CN104404147A - Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice - Google Patents
Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice Download PDFInfo
- Publication number
- CN104404147A CN104404147A CN201410693230.0A CN201410693230A CN104404147A CN 104404147 A CN104404147 A CN 104404147A CN 201410693230 A CN201410693230 A CN 201410693230A CN 104404147 A CN104404147 A CN 104404147A
- Authority
- CN
- China
- Prior art keywords
- seq
- series
- hybrid rice
- sterile line
- sequence table
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice. The specific primer combination comprises ZJJU01, ZJJU02, ZJJU03 and ZJJU04, the nucleotide sequences of which are as shown in SEQ ID NO.1-8. The invention further provides a method of utilizing the primer combination to identify the sterile line Jun 1A of the three-line hybrid rice. The method comprises the following steps: firstly extracting a targeted plant genome, using the genome as a template, and using the specific primer combination claimed in the claim 1 to perform PCR (Polymerase Chain Reaction). The primer disclosed by the invention is designed according to the ISSR (Inter-simple Sequence Repeat) primer amplification sequence capable of identifying the sterile line Jun 1A of the three-line hybrid rice, and can be used for quickly identifying the sterile line Jun 1A of the three-line hybric rice from rice varieties through PCR amplification. The method for identifying the sterile Jun 1A of the three-line hybrid rice provided by the invention can be used for purity identification of the rice variety, and further can be applied to assist breeding the rice variety.
Description
Technical field
The present invention relates to technical field of biological, particularly a kind of Specific primer pair for detecting series of three-series hybrid rice sterile line fine horse 1A.
Background technology
China is hybrid rice seeds producing country maximum in the world and country of consumption, has huge hybrid rice seeds market.Current domestic hybrid rice Annual planting area accounts for more than 59% of paddy rice year total cultivated area, and rice yield is increased substantially, for ensureing that the grain security of China has made significant contribution.Obtaining highly purified cenospecies is the basis giving full play to hybrid vigour yield potential.Mechanical admixture and biology hybrid are the main sources of series of three-series hybrid rice parent hybrid strain.Seed purity weighs the leading indicator of Seed Quality of Hybrid Rice, and the lower general who has surrendered of purity causes the obvious reduction of crop yield and quality.The hybrid rice seeds of low-purity, verity difference brings extreme loss to agriculture production, is seed quality testing department, breeding research unit, production of hybrid seeds unit and seeds company's questions of common interest.The purity of series of three-series hybrid rice sterile line is the key factor of restriction Cross-incompatibility groups.
Series of three-series hybrid rice sterile line " fine horse 1A " is independently cultivated for the applicant, rice varieties " fine horse excellent 172 " in the triple crossing that sterile line " fine horse 1A " and restorer " R0172 " combo are bred as, and rice varieties " fine horse excellent 522 " in the triple crossing precocity that is bred as of sterile line " fine horse 1A " and restorer " R522 " combo, all by Hubei Province's variety certification, blast resisting, rice is of fine quality, is the new crop varieties of applicable Enshi State of Hubei Province plantation.
State in realization in the process of research and development, present inventor finds that prior art at least exists following problem:
Do not identify the special primer of series of three-series hybrid rice sterile line " fine horse 1A ", above-mentioned rice varieties and its parent cannot be distinguished, the work such as seed purity molecular markers for identification and relevant molecular mark fast can not be carried out to it.
Summary of the invention
The invention provides a kind of Specific primer pair for the identification of series of three-series hybrid rice sterile line fine horse 1A, solve the problem in background technology, adopt this combination of primers to identify series of three-series hybrid rice sterile line fine horse 1A fast and accurately.
Realizing the technical scheme that above-mentioned purpose of the present invention adopts is:
For the identification of a Specific primer pair of series of three-series hybrid rice sterile line fine horse 1A, comprise ZJJU01, ZJJU02, ZJJU03 and ZJJU04, wherein ZJJU01 forward primer is as SEQ ID NO.1:GAGAGAGAGAGAGAGACACTATTAACG in sequence table;
ZJJU 01 reverse primer is as SEQ ID NO.2:GAGAGAGAGAGAGAGACGGAGG in sequence table;
ZJJU 02 forward primer is as SEQ ID NO.3:TCTCTCTCTCTCTCTCAAACAGAA in sequence table;
ZJJU 02 reverse primer is as SEQ ID NO.4:CTCTCTCTCTCTCTCACTGTCG in sequence table;
ZJJU 03 forward primer is as SEQ ID NO.5:TCAGTAGCTGTGTCTCAGAACTATGAC in sequence table;
ZJJU 03 reverse primer is as SEQ ID NO.6:GTACCTCTTTTCGGCCAGGA in sequence table;
ZJJU 04 forward primer is as SEQ ID NO.7:GGATAATCCGCATCAAGAAG in sequence table;
ZJJU 04 reverse primer is as SEQ ID NO.8:GGTCACCCGAGAATTGCAT in sequence table.
The present invention additionally provides the method according to above-mentioned primer sets incompatible qualification series of three-series hybrid rice sterile line fine horse 1A simultaneously, step is as follows: first extract target plant genome, then take genome as template, carry out PCR detection with Specific primer pair according to claim 1.
Described PCR reaction conditions is: 95 DEG C of 5min; 95 DEG C of sex change 30s, 65 DEG C of annealing 40s, wherein each circulation reductions by 0.7 DEG C, 72 DEG C extend 1min30s, 15 circulations;
94 DEG C of sex change 30s, 55 DEG C of annealing 45s, 72 DEG C extend 2min, 25 circulations; 10min is extended after 72 DEG C.
Described PCR reaction system is: the DNA profiling 0.8 μ l of 50ng/ μ l, 10 × PCR damping fluid 1 μ l, 2.5mMdNTPs 0.8 μ l, 10 μMs of each 0.2 μ l of forward and reverse primer, archaeal dna polymerase 0.5U, ddH
2o complements to 10 μ l.
Present invention also offers a kind of detection kit containing above-mentioned Specific primer pair.
Mentioned reagent box can be applied in the purity of qualification series of three-series hybrid rice sterile line fine horse 1A and its breeding auxiliary.
The present invention, according to the ISSR primer amplification primers identifying series of three-series hybrid rice sterile line fine horse 1A, by pcr amplification, can identify series of three-series hybrid rice sterile line fine horse 1A fast from other rice varieties.The authentication method of series of three-series hybrid rice sterile line fine horse 1A provided by the invention, can be used for the Purity of above-mentioned rice varieties, and then applies in its breeding auxiliary.
Accompanying drawing explanation
Fig. 1 is by the amplification figure A of PCR reaction in paddy rice in the present embodiment
Fig. 2 is by the amplification figure B of PCR reaction in paddy rice in the present embodiment.
Embodiment
Below in conjunction with accompanying drawing and specific embodiment, detailed specific description is done to the present invention, but protection scope of the present invention is not limited to following examples.
The experimental technique of unreceipted actual conditions in following examples, usual conveniently condition, " molecular cloning: laboratory manual " (New York:Cold Spring Harbor Laboratory Press of such as Sambrook etc., 2001) condition described in, or according to the condition that instrument or reagent manufacturer advise.Agents useful for same is commercial goods.
The Specific primer pair for the identification of series of three-series hybrid rice sterile line fine horse 1A that the present embodiment provides, comprise ZJJU01, ZJJU02, ZJJU03 and ZJJU04, wherein ZJJU01 forward primer is as SEQ ID NO.1:GAGAGAGAGAGAGAGACACTATTAACG in sequence table;
ZJJU 01 reverse primer is as SEQ ID NO.2:GAGAGAGAGAGAGAGACGGAGG in sequence table;
ZJJU 02 forward primer is as SEQ ID NO.3:TCTCTCTCTCTCTCTCAAACAGAA in sequence table;
ZJJU 02 reverse primer is as SEQ ID NO.4:CTCTCTCTCTCTCTCACTGTCG in sequence table;
ZJJU 03 forward primer is as SEQ ID NO.5:TCAGTAGCTGTGTCTCAGAACTATGAC in sequence table;
ZJJU 03 reverse primer is as SEQ ID NO.6:GTACCTCTTTTCGGCCAGGA in sequence table;
ZJJU 04 forward primer is as SEQ ID NO.7:GGATAATCCGCATCAAGAAG in sequence table;
ZJJU 04 reverse primer is as SEQ ID NO.8:GGTCACCCGAGAATTGCAT in sequence table.
Adopt the method for above-mentioned primer sets incompatible qualification series of three-series hybrid rice sterile line fine horse 1A in the present embodiment, step is as follows:
1. experiment material
1.1 vegetable material
Middle fine horse excellent 1 and parent's sterile line 418A, maintenance line 418B and restorer R964, nine B in nine A and maintenance line in the similar origin sterile line of middle fine horse excellent 1; Fine horse excellent 522 and parent's sterile line fine horse 1A, maintenance line fine horse 1B and restorer R522, fine horse excellent 522 similar origin sterile line Fuyi No.A and her B of maintenance line good fortune.
1.2 enzymes and reagent
Molecular biology reagents, TAKARA rTaq archaeal dna polymerase, 10 × PCR damping fluid, dNTPMixture (2.5mM) is purchased from the precious biotech firm in Dalian.
Other biochemical reagents are import packing or domestic analytical pure.Primer is synthesized by Nanjing Genscript Biotechnology Co., Ltd..
1.3 laboratory apparatus
To vibrate broken instrument (Geno/grinder, USA);
PCR amplification instrument: PTC-100TM (MJ, USA);
Nucleic acid electrophoresis apparatus: DYYIII type YY0115-94 (Liuyi Instruments Plant, Beijing);
DNA electrophoretic analysis system: GeneSnap Labworks image acquisition and analysis software;
Other Instruments comprises: thermostat water bath, electronic balance, whizzer, vortex instrument, pure water instrument, constant incubator etc.
2. experimental technique
The extraction of 2.1 oryza sativa genomic dnas
Single-seed rice is planted, get young leaflet tablet as DNA extraction material, according to publishing with reference to CSH Press (Cold Spring Harbor Laboratory Press), " molecular cloning " that Nina Irwin and Kaaren A.Janssen writes one book extract the STb gene of rice material.
2.2PCR amplification
According to the special primer of ISSR primer amplification sequences Design identifying series of three-series hybrid rice sterile line fine horse 1A and combination thereof, utilizing this 4 pairs of combination of primers, is that template carries out pcr amplification with oryza sativa genomic dna.
PCR amplification system is: 10 × PCR damping fluid 1 μ l, 2.5mM dNTPs 0.6 μ l, 10 μMs of each 0.2 μ l of forward and reverse primer, and archaeal dna polymerase 0.5U, 50ng/ μ l DNA profiling 0.5 μ l, ddH 2O complements to 10 μ l.
Pcr amplification program: 95 DEG C of 5min; 95 DEG C of sex change 30s, 65 DEG C of annealing 40s, (wherein each circulation reduction by 0.7 DEG C) 72 DEG C extends 1min30s, 15 circulations; 94 DEG C of sex change 30s, 55 DEG C of annealing 45s, 72 DEG C extend 2min, 25 circulations; 10min is extended after 72 DEG C.
3. experimental result
Amplification is all negative control with sterilized water, only has when negative control amplification is without any banding pattern, then explanation PCR reliable results.The amplified band of the detected material of statistics, feminine gender counts 0, and the positive counts 1.Statistics and cluster analysis result are as shown in following table and Fig. 1 and Fig. 2.Result shows, series of three-series hybrid rice sterile line fine horse 1A can separate with its combination region by 4 pairs of molecule markers combination of the present invention.
The 4 pairs of molecule marker combination of primers increase the finger printing statistics of 2 series of three-series hybrid rice combinations
Claims (6)
1. the Specific primer pair for the identification of series of three-series hybrid rice sterile line fine horse 1A, it is characterized in that: comprise ZJJU01, ZJJU02, ZJJU03 and ZJJU04, wherein ZJJU01 forward primer is as SEQ ID NO.1:GAGAGAGAGAGAGAGACACTATTAACG in sequence table;
ZJJU 01 reverse primer is as SEQ ID NO.2:GAGAGAGAGAGAGAGACGGAGG in sequence table;
ZJJU 02 forward primer is as SEQ ID NO.3:TCTCTCTCTCTCTCTCAAACAGAA in sequence table;
ZJJU 02 reverse primer is as SEQ ID NO.4:CTCTCTCTCTCTCTCACTGTCG in sequence table;
ZJJU 03 forward primer is as SEQ ID NO.5:TCAGTAGCTGTGTCTCAGAACTATGAC in sequence table; ZJJU 03 reverse primer is as SEQ ID NO.6:GTACCTCTTTTCGGCCAGGA in sequence table;
ZJJU 04 forward primer is as SEQ ID NO.7:GGATAATCCGCATCAAGAAG in sequence table;
ZJJU 04 reverse primer is as SEQ ID NO.8:GGTCACCCGAGAATTGCAT in sequence table.
2. the method based on the qualification series of three-series hybrid rice sterile line fine horse 1A of combination of primers according to claim 1, it is characterized in that step is as follows: first extract target plant genome, then take genome as template, carry out PCR detection with Specific primer pair according to claim 1.
3. the method for qualification series of three-series hybrid rice sterile line fine horse 1A according to claim 2, is characterized in that: described PCR reaction conditions is: 95 DEG C of 5min; 95 DEG C of sex change 30s, 65 DEG C of annealing 40s, wherein each circulation reductions by 0.7 DEG C, 72 DEG C extend 1min30s, 15 circulations;
94 DEG C of sex change 30s, 55 DEG C of annealing 45s, 72 DEG C extend 2min, 25 circulations; 10min is extended after 72 DEG C.
4. the method for the qualification series of three-series hybrid rice sterile line fine horse 1A according to Claims 2 or 3, it is characterized in that: described PCR reaction system is: the DNA profiling 0.8 μ l of 50ng/ μ l, 10 × PCR damping fluid 1 μ l, 2.5mM dNTPs0.8 μ l, 10 μMs of each 0.2 μ l of forward and reverse primer, archaeal dna polymerase 0.5U, ddH
2o complements to 10 μ l.
5. the detection kit containing Specific primer pair described in claim 1.
6. the application of test kit described in claim 5 in the purity and its breeding auxiliary of qualification series of three-series hybrid rice sterile line fine horse 1A.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410693230.0A CN104404147B (en) | 2014-11-26 | 2014-11-26 | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410693230.0A CN104404147B (en) | 2014-11-26 | 2014-11-26 | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404147A true CN104404147A (en) | 2015-03-11 |
| CN104404147B CN104404147B (en) | 2017-02-22 |
Family
ID=52641810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410693230.0A Expired - Fee Related CN104404147B (en) | 2014-11-26 | 2014-11-26 | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404147B (en) |
-
2014
- 2014-11-26 CN CN201410693230.0A patent/CN104404147B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 黄光文等: "运用ISSR标记鉴别水稻品种的初步研究", 《杂交水稻》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404147B (en) | 2017-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lu et al. | Cultivar identification and genetic diversity analysis of broccoli and its related species with RAPD and ISSR markers | |
| CN102154459B (en) | Inter-simple sequence repeat ISSR-SCAR marker specific to E-group chromosomes of agropyron elongatum | |
| CN103361425B (en) | Primer and method for identifying purity of cucumber 'Yuexiu No.3' hybrid seed | |
| CN103993074B (en) | The molecule marker of Xanthomonas oryzae pv oryzae and application thereof | |
| CN103194539B (en) | Method for identifying ramie variety by simple sequence repeat (SSR) molecular marker | |
| CN107630103B (en) | CAPS molecular marker method for identifying rice varieties and application | |
| Sun et al. | A simple and rapid technique for the authentication of the ginseng cultivar, Yunpoong, using an SNP marker in a large sample of ginseng leaves | |
| CN109234423B (en) | Application of soybean molecular marker and polymorphism thereof in identification of soybean branch number traits | |
| CN105713990A (en) | Wheat molecular marker and application thereof in identifying wheat yield related traits | |
| CN103276054B (en) | Primer for auxiliary detection of soybean hundred-grain weight, and detection method thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN102127597B (en) | Specific RAPD-SCAR (Random Amplified Polymorphic DNA-Sequence Characterized Amplified Region) molecular marker for E group chromosome of elytrigia elongata | |
| CN101880725B (en) | Polymerase chain reaction (PCR) detection method for trans-cry2A-genic rice line T2A-1 and application thereof | |
| CN101974618B (en) | Transformant specific polymerase chain reaction (PCR) detection method for transgenic rice strain T1c-19 with cry1C gene | |
| Arya et al. | Diagnostic set of microsatellite markers for hybrid purity testing and molecular identification of hybrids and parental lines in sorghum | |
| CN104357576B (en) | A kind of Specific primer pair identifying rice varieties fine horse excellent 522 and parent thereof | |
| CN104404156B (en) | Rapid identification molecular marker of self-compatible variety of loquat, marker primer and identification method | |
| CN115786559B (en) | Indel marker of maize drought response gene miR528b promoter and application thereof | |
| CN106755558B (en) | A set of primer special and its application for willow excellent variety Genetic identification | |
| CN104404147B (en) | Specific primer combination for identifying sterile line Jun 1A of three-line hybrid rice | |
| Tidke et al. | Analysis of genetic diversity of 12 genotypes of Glycine max by using RAPD marker | |
| CN102618534A (en) | Functional specific molecular marker PikFNP for resistance genes Pik of rice blast and method and application of functional specific molecular marker PikFNP | |
| CN105671180A (en) | Related gene causing increase of grain weights of wheat and application of related gene | |
| CĂPRAR et al. | Evaluation of genetic diversity by DNA barcoding of local tomato populations from North-Western Romania | |
| Tan et al. | Resequencing and nucleotide variation of Sucrose Synthase (SuSy) gene in a tropical timber tree Neolamarckia macrophylla |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170222 Termination date: 20201126 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |