CN102584967B - Anti-soybean mosaic virus (SMV) protein in soybean and coding gene Rsv3C and application thereof - Google Patents

Abstract

The invention discloses an anti-soybean mosaic virus (SMV) protein in soybean and a coding gene Rsv3C and application thereof. The amino acid sequence of the protein is shown as SEQ ID NO. 1. The nucleotide sequence of the gene is shown as SEQ ID NO. 2. The cloned Rsv3C functional anti-SMV gene can be used as a target gene and introduced into high-yield soybean varieties; and the R protein coded by the gene can identify effect factors released by corresponding SMV pathogens and excite resistance response, so that the disease resistance of plants is improved and the aim of improving plant varieties is fulfilled.

Description

Anti-SMV albumen and encoding gene Rsv3C and application in the soybean

Technical field

The invention belongs to biological technical field, be specifically related to anti-SMV albumen and encoding gene Rsv3C and their application in cultivating anti-SMV soybean in the soybean.

Background technology

Soybean is important plant protein and food oils source, but (Soybean Mosaic Virus, SMV) caused soybean mosaic is one of the most serious soybean diseases that generally takes place in worldwide by soybean mosaic virus.In each soybean producing region of China, annual SMV all causes the harm of certain degree, and along with the differentiation of viral toxicity is strengthened, production loss has the trend that increases the weight of year by year.For example the dish that " inferior vegetables " are introduced from Taiwan almost has no harvest with many areas of soybean varieties " Taiwan 75 " with regard to Ceng Yinwei severe infections soybean mosaic virus two provinces in the Jiangsu and Zhejiang Provinces.SMV not only reduces soybean yields, and causes seed mottled, influences the exterior quality of soybean, directly threatens the beans farming and increases income and national agriculture safety.No matter still external at home, prevent and treat soybean mosaic is to ensure that soybean continues a preferential research topic of producing always, but does not still have the control that beneficial agents is used for SMV at present.Developing rapidly of Protocols in Molecular Biology makes to filter out the not available functional disease-resistant gene of perceptual kind that from the soybean resistant variety utilizing it to carry out soybean molecular breeding then becomes possibility.This is a kind of splendid prevention and cure of viruses strategy, also is to cultivate the most cost-effective ways disease-resistant, the high quality soybean new variety.

Summary of the invention

The technical problem that solves:The present invention is directed to above-mentioned technological gap, anti-SMV albumen and encoding gene Rsv3C thereof in a kind of soybean are provided, and their application in cultivating anti-SMV soybean are provided.

Technical scheme:

Anti-SMV albumen in the soybean, the aminoacid sequence of this albumen is as described in the SEQ ID NO. 1.

The encode gene Rsv3C of anti-SMV albumen in the above-mentioned soybean, the nucleotide sequence of this gene is as described in the SEQ ID NO. 2.

The recombinant plasmid that comprises above-mentioned nucleotide sequence.

The host's carrier that comprises above-mentioned recombinant plasmid.

The application of above-mentioned aminoacid sequence in cultivating anti-SMV soybean.

Above-mentioned nucleotides sequence is listed in the application of cultivating in the anti-SMV soybean.

Beneficial effect:

The present invention clone's the functional anti-SMV gene of Rsv3C, can be used as goal gene and import more high yielding soybeans kinds, its coded R albumen can be identified the effector of corresponding SMV cause of disease release and excite the resistance reaction, improves the resistance against diseases of plant, reaches the purpose of plant species improvement.

Carry the anti-SMV gene of Rsv3C function of the present invention plant expression vector can Ti-plasmids, Ri plasmid, plant viral vector, dna direct conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated by using, and the plant transformed tissue cultivating is become plant.Improve the accuracy of breeding and accelerate breeding process, satisfy and produce the requirement of going up varietal resistance, the harm of control SMV improves the yield and quality of soybean, strengthens the market competitiveness of homemade soybean.In addition, by fast prediction, screening, the definite research that reaches the clone to the anti-SMV functional gene of soybean, also can provide a kind of new technology and service platform for other disease-resistant gene research, promote the development of soybean function gene clone new technology.

Description of drawings

Fig. 1 is 5 NBS-LRR type disease-resistant gene position synoptic diagram between molecule marker A519 and M3Satt on No. 14 karyomit(e)s of soybean, difference called after Rsv3-A, B, C, D, E;

Fig. 2 is at the special zone design primer of the upstream and downstream of each gene, is used for whole coding regions (comprising an intron zone) of amplification corresponding gene;

Fig. 3 analyzes after for the sequence that obtains Rsv3 go up each gene from anti-, sense kind soybean, constructing system develops and sets, discovery has only the Rsv3C gene to distinguish cluster separately between anti-sense kind, and great changes will take place for the sequence of resistant variety, detect tangible forward selective action, its evolutionary pattern meets the feature of functioning gene; Other gene does not then possess these features, fails between anti-sense kind cluster separately as the Rsv3B gene, and sequence difference is little, also detects less than the forward selective action;

Fig. 4 is that the analysis of protein 3D structural simulation shows, last figure is perceptual kind, figure below is resistant variety: compare with the Rsv3C in the perceptual kind, noticeable change has taken place at the function cog region (LRR zone) of C-end in the Rsv3C product in the resistant variety precocity 18, not obvious in the resistance protein product as some the loose loop zones (arrow) in the perceptual albumen, even disappear.Thereby the virokine that identification SMV virus discharges, and excite resistance.

The transgene clone carrier pBA002 that Fig. 5 selects for use for us has been connected to the Rsv3C gene that separates in the resistant variety precocity 18 in this carrier, and the result of plasmid extraction and PCR checking result are all positive.M1 is the 15kb molecule marker among the figure; 1 plasmid (the containing Rsv3C) gene for extracting after the successful connection; The 2 Rsv3C fragments that obtain for PCR checking; M2 is the 8kb molecule marker.

Fig. 6 utilizes agriculture bacillus mediated cotyledonary node method, and precocious 18-Rsv3C gene is imported to the transfer-gen plant that produces after the high sense kind, and its blade shows as resistance to soybean mosaic virus.

Embodiment

Below by the present invention of embodiment more detailed description, but the present invention is not limited by the following examples.

Embodiment 1:

Obtain functional gene:

(1) utilizes soybean Williams82 genomic data (http://soybase.org/), obtain the 153kb sequence that molecule marker A519 and M3Satt limit on No. 14 karyomit(e).Then with the standard construction territory sequence NB-ARC(PF00931 in the Pfam database (http://pfam.janelia.org/)) be reference, to the search of comparing of this 153kb sequence, find the gene that contains the NBS functional domain.Compare two kinds of methods by predictive genes instrument FGENESH and ordering, determine the total length zone of this gene, comprise number and the position of exon, intron.With its called after Rsv3 C.

(2) by software Oligo6, design the Auele Specific Primer (Fig. 2) of Rsv3C, primer sequence is:

Upstream CGGAATTCCGAGCGACAAGTCATGGTAT;

Downstream TCCCCGCGGGGATATGAGGGGTGTTAGTGTCTGA;

(3) gather about blades 5 grams the back manufacturing soybean precocity 18, two week, adopts improved CTAB method to extract genomic dna, and with concentration and the purity of 0.8% agarose gel electrophoresis and UV spectrophotometer measuring gained DNA.Be template (concentration is controlled to be 20ng/ μ L) with the genomic dna, utilize the Auele Specific Primer that (2) step designed, adopt LA-Taq enzyme and the matched reagent of TAKARA company, with Long-PCR method amplification NBS-LRR type candidate gene Rsv3C.The PCR program of using is: 94 ℃ of pre-sex change 5 minutes, and 94 ℃ of sex change 30 seconds, 56 ℃ of renaturation 45 seconds, 68 ℃ were extended 7 minutes, totally 30 circulations, 68 ℃ of renaturation 10 minutes, 12 ℃ of constant temperature subsequently.The PCR system of using is 25 microlitre systems: comprise 15.2 microlitre deionized waters, 2.5 microlitres, 10 * LA PCR Buffer, 2.5 microlitre MgCl ₂, 2.5 microlitre dNTP(20mM), 1 microlitre upstream special primer, 1 microlitre downstream special primer, and 0.3 microlitre LA Taq enzyme.After the reaction, the product of pcr amplification is carried out the agarose gel electrophoresis purifying, send order-checking company (Nanjing Genscript Biotechnology Co., Ltd.) to measure its nucleotide sequence then.

(4) select transgene clone carrier pBA002 for use; take double-enzyme method with restriction enzyme EcoRI and SacII carrier to be cut into wire; again with the Rsv3C upstream and downstream primer that has restriction enzyme site (contain protection base) with Rsv3C gene amplification purifying after; adopt T4 ligase enzyme (TAKARA company) to be connected in the carrier, obtain pBA002-Rsv3C.Clone successfully for guaranteeing to connect, we have carried out necessary plasmid extraction and PCR checking, and the result is positive (Fig. 5) all.

Functional checking:

(5) then take agriculture bacillus mediated cotyledonary node method, the Rsv3C gene is transferred in the high sense kind (Williams): change pBA002-Rsv3C over to agrobacterium tumefaciens bacterial strain EHA105(Avsian-Kretchmer et al with freeze-thaw method, 2004, Plant Physiology, 135:1685-1696) in.PBA002-Rsv3C transforms high sense kind by the mediation of Agrobacterium strain EHA105, utilizes antibiotic-screening and round pcr to screen positive transfer-gen plant.After waiting to induce the indefinite bud growth of generation and producing blade, it is carried out soybean mosaic virus infect.The incidence of 2 weeks back detection transgenic seedling blade is found not fall ill substantially, compares with the sickness rate that non-transgenic contrast plant height reaches more than 80%, and resistance is (Fig. 6) extremely significantly.This shows originally soybean mosaic virus is shown as susceptible height sense kind because having changed the Rsv3C gene of our screening over to, and has possessed the ability of resisting soybean mosaic virus.

Sequence table

＜110〉Nanjing University

＜120〉anti-SMV albumen and encoding gene Rsv3C and application in the soybean

<130>

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1301

<212> PRT

＜213〉artificial sequence

<400> 1

Met Gly Asp Ile Val Leu Ser Ile Val Ala Lys Leu Ala Glu Tyr Thr

1 5 10 15

Val Gly Pro Ile Leu Asp His Ala Arg Tyr Leu Cys Cys Phe Asn Asn

20 25 30

Ile Ala Gly Asn Leu Pro Asn Ala Lys Glu Glu Leu Glu Leu Thr Arg

35 40 45

Asn Ser Val Lys Glu Arg Val Glu Glu Ala Ile Met Arg Thr Glu Ile

50 55 60

Ile Glu Pro Ala Val Glu Lys Trp Leu Lys Asp Val Glu Lys Val Leu

65 70 75 80

Glu Glu Val His Met Leu Gln Gly Arg Ile Ser Glu Val Ser Lys Ser

85 90 95

Tyr Phe Arg Arg Gln Phe Gln Tyr Phe Leu Thr Lys Glu Ile Ala Arg

100 105 110

Lys Ile Glu Lys Met Ala Gln Leu Asn His Asn Ser Lys Phe Glu Pro

115 120 125

Phe Ser Lys Ile Ala Glu Leu Pro Gly Met Lys Tyr Tyr Ser Ser Lys

130 135 140

Asp Phe Val Arg Phe Lys Ser Arg Glu Ser Thr Tyr Glu Asn Leu Leu

145 150 155 160

Glu Ala Leu Lys Asp Lys Ser Ala Cys Thr Ile Gly Leu Val Gly Leu

165 170 175

Gly Gly Ser Gly Lys Thr Thr Leu Ala Lys Glu Val Gly Lys Lys Ala

180 185 190

Glu Glu Leu Lys Leu Phe Glu Lys Val Val Met Ala Thr Val Ser Gln

195 200 205

Thr Pro Asn Ile Thr Ser Ile Gln Met Gln Ile Ala Asp Lys Leu Gly

210 215 220

Leu Lys Phe Glu Glu Lys Thr Glu Glu Gly Arg Ala Gln Arg Leu Ser

225 230 235 240

Glu Arg Leu Arg Thr Gly Thr Thr Leu Leu Ile Leu Asp Asp Val Trp

245 250 255

Glu Lys Leu Glu Phe Glu Ala Ile Gly Ile Pro Tyr Asn Glu Asn Asn

260 265 270

Lys Gly Cys Gly Val Ile Leu Thr Thr Arg Ser Arg Glu Val Cys Ile

275 280 285

Ser Met Gln Cys Gln Thr Ile Ile Glu Leu Asn Leu Leu Ala Gly Asn

290 295 300

Glu Ala Trp Asp Leu Phe Lys Leu Asn Ala Asn Ile Thr Asp Glu Ser

305 310 315 320

Pro Tyr Ala Leu Lys Gly Val Ala Thr Lys Ile Val Asp Glu Cys Lys

325 330 335

Gly Leu Ala Ile Ala Ile Val Thr Val Gly Ser Thr Leu Lys Gly Lys

340 345 350

Thr Val Lys Glu Trp Glu Leu Ala Leu Ser Arg Leu Lys Asp Ser Glu

355 360 365

Pro Leu Asp Ile Pro Lys Gly Leu Arg Ser Pro Tyr Ala Cys Leu Gly

370 375 380

Leu Ser Tyr Asp Asn Leu Thr Asn Glu Leu Ala Lys Ser Leu Phe Leu

385 390 395 400

Leu Cys Ser Ile Phe Pro Glu Asp His Glu Ile Asp Leu Glu Asp Leu

405 410 415

Phe Arg Phe Gly Lys Gly Met Gly Leu Pro Gly Thr Phe Gly Thr Met

420 425 430

Glu Lys Ala Arg Arg Glu Met Gln Ile Ala Val Ser Ile Leu Ile Asp

435 440 445

Cys Tyr Leu Leu Leu Glu Ala Ser Lys Lys Glu Arg Val Lys Met His

450 455 460

Asp Met Val Arg Asp Val Ala Leu Trp Ile Ala Ser Lys Thr Gly Lys

465 470 475 480

Ala Ile Leu Ala Ser Thr Gly Met Asp Pro Arg Met Leu Leu Glu Asp

485 490 495

Glu Thr Ile Lys Asp Lys Arg Ala Ile Ser Leu Trp Asp Leu Lys Asn

500 505 510

Gly Gln Leu Leu Asp Asp Asp Gln Leu Asn Cys Pro Ser Leu Glu Ile

515 520 525

Leu Leu Phe His Ser Thr Glu Val Asp Phe Asp Val Ser Asn Ala Cys

530 535 540

Phe Glu Arg Leu Lys Met Ile Lys Ile Leu Ala Ile Leu Thr Ser Ser

545 550 555 560

Leu Asn Trp Arg Arg Arg Glu Leu Met Lys Pro Phe Gly Thr Ser Tyr

565 570 575

Leu Ser Leu Ser Leu Pro Gln Ser Met Glu Ser Leu Gln Asn Leu His

580 585 590

Thr Leu Cys Leu Arg Gly His Ile Leu Gly Asp Ile Ser Ile Leu Glu

595 600 605

Ser Leu Gln Ala Leu Glu Val Leu Asp Leu Arg Asn Ser Ser Phe Ile

610 615 620

Glu Leu Pro Asn Gly Ile Ala Ser Leu Lys Lys Leu Lys Leu Leu Asp

625 630 635 640

Leu Phe Asn Cys Val Ile Arg Glu His Asn Ala Tyr Glu Val Ile Gly

645 650 655

Arg Cys Leu Gln Leu Asn Glu Leu Tyr Leu Cys Ile Tyr Leu Cys Ala

660 665 670

Tyr Glu Glu Phe Pro His Asn Ile Ser Leu Ser Arg Leu Glu Arg Tyr

675 680 685

Val Leu Asn Phe Lys Met Tyr Ser Gln Ser Trp Thr Asp Met Met Glu

690 695 700

Glu His Arg Pro Cys Arg Ala Leu Cys Ile Asn Gly Phe Asn Ala Ser

705 710 715 720

Val Gln Ser Phe Ile Ser Leu Pro Ile Lys Asp Phe Phe Gln Lys Ala

725 730 735

Glu Tyr Leu His Leu Arg Asp Leu Lys Gly Gly Tyr Glu Asn Val Ile

740 745 750

Pro Ser Met Val Pro Gln Gly Met Asn His Leu Thr Phe Leu Ile Leu

755 760 765

Glu Asp Cys Pro Glu Ile Lys Cys Val Phe Asp Gly Thr Thr Met Gln

770 775 780

Thr Glu Asp Ala Phe Ser Ser Leu Val Ile Leu Arg Leu Tyr Glu Leu

785 790 795 800

Asp Asn Leu Glu Glu Val Phe Asn Asp Pro Ser Ser Arg Cys Ser Leu

805 810 815

Lys Ser Leu Glu Glu Leu Ser Ile Glu Ser Cys Arg Gln Leu Tyr Asn

820 825 830

Ile Ser Phe Pro Lys Asn Ser Lys Leu Cys His Leu Lys Phe Leu Thr

835 840 845

Ile Asp His Cys Pro Met Leu Thr Cys Ile Phe Lys Pro Ser Ile Val

850 855 860

Gln Thr Leu Glu Leu Leu Glu Gln Val Thr Ile Ser Asp Cys Phe Glu

865 870 875 880

Leu Lys Gln Ile Ile Glu Glu Val Glu Glu Gly Ser Val Asp Tyr Val

885 890 895

Ser Ser Gln Ser His Thr Ser Leu Met Leu Pro Lys Leu Arg Thr Leu

900 905 910

Thr Ile Leu Arg Cys His Ser Leu Glu Tyr Ile Phe Pro Met Cys Tyr

915 920 925

Ala His Gly Leu Ala Ser Leu Glu Glu Leu Asn Ile Gly Phe Cys Asp

930 935 940

Lys Leu Lys Tyr Val Phe Gly Ser Glu Lys Glu His Asp Leu Arg Val

945 950 955 960

Tyr Gln His Gln Ser His Pro Gln Thr Asn Ile His Ile Asn Phe Leu

965 970 975

Asn Leu Glu Thr Leu Arg Leu Thr Glu Leu Pro Asn Leu Val Glu Ile

980 985 990

Trp Pro Lys Tyr Phe Asp Pro His Leu Pro Asn Leu Lys Glu Leu Gln

995 1000 1005

Cys Ile Asp Cys Pro Arg Leu Pro Asp Ser Trp Val Arg Arg Val

1010 1015 1020

Met Ile Ile Asp Ser Asp Leu Gln Gln Asp Ser Thr Thr Thr Glu

1025 1030 1035

Lys Glu Leu Leu Cys Ser Val Thr Thr Thr Phe Asn Gln Leu Ser

1040 1045 1050

Asp Gln Val Leu Ser Ser Lys Leu Arg His Leu Gln Leu Tyr Gly

1055 1060 1065

Leu Gly Val Lys Gly Leu Phe Gln Phe Gln Ile Arg Glu His Gly

1070 1075 1080

Ser Asn Thr Glu Leu Ala Pro Leu Asn Leu Asp Leu Ile Tyr Ala

1085 1090 1095

Glu Leu Ser Asp Leu Pro Glu Leu Glu Phe Ile Trp Lys Gly Pro

1100 1105 1110

Thr Asn Phe Leu Ser Leu Gln Met Leu Asp Val Ile Tyr Val Asn

1115 1120 1125

Arg Cys Pro Lys Leu Lys Val Ile Phe Ser Pro Thr Ile Val Arg

1130 1135 1140

Ser Leu Pro Met Leu Arg Thr Leu Glu Ile Thr His Cys Glu Glu

1145 1150 1155

Leu Glu Gln Ile Phe Asp Ser Gly Asp Ala Gln Thr Leu Tyr Thr

1160 1165 1170

Cys Ser Gln Gln Val Cys Phe Pro Asn Leu His Tyr Ile Cys Val

1175 1180 1185

Glu Lys Cys Asn Lys Leu Lys Tyr Leu Phe His Asn Phe Val Ala

1190 1195 1200

Gly His Phe His Asn Leu Ile Ala Leu Glu Ile Lys Asp Cys Ser

1205 1210 1215

Gln Leu Gln Lys Val Phe Ala Phe Glu Cys Glu Thr Asp Asp Asp

1220 1225 1230

Asp Gln Glu Gly Ile Val Met Asp Gly Glu Lys Val Leu Leu Arg

1235 1240 1245

Asn Leu Leu Arg Ile Arg Leu Ser Arg Leu Pro Asn Phe Lys Glu

1250 1255 1260

Ile His His Gly Phe Lys Leu Lys Asp Asp Val Glu Glu His Ile

1265 1270 1275

Ile Asn Asp Cys Pro Lys Tyr Tyr Pro Ser Leu Tyr Leu His Thr

1280 1285 1290

Gly Thr Ile Leu Met Ser Phe Tyr

1295 1300

<210> 2

<211> 3906

<212> DNA

＜213〉artificial sequence

<400> 2

atgggggata ttgttctttc catcgtagca aagttagcag aatatacagt gggcccaatt 60

ttagaccatg ctcgatactt gtgttgtttc aacaacattg ctgggaatct tccaaatgcc 120

aaggaagaat tggaattaac ccgaaacagt gtgaaggaac gagttgaaga agctattatg 180

aggactgaaa taattgaacc agcagttgag aagtggctga aagatgttga gaaagtctta 240

gaagaagtgc atatgcttca aggaagaatt tcggaagtaa gcaagagcta tttcagaagg 300

caattccaat attttcttac aaaagaaata gcaagaaaaa ttgagaaaat ggctcaactc 360

aaccacaaca gcaagtttga gccattttct aagattgccg aacttccagg catgaagtac 420

tattcatcca aagattttgt tcgtttcaaa tcaagagaat cgacttatga gaaccttttg 480

gaagcattaa aggataaaag cgcttgcacg attggactag ttggactagg aggctcagga 540

aaaactactt tggcgaaaga ggttggtaag aaagctgagg agttaaaact ttttgagaag 600

gttgtcatgg caacagtctc tcaaactcca aatatcacaa gcatccaaat gcaaattgct 660

gataagttgg gtttgaaatt tgaggaaaaa acagaggaag gtagagcaca aagactatca 720

gagagattaa ggacaggcac aactctacta atcttggatg atgtatggga aaagctagaa 780

tttgaggcta ttggtattcc atacaatgaa aacaacaagg gctgtggagt aattttaacc 840

actcggagta gagaagtatg catttccatg caatgccaaa caataattga gcttaatctc 900

ttagctggca atgaagcttg ggatttgttc aaattgaatg caaacataac tgatgagtcc 960

ccatatgcat tgaaaggcgt tgcaacaaaa attgtagatg aatgcaaagg attggctatt 1020

gcaattgtga cggtgggaag cacactgaag ggcaaaactg ttaaagagtg ggaattagca 1080

ttgtcaagac taaaagattc tgaaccacta gatattccaa aaggcttaag aagtccttat 1140

gcctgtcttg gattgagtta tgataatttg accaatgaat tagccaagtc cttgttcttg 1200

ttgtgttcta tatttccaga ggatcatgaa attgatttgg aagatttatt tcgatttgga 1260

aagggaatgg gcctacctgg gacttttgga acaatggaga aagcaaggag ggagatgcag 1320

atagctgtta gcatcctcat tgattgttat ttgttgttgg aggccagtaa aaaagaaagg 1380

gtgaaaatgc atgacatggt tcgtgatgta gccttgtgga tagcatctaa aactggtaaa 1440

gcaattttgg caagtaccgg aatggatcca agaatgttgt tagaggatga aaccataaaa 1500

gataagaggg caatatcctt atgggatttg aaaaatggcc agcttcttga tgatgatcaa 1560

ttgaattgtc catcacttga aattctcttg tttcattcaa ccgaggttga ctttgatgta 1620

tcaaatgctt gttttgaaag gctaaaaatg attaaaatcc tggcaatctt aacatctagc 1680

ttaaattggc gtaggcgtga attgatgaag ccatttggta catcgtatct ctccttgtca 1740

ctgccacaat caatggagtc attacaaaat cttcatactc tgtgcttgag aggtcatata 1800

ttaggtgaca tctccatttt ggaaagccta caagcacttg aggttcttga cttgcgtaat 1860

tcttctttta tagaattgcc taatggaatc gcgtcattaa agaaattgaa gcttctggat 1920

ttgttcaatt gtgtcattcg ggaacataat gcttacgagg ttataggaag atgtttgcag 1980

ctgaatgaat tgtatttgtg tatatattta tgtgcatatg aggaatttcc gcataatatc 2040

tccttgtcaa gattagagag gtatgtttta aattttaaaa tgtacagcca gagctggact 2100

gacatgatgg aagaacatag accatgtaga gctttatgca taaatggttt taatgcctca 2160

gttcaaagtt ttatatcatt accaatcaag gatttctttc aaaaagcaga gtaccttcat 2220

ttgagggacc ttaagggagg ttacgaaaat gtaatcccat ccatggttcc acaaggcatg 2280

aatcacttga ctttcctaat cctcgaagat tgtccagaga taaaatgcgt ctttgatggt 2340

accacaatgc aaactgaaga tgcgttctcc agcctagtca ttttacgctt gtatgaattg 2400

gataaccttg aagaagtgtt taatgacccc tcttccagat gttctctcaa aagtttagaa 2460

gagctaagca tagagagttg cagacaattg tacaatattt cctttcccaa gaactcaaag 2520

ctatgccatc tcaagttctt gacaatagat cattgcccga tgctaacttg tatcttcaag 2580

ccatccattg tccaaactct agagctgcta gaacaagtga caatatctga ctgctttgaa 2640

ttgaagcaga taatagaaga agtggaagaa gggagtgttg attatgttag cagtcaaagt 2700

catacctctt tgatgcttcc aaaattaagg acacttacta ttcttcgatg tcacagcttg 2760

gaatatatat tccctatgtg ttatgctcat gggctagcaa gtttggaaga gctgaacatt 2820

ggattttgtg ataagttgaa gtatgtattt ggcagtgaaa aggaacatga tcttagagtg 2880

taccagcacc agagtcatcc tcagactaat attcacatca atttccttaa tttggaaact 2940

ctacggttga cggagttgcc gaatttggtt gagatttggc ctaaatattt tgatccacat 3000

ttaccaaatt tgaaagagct acaatgcatt gattgtccaa gactgcctga ctcttgggtg 3060

cgtagggtga tgattattga ttcagatctg caacaagact caactacaac ggagaaggaa 3120

ttactatgct cggttaccac cacattcaac caattatccg atcaagtgct ttcttctaaa 3180

cttagacatc ttcaattgta tggtcttgga gtaaaaggtc ttttccaatt ccaaatcaga 3240

gaacatggga gcaacacaga acttgctcct ttaaacttgg atctaattta tgctgaattg 3300

agtgatctac ctgagctcga gttcatatgg aagggcccca caaattttct aagcctccag 3360

atgcttgacg tgatttatgt gaatagatgt ccaaaattga aagtcatctt ctcccctacc 3420

attgttagaa gcttaccaat gctgagaaca ctggaaataa cccattgtga ggaattggag 3480

caaatatttg attcaggtga tgcacaaacc ctatatactt gttcacaaca agtgtgcttc 3540

ccaaatctcc attatatttg tgtcgaaaag tgcaacaagt tgaaatacct ttttcataat 3600

tttgtggctg gtcactttca caatctgatc gcgttggaaa taaaagactg ctctcagtta 3660

cagaaggttt ttgcttttga atgtgaaact gatgacgatg atcaagaagg gattgttatg 3720

gatggagaaa aagtactact acgtaacctg ctacgtataa gactcagccg tttgccaaac 3780

ttcaaagaga ttcaccatgg attcaagtta aaagatgatg ttgaagaaca tatcataaat 3840

gattgtccta aatattatcc aagtttatat ctacacacag gtacaattct catgtccttt 3900

tactag 3906

<210> 3

<211> 28

<212> DNA

＜213〉artificial sequence

<400> 3

cggaattccg agcgacaagt catggtat 28

<210> 4

<211> 34

<212> DNA

＜213〉artificial sequence

<400> 4

tccccgcggg gatatgaggg gtgttagtgt ctga 34

Claims (5)

1. (aminoacid sequence that it is characterized in that this albumen is as described in the SEQ ID NO. 1 for Soybean Mosaic Virus, albumen SMV) for Chinese People's Anti-Japanese Military and Political College's bean mosaic virus in the soybean.

2. (nucleotide sequence that it is characterized in that this gene is as described in the SEQ ID NO. 2 for Soybean Mosaic Virus, SMV) the gene Rsv3C of albumen for Chinese People's Anti-Japanese Military and Political College's bean mosaic virus in the coding claim 1 described soybean.

3. the recombinant plasmid that comprises the described nucleotide sequence of claim 2.

4. the host bacterium that comprises the described recombinant plasmid of claim 3.

5. (Soybean Mosaic Virus, albumen SMV) is being cultivated the Chinese People's Anti-Japanese Military and Political College bean mosaic virus (Soybean Mosaic Virus, SMV) application in the soybean to the described Chinese People's Anti-Japanese Military and Political College of claim 1 bean mosaic virus.

Images