnuts is usually carried out by different methods such as an isolation bagging method, a pollen Mongolian induction method, a medicament induction method, an in vitro induction method, a radiation induction method and the like; the identification method comprises an embryology observation method, an isozyme analysis method, a molecular marking method and the like. Grouh et al (Mohammad S.H.J., kouroshV., mahmoun L., darab H., nejat P.B.Production of Haploids in personal wave root of Parthenogensis Induced by Gamma-irradial Polen [ J ]. Journal of Pollen after irradiation of the American Society for household Science,2011,136 (3): 198-204.) Pollen after irradiation of Gamma rays pollinates walnuts, embryo rescue of non-fusiogenic progeny seeds yields plantlets, whose SSR sites after analysis with 4 SSR markers only retain the allele of one of the parents, which was also confirmed by flow cytometry. 3238 and 3262 Zxft 3238 (3262 Zxft 3262. Induction and identification of walnut apomixis [ D ]. Kunming: university of southwest forestry, 2009.) use different medicaments to induce walnut apomixis, and use SSR markers to identify apomixis offspring, so that locus variation is found to occur in apomixis walnut offspring, separation of allele occurs in apomixis offspring compared with parent, and a small amount of new belts and no amplification phenomenon occur, and the phenomenon is presumed to be caused by pollen floating in the experimental bagging process and possibly caused by different genotypes. The origins of apomixis filial generations in walnuts obtained by different researchers are different, which indicates that the apomixis of the walnuts has complexity.
Apomixis can produce haploid offspring and diploid plants. A haploid if a plant or young embryo formed by the development of a haploid egg cell directly through mitosis is a haploid; if a haploid egg cell initially divides, the young embryo or plant that is naturally developed by doubling its chromosome is diploid. The diploid plant of apomixis has homozygous genes, regular and consistent offspring phenotype and stable heredity. Whether the apomictic walnut genotype is haploid or diploid depends on the nature of apomixis. But are "homozygous" whether haploid or diploid.
DNA fingerprinting enables identification of differences or genetic similarities between varieties at the DNA level. Microsatellites (also known as simple repeats, SSRs) are DNA fragments consisting of short sequences of 1 to 6 nucleotides repeated in tandem. Since the number of repetitions of the repeating unit in the microsatellite is different, the length of the amplified microsatellite sequence shows polymorphism. The microsatellite sequence has the characteristics of higher polymorphism, good repeatability and stability and the like, is a very effective molecular marker, and is widely applied to the fields of variety identification, fingerprint map construction and the like.
The method for checking the fruit setting rate in an isolated mode by using the bagging is used for researching the apomixis rate, the apomixis rate is high possibly due to untimely bagging, the operation steps of identifying the apomixis filial generation by adopting an embryology observation method and an isozyme analysis method are more, the consumed time is longer, and rich experience is required.
Disclosure of Invention
In view of the above, the invention aims to provide a primer set, a kit and a method for identifying the authenticity of apomixis progeny of a juglans sigillata, which are simple and rapid to operate and have high accuracy.
In order to achieve the above purpose, the invention provides the following technical scheme:
the primer group for authenticating the authenticity of apomixis filial generation of the apomixis walnut comprises one pair of the following primer pairs: YAFW01-F and YAFW01-R; YAFW02-F and YAFW02-R; YAFW03-F and YAFW03-R; YAFW04-F and YAFW04-R; YAFW05-F and YAFW05-R; YAFW06-F and YAFW06-R; the nucleotide sequences of the primer pairs are as follows:
the invention provides a kit for authenticating the authenticity of apomixis filial generation of a juglans sigillata, which comprises the primer group.
Preferably, the kit further comprises 2 x PCR Mix and water.
Preferably, the kit further comprises a positive control substance and a negative control substance.
The invention provides a method for authenticating the authenticity of apomixis filial generation of a juglans sigillata, which comprises the following steps:
1) Respectively extracting the genome DNA of the leaf of the progeny sample and the genome DNA of the leaf of the parent tree sample;
2) Respectively taking the genomic DNA of the progeny sample leaves and the maternal tree sample leaves in the step 1) as templates, and taking the primer group as a primer to carry out PCR amplification; obtaining the amplification products of the filial generation samples and the amplification products of the mother tree samples;
3) Carrying out agarose gel electrophoresis on the amplification products of the filial generation samples and the amplification products of the mother tree samples obtained in the step 2) to obtain electrophoresis results of the amplification products of the filial generation samples and the amplification products of the mother tree samples;
4) Comparing the electrophoresis result of the amplification product of the progeny sample with the electrophoresis result of the amplification product of the mother tree sample; if the band of the amplification product of the progeny sample is consistent with the band of the amplification product of the mother tree sample, the progeny is apomixis; if not, it is not an apomictic progeny.
Preferably, the PCR amplification system in step 2) comprises the following components in 20 μ L: 2 XPCR Mix 10. Mu.L, 10. Mu. Mol. L -1 1. Mu.L of each of the F-primer and the R-primer of (1), 20 ng. Mu.L -1 1. Mu.L of the template DNA of (1) and 7. Mu.L of sterilized ultrapure water.
Preferably, the amplification procedure of the PCR amplification described in step 2) is as follows: pre-denaturation at 94 ℃ for 4min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; final extension at 72 deg.C for 2min, and storage at 4 deg.C
The invention has the beneficial effects that: the primer group for identifying the authenticity of apomixis progeny of the apomixis walnut provided by the invention is characterized in that a primer pair in the primer group is an SSR primer which has polymorphism and is highly stable; the method can specifically amplify the allelic loci of the female parent and the filial generation, and judges whether the filial generation is apomictic generation through comparison of the amplification products, and has the advantages of simple operation, short time consumption and high accuracy.
Drawings
FIG. 1 is the result of identifying the authenticity of 6 pairs of SSR marker primers for apomixis progeny of 'Polycarya crotalarioides' walnuts, wherein 1 is a 'Polycarya crotalarioides' walnut mother tree sample, 2-3 are 2 parts of bagging treatment progeny (treatment I), 4-12 are 10 parts of stigma cutting treatment progeny (treatment II), 13-23 are 10 parts of natural pollination control (treatment III), and 24 is a negative control (ultrapure water is an amplification template);
FIG. 2 is a schematic representation of the use of YAFW01-F and YAFW01-R in the identification of specific apomictic progeny; YAFW02-F and YAFW02-R; 3 pairs of primers YAFW04-F and YAFW04-R can completely determine the real apomixis filial generation; wherein, 1 is a 'mother walnut sample of' mother walnut 'of Polygala crotalarioides', 2-3 are 2 filial generation processed by bagging (processing I), 4-12 are 9 filial generation processed by cutting stigmas (processing II), 13-23 are 11 natural pollination controls (processing III), 24 are negative controls (ultrapure water is an amplification template), and M is a molecular weight size standard (DNAmarker);
fig. 3 illustrates the use of YAFW02-F and YAFW02-R in identifying specific apomictic progeny; the filial generation which is not apomixis can be completely eliminated by using 2 pairs of primers of YAFW03-F and YAFW03-R; wherein, 1 is a 'Yangbi Dapao' walnut mother tree sample, 2 to 15 are 14 parts of stigmas cut treated filial generation (treated II), 16 to 21 are 6 parts of natural pollination control (treated III), 22 is negative control (ultrapure water is an amplification template), and M is a molecular weight size standard (DNA Marker).
Detailed Description
The invention provides a primer group for authenticating the authenticity of apomixis filial generation without fusion of the apomixis of the juglans sigillata, which comprises one pair of the following primer pairs: YAFW01-F and YAFW01-R; YAFW02-F and YAFW02-R; YAFW03-F and YAFW03-R; YAFW04-F and YAFW04-R; YAFW05-F and YAFW05-R; YAFW06-F and YAFW06-R; the nucleotide sequences of the primer pairs are as follows:
YAFW01-F：GAAGAGACTCCGTTGCCACA(SEQ ID NO：1)
YAFW01-R：ACTCCGTCGTTTCCCTGAAC(SEQ ID NO：2)
YAFW02-F：ATGAGAGCCAGCCAACAGAC(SEQ ID NO：3)
YAFW02-R：CGAGCGAGCAAGAGAGAGAG(SEQ ID NO：4)
YAFW03-F：TCCGGACAACTCCTCATCCT(SEQ ID NO：5)
YAFW03-R：CTCTCCGCCGAGTCATGTAC(SEQ ID NO：6)
YAFW04-F：AGCTAGCTCTCAAACAACAAGC(SEQ ID NO：7)
YAFW04-R：ACAAACATGGCAACCTTCGTG(SEQ ID NO：8)
YAFW05-F：AGCTCAACGGTCAAGGAAGG(SEQ ID NO：9)
YAFW05-R：GGAGAGAGAGAGCTCGGCTA(SEQ ID NO：10)
YAFW06-F：GCCTCTCCTCGTGCTCATTT(SEQ ID NO：11)
YAFW06-R：ACTCGCTACTTTTCAGGCCC(SEQ ID NO：12)。
in the present invention, the primer pairs in the primer set are SSR primers, and the repeat type, repeat number, product size, and annealing temperature of the primers are shown in table 1. The preparation method of the primer is not specially limited, and the primer can be prepared by adopting a conventional method in the field, and is synthesized by Shanghai biological engineering corporation Limited in the specific implementation process of the invention.
TABLE 1 details of the primers
The invention provides a kit for authenticating the authenticity of apomixis filial generation of a juglans sigillata, which comprises the primer group. In the present invention, the kit preferably further comprises 2 × PCR Mix and water. In the present invention, the 2 XPCR Mix is preferably purchased from Beijing kang, century Biotechnology Ltd. In the invention, the kit preferably further comprises a positive control substance and a negative control substance, and in the invention, the positive control substance is preferably the genomic DNA of a non-fused mother tree sample of the juglans sigillata; the negative control is preferably sterile ultrapure water.
The invention provides a method for authenticating the authenticity of apomixis filial generation of a juglans sigillata, which comprises the following steps: 1) Respectively extracting the genome DNA of the leaf of the progeny sample and the genome DNA of the leaf of the parent tree sample; 2) Respectively taking the genomic DNA of the progeny sample leaves and the maternal tree sample leaves in the step 1) as templates, and taking the primer group as a primer to carry out PCR amplification; obtaining the amplification products of the filial generation samples and the amplification products of the mother tree samples; 3) Carrying out agarose gel electrophoresis on the amplification products of the filial generation samples and the amplification products of the mother tree samples obtained in the step 2) to obtain electrophoresis results of the amplification products of the filial generation samples and the amplification products of the mother tree samples; 4) Comparing the electrophoresis result of the amplification product of the progeny sample with the electrophoresis result of the amplification product of the mother tree sample; if the band of the amplification product of the progeny sample is consistent with the band of the amplification product of the mother tree sample, the progeny is apomixis; if not, it is not an apomictic progeny.
In the invention, the genome DNA of the leaf of the filial generation sample and the leaf of the mother tree sample are respectively extracted. In the present invention, the progeny sample leaf and the mother tree sample leaf are preferably healthy leaves. The method for extracting the genomic DNA is not particularly limited, and a conventional method for extracting a plant genome in the field can be adopted. In the practice of the present invention, the novel plant genome extraction kit (DP 320) manufactured by Beijing Tiangen Biotechnology Ltd is preferably used for extraction. After the genomic DNA is extracted and obtained, the concentration and the quality of the genomic DNA are preferably detected; the concentration is preferably detected by a micro ultraviolet spectrophotometer ND 2000; the quality detection is preferably carried out by adopting an agarose electrophoresis method, an electrophoresis band is single, clear, bright and free of dispersion, and the quality of the genome DNA is qualified; if the product is not qualified, the product needs to be extracted again. After obtaining the qualified genome DNA, the invention preferably dilutes the genome DNA; the concentration of the diluted genomic DNA is preferably 20 ng. Mu.L -1 The diluted genomic DNA is preferably stored at-20 ℃ in a refrigerator for future use.
After obtaining the genome DNA of the leaf of the progeny sample and the leaf of the mother tree sample, respectively taking the genome DNA of the leaf of the progeny sample and the genome DNA of the leaf of the mother tree sample as templates and taking the primer group as a primer to carry out PCR amplification; obtaining the amplification products of the filial generation sample and the mother tree sample. In the present invention, the amplification system of the PCR amplification is calculated by 20. Mu.L, and preferably comprises the following components: 2 XPCR Mix 10. Mu.L, 10. Mu. Mol. L -1 1. Mu.L of each of the F-primer and the R-primer of (1), 20 ng. Mu.L -1 Form panel of1 mu L of DNA and 7 mu L of sterilized ultrapure water; the amplification procedure of the PCR amplification is preferably as follows: pre-denaturation at 94 ℃ for 4min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; final extension at 72 deg.C for 2min, and storage at 4 deg.C.
After the amplification products of the filial generation sample and the mother tree sample are obtained, the obtained amplification products of the filial generation sample and the mother tree sample are subjected to agarose gel electrophoresis to obtain the electrophoresis results of the amplification products of the filial generation sample and the mother tree sample. The method and steps of the agarose gel electrophoresis are not particularly limited, and the method and steps of the agarose gel electrophoresis which are conventional in the field can be adopted.
After electrophoresis, comparing the electrophoresis result of the amplification product of the progeny sample with the electrophoresis result of the amplification product of the mother tree sample; if the band of the amplification product of the progeny sample is consistent with the band of the amplification product of the mother tree sample, the progeny is apomixis; if not, it is not an apomictic progeny.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
The walnut kernel of the 'niangqing' walnut is oval or round, the top end is sharp, the base part is flat, the average longitudinal and transverse meridians are 2.8-3.6 cm, the shell thickness is 1.1-1.3 mm, the inner fold wall is slightly developed, the whole kernel or half kernel can be selected, the inner seed coat has purple veins, the kernel is full, and the taste is fragrant. Has the characteristics of easy survival, fast growth, barren resistance, strong adaptability, high yield and stable yield of grafting. The 'Juglans sigillata' walnut is one of main cultivated varieties in 23 walnut series of the 'Yangbi walnut' geographic sign protection product, the walnut can be planted for 88 ten thousand mu only in 9 villages and towns in the Yangbi county, the yield is more than 2.7 ten thousand tons, the annual output value is more than 5 million yuan, and the 'Rongqian tree' in the Yangbi Fuminxing county is provided. The 'Polygala crotalarioides' walnut has apomixis or complexity, is operated by adopting a conventional embryology observation method and an isozyme analysis method, and has the defects of more steps, longer time consumption and need of rich experience.
Test materials
Carrying out 2 apomixis treatments on the pecan, namely bagging (treatment I) and cutting stigmas (treatment II) to respectively obtain 100 female flowers, and taking 11 fruits of natural pollination and fructification offspring (treatment III) as a control for treatment. The emergence of the progeny fruits after sowing is shown in table 2.
TABLE 2 apomixis treatment of 'Polygala crotalarioides' walnut and emergence of naturally pollinated fruit
Genomic DNA extraction and detection
Taking the above test materials and Polygala crotalarioides extracting genome DNA from healthy leaves of the mother tree. The extraction of DNA was carried out by using "novel plant genome extraction kit (DP 320)" manufactured by Beijing Tiangen Biotechnology Ltd. Detecting concentration and quality by using micro ultraviolet spectrophotometer ND2000 and 0.8% agarose gel electrophoresis, and diluting sample concentration to 20 ng. Mu.L -1 And storing in a refrigerator at-20 ℃ for later use.
SSR-PCR reaction system, amplification program and detection of amplification product
The SSR primers are from the institute of economic and forestry, the national institute of forestry and sciences, yunnan province, and 6 pairs of polymorphic and highly stable SSR primers are synthesized by Shanghai biological engineering corporation, wherein specific sequence information is shown in Table 1.
The total volume of the SSR-PCR amplification reaction system is 20 muL, wherein 10 muL of 2 XPCR Mix (Beijing kang is century Biotechnology Co., ltd.), and 1 muL of each of the upstream and downstream primers of SSR (10 mumol. L) -1 ) 1. Mu.L of template DNA (20 ng. Mu.L) -1 ) 7. Mu.L of ultrapure water was sterilized.
The SSR-PCR amplification program is as follows: pre-denaturation at 94 ℃ for 4min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, and 30 cycles; final extension at 72 deg.C for 2min, and storage at 4 deg.C. The amplification reaction was performed in a Biometra TProfessional thermocycler amplification apparatus.
After SSR-PCR amplification is finished, separating an amplification product in 3% agarose gel, taking DL2000 as a molecular weight size standard (DNA marker), and performing EB (Epstein-Barr) staining detection after electrophoresis is finished.
SSR identification of genuineness of apomictic offspring
And (3) performing homozygous/heterozygous banding pattern analysis on the parent tree and the apomixis filial generation to be detected by different treatments by using the 6 pairs of SSR primers, wherein the judgment standard of the authenticity of the apomixis filial generation is as follows: the amplified band is obvious, the band shape is clear and stable, and the amplified band and the mother tree present a single band (namely, the amplified band and the SSR locus of the mother tree are homozygotic); while two bands (heterozygote) appear in the free-pollinated progeny and the non-apomictic progeny.
Results
The authenticity identification of apomixis offspring is carried out on the SSR marker primer by 6 pairs of 'Polymnia sonchifolia' walnuts, the result is shown in figure 1, wherein 1 is a 'Polymnia sonchifolia' walnut mother tree sample, 2-3 are 2 parts of bagging treatment offspring (treatment I), 4-12 are 9 parts of stigma cutting treatment offspring (treatment II), 13-23 are 11 parts of natural pollination control (treatment III), 24 is negative control (ultrapure water is an amplification template), and M is a molecular weight size standard (DNAmarker). Primer pairs YAFW01-F and YAFW01-R are sequentially arranged from top to bottom; YAFW02-F and YAFW02-R; YAFW04-F and YAFW04-R; YAFW05-F and YAFW05-R; amplification results of YAFW06-F and YAFW 06-R. YAFW01-F and YAFW01-R were used in specific identification procedures; YAFW02-F and YAFW02-R; and 3 pairs of primers YAFW04-F and YAFW04-R can completely determine apomixis (see figure 2, wherein 1 is a mother walnut sample of 'Polymnia glauca', 2-3 are 2 bagging treatment filial generations (treatment I), 4-12 are 9 stigma cutting treatment filial generations (treatment II), 13-23 are 11 natural pollination controls (treatment III), 24 are negative controls (ultrapure water is an amplification template), and M is a molecular weight size standard (DNA Marker)).
The results show that the fruiting offspring of 2 bagging treatments (2 and 3) and 3 stigma cutting treatments (6, 8 and 11) are apomictic offspring, and all detected individuals pollinated naturally are not apomictic offspring.
The embodiments show that the primer group and the kit for authenticating the authenticity of the apomixis progeny of the juglans sigillata variety 'nyuqing' provided by the invention can specifically amplify the allelic loci of the female parent and the progeny, and judge whether the progeny is the apomixis progeny or not by comparing the amplification products, so that the operation is simple, the time consumption is short (the result can be obtained within one working day), and the accuracy is high.
Example 2
The Yangbi big-bubble walnut kernel is spherical or oblate, the top of the walnut kernel is round, the base is slightly sharp, the average length and width of the kernel is 3.1-3.8 cm, the shell thickness is 0.7-1.0 mm, and the kernel is made of inner fold wall and diaphragm paper and is easy to take out. Plump kernels, fragrant and non-astringent taste. The Yangbi Dapao' is famous for large fruit, thin shell, white kernel and fragrant flavor. The variety is an early clone excellent variety in Yunnan province, has a cultivation history of more than 500 years, and the 'Yangbi Dapao' walnut in 2004 is proved by the mark registration of the original production place, is certified by the national geographic identification in 2008, and is also one of excellent varieties which are vigorously developed, popularized and sold by foreign trade for more than years in Yunnan province at present. At present, the cultivation area reaches more than 150 million mu.
Test materials
The Juglans sigillata Dode is subjected to 2 apomixis treatments, namely bagging (treatment I) and stigmatissima cutting (treatment II) of 100 female flowers, and 6 natural pollination fructification progeny (treatment III) fruits are used as a control for treatment. The emergence of the progeny fruits after sowing is shown in table 3.
Table 3 'Yangbi Dapao' walnuts apomixis treatment and emergence situation of naturally pollinated fruits
Genomic DNA extraction and detection
And extracting genome DNA from the test material and healthy leaves of the Juglans sigillata Dode mother trees. The DNA was extracted using a novel plant genome extraction kit (DP 320) manufactured by Beijing Tiangen Biotechnology Ltd. Detecting concentration and quality by using micro ultraviolet spectrophotometer ND2000 and 0.8% agarose gel electrophoresis, and diluting sample concentration to 20 ng. Mu.L -1 And storing in a refrigerator at-20 ℃ for later use.
SSR-PCR reaction system, amplification program and detection of amplification product
The SSR primers are derived from economic forest research institute of forestry academy of sciences of Yunnan province, and 2 pairs of SSR primers with polymorphism and high stability, namely YAFW02-F and YAFW02-R are totally adopted; YAFW03-F and YAFW03-R were synthesized by Shanghai Biotechnology, inc.
The total volume of the SSR-PCR amplification reaction system is 20 muL, wherein 10 muL of 2 XPCR Mix (Beijing kang is century Biotechnology Co., ltd.), and 1 muL of each of the upstream and downstream primers of SSR (10 mumol. L) -1 ) 1. Mu.L of template DNA (20 ng. Mu.L) -1 ) And 7. Mu.L of sterilized ultrapure water.
The SSR-PCR amplification program is as follows: pre-denaturation at 94 ℃ for 4min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, and 30 cycles; final extension at 72 deg.C for 2min, and storage at 4 deg.C. The amplification reaction was performed in a Biometra TProfessional thermocycler amplification apparatus.
After SSR-PCR amplification is finished, separating an amplification product in 3% agarose gel, taking DL2000 as a molecular weight size standard (DNA marker), and performing EB (Epstein-Barr) staining detection after electrophoresis is finished.
SSR identification of genuineness of apomixis filial generation
Forming a primer combination by using 2 pairs of the 6 pairs of SSR primers, and carrying out homozygous/heterozygous banding pattern analysis on the mother tree and the apomixis filial generation to be detected by different treatments, wherein the judgment standard of the authenticity of the apomixis filial generation is as follows: the amplified band is obvious, the band shape is clear and stable, and the band shape presents a single band with the mother tree (namely, the band shape is homozygotic with the SSR locus of the mother tree); while two bands (heterozygote) appear in the free-pollinated progeny and the non-apomictic progeny.
Results
The 'Yangbi large-bubble' walnut uses 2 pairs of SSR Marker primers to perform non-fusional reproduction progeny authenticity identification, and the result is shown in figure 3, wherein 1 is a 'Yangbi large-bubble' walnut mother tree sample, 2-15 are 14 parts of stigma cutting processed progeny (processing II), 16-21 are 6 parts of natural pollination control (processing III), 22 is negative control (ultrapure water is an amplification template), and M is a molecular weight size standard (DNA Marker). Primer pairs YAFW02-F and YAFW02-R are sequentially arranged from top to bottom; amplification results of YAFW03-F and YAFW 03-R.
The result shows that all fruiting offspring processed by cutting stigma is not apomictic offspring, and all detection individuals pollinated naturally are not apomictic offspring.
The embodiments show that the primer group and the kit for identifying the authenticity of the apomictic progeny of the species Juglans sigillata Dode' can specifically amplify the allelic loci of the female parent and the progeny, and judge whether the progeny is the apomictic progeny or not by comparing the amplification products, so that the method is simple to operate, short in time consumption (results can be obtained within one working day), and high in accuracy.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> scientific college for forestry of Yunnan province
<120> primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaagagactc cgttgccaca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
agctagctct caaacaacaa gc 22
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
acaaacatgg caaccttcgt g 21
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gcctctcctc gtgctcattt 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
Claims (7)
1. The primer group for identifying the authenticity of apomixis filial generation of the apomixis walnut is characterized by comprising the following primer pair combinations: YAFW01-F and YAFW01-R; YAFW02-F and YAFW02-R; YAFW04-F and YAFW04-R total 3 pairs of primer pairs; or YAFW02-F and YAFW02-R; YAFW03-F and YAFW03-R have 2 pairs of primer pairs; the nucleotide sequences of the primer pairs are as follows:
the nucleotide sequence of YAFW01-F is shown as SEQ ID NO. 1, the nucleotide sequence of YAFW01-R is shown as SEQ ID NO. 2, the nucleotide sequence of YAFW02-F is shown as SEQ ID NO. 3, the nucleotide sequence of YAFW02-R is shown as SEQ ID NO. 4, the nucleotide sequence of YAFW03-F is shown as SEQ ID NO. 5, the nucleotide sequence of YAFW03-R is shown as SEQ ID NO. 6, the nucleotide sequence of YAFW04-F is shown as SEQ ID NO. 7, and the nucleotide sequence of YAFW04-R is shown as SEQ ID NO. 8.
2. Kit for authenticating the authenticity of apomictic progeny of apomictic walnuts, which is characterized by comprising the primer group of claim 1.
3. The kit of claim 2, further comprising 2 x PCR Mix and water.
4. The kit of claim 2 or 3, further comprising a positive control and a negative control.
5. The method for authenticating the authenticity of apomixis filial generation of the apomixis walnuts comprises the following steps:
1) Respectively extracting genome DNA of the leaf of the filial generation sample and the leaf of the mother tree sample;
2) Respectively taking the genomic DNA of the leaf of the progeny sample and the genomic DNA of the leaf of the parent tree sample in the step 1) as templates, and taking the primer group in the claim 1 as a primer to carry out PCR amplification; obtaining the amplification products of the filial generation samples and the amplification products of the mother tree samples;
3) Carrying out agarose gel electrophoresis on the amplification products of the filial generation samples and the amplification products of the mother tree samples obtained in the step 2) to obtain electrophoresis results of the amplification products of the filial generation samples and the amplification products of the mother tree samples;
4) Comparing the electrophoresis result of the amplification product of the progeny sample with the electrophoresis result of the amplification product of the mother tree sample; if the band of the amplification product of the progeny sample is consistent with the band of the amplification product of the mother tree sample, the progeny is apomixis; if not, it is not an apomictic progeny.
6. The method according to claim 5, wherein the PCR amplification system in step 2) comprises the following components in 20 μ L: 2 XPCRMix 10. Mu.L, 10. Mu. Mol. L -1 1. Mu.L of each of the F-primer and the R-primer of (1), 20 ng. Mu.L -1 1. Mu.L of the template DNA of (1) and 7. Mu.L of sterilized ultrapure water.
7. The method according to claim 5 or 6, wherein the amplification procedure of the PCR amplification in step 2) is as follows: pre-denaturation at 94 ℃ for 4min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; final extension at 72 deg.C for 2min, and storage at 4 deg.C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910222663.0A CN111719009B (en) | 2019-03-22 | 2019-03-22 | Primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910222663.0A CN111719009B (en) | 2019-03-22 | 2019-03-22 | Primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111719009A CN111719009A (en) | 2020-09-29 |
| CN111719009B true CN111719009B (en) | 2023-03-14 |
Family
ID=72562798
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910222663.0A Active CN111719009B (en) | 2019-03-22 | 2019-03-22 | Primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111719009B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557369A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method |
| CN107557434A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method |
| CN107586866A (en) * | 2017-09-02 | 2018-01-16 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Moore characteristic sequence, labeled primer and authentication method |
| CN107586867A (en) * | 2017-09-02 | 2018-01-16 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method |
| CN108300798A (en) * | 2018-04-10 | 2018-07-20 | 新疆农业科学院园艺作物研究所 | A kind of primer pair of walnut microsatellite DNA mark fingerprint map construction method and its application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104884625A (en) * | 2012-10-15 | 2015-09-02 | 先锋国际良种公司 | Methods and compositions to enhance activity of cry endotoxins |
-
2019
- 2019-03-22 CN CN201910222663.0A patent/CN111719009B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107557369A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method |
| CN107557434A (en) * | 2017-09-02 | 2018-01-09 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method |
| CN107586866A (en) * | 2017-09-02 | 2018-01-16 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Moore characteristic sequence, labeled primer and authentication method |
| CN107586867A (en) * | 2017-09-02 | 2018-01-16 | 浙江省林业科学研究院 | Thin shell mountain pecan Peach cultivars Pawnee characteristic sequence, labeled primer and authentication method |
| CN108300798A (en) * | 2018-04-10 | 2018-07-20 | 新疆农业科学院园艺作物研究所 | A kind of primer pair of walnut microsatellite DNA mark fingerprint map construction method and its application |
Non-Patent Citations (1)
| Title |
|---|
| 核桃无融合生殖的诱导及鉴定;朱燕;《中国优秀硕士学位论文全文数据库》;20101231;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111719009A (en) | 2020-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100138951A1 (en) | Methods of producing haploid and doubled haploid oil palms | |
| EP3978613A1 (en) | Parthenogenetic haploid induction gene dmp and application thereof | |
| Huang et al. | Determination of genetic stability of long-term micropropagated plantlets of Platanus acerifolia using ISSR markers | |
| Ruiqi et al. | Introduction of chromosome segment carrying the seed storage protein genes from chromosome 1V of Dasypyrum villosum showed positive effect on bread-making quality of common wheat | |
| CN104488694B (en) | Method for rapidly cultivating transgenic maize inbred line | |
| CN113637794B (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| Amorim et al. | Banana breeding at Embrapa cassava and fruits | |
| González et al. | Somatic embryogenesis and plant regeneration capacity in Argentinean maize (Zea mays L.) inbred lines | |
| CN113430300A (en) | SSR molecular marker of mulberry variety Yuehen 123, core primer group and kit thereof, and application of SSR molecular marker | |
| Luthar et al. | Biotechnological methods for buckwheat breeding | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| Tel-Zur | Breeding an underutilized fruit crop: A long-term program for Hylocereus | |
| CN106591460B (en) | Method for identifying variety of 'Zhongcha 302' tea tree by SSR molecular marker and application | |
| Li et al. | Homozygote depression in gamete-derived dragon-fruit (Hylocereus) lines | |
| CN111719009B (en) | Primer group, kit and method for authenticating apomixis filial generation authenticity of paullo walnuts | |
| REPEAT | Assessing the genetic relationship of Taif rose with some rose genotypes (Rosa sp.) based on random amplified polymorphic DNA, inter simple sequence repeat and simple sequence repeat markers | |
| Kishii et al. | Production of wheat-Psathyrostachys huashanica chromosome addition lines | |
| CN108239675B (en) | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof | |
| Chen et al. | Induction of apomixis by dimethyl sulfoxide (DMSO) and genetic identification of apomictic plants in cassava | |
| EP1972692A1 (en) | Methods of producing haploid and doubled haploid oil palms | |
| Hu et al. | Authenticity identification and leaf blight resistance evaluation of the F1 hybrids from two Lilium cultivars ‘Sorbonne’and ‘Francia’ | |
| Zhong et al. | A genotype independent DMP-HI system in dicot crops | |
| Encheva et al. | Field evaluation of somaclonal variation in sunflower (Helianthus annuus L) and its application for crop improvement | |
| Sanghera et al. | Sugarcane improvement in genomic era: opportunities and complexities | |
| Sepahian et al. | Authentication, genetic fingerprinting and assessing relatedness of rice (Oryza Sativa) genotypes by SSR molecular markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |