CN104357345A - Strain with antagonistic effect on various new anthracnose pathogens of camellia oleifera and application method of strain - Google Patents
Strain with antagonistic effect on various new anthracnose pathogens of camellia oleifera and application method of strain Download PDFInfo
- Publication number
- CN104357345A CN104357345A CN201410427200.5A CN201410427200A CN104357345A CN 104357345 A CN104357345 A CN 104357345A CN 201410427200 A CN201410427200 A CN 201410427200A CN 104357345 A CN104357345 A CN 104357345A
- Authority
- CN
- China
- Prior art keywords
- strain
- oil tea
- colletotrichum
- bacterial strain
- anthracnose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Environmental Sciences (AREA)
- Pest Control & Pesticides (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Dentistry (AREA)
- Biomedical Technology (AREA)
- Plant Pathology (AREA)
- Agronomy & Crop Science (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a strain with an antagonistic effect on various new anthracnose pathogens of camellia oleifera and an application method of the strain. An endophytic antagonistic strain with a strong inhibition effect on six new anthracnose pathogens of the camellia oleifera and one reported anthracnose pathogens of the camellia oleifera is separated and screened from the healthy camellia oleifera, so that a fine strain is provided for pointedly preventing and controlling the anthracnose pathogens of the camellia oleifera by antagonistic bacteria; the newly screened endophytic antagonistic strain is capable of continuously and efficiently controlling various camellia oleifera anthracnoses, cannot pollute the environment, guarantees the camellia oleifera to be safe, and has remarkable economic, social and ecological benefits.
Description
Technical field
The invention belongs to oil tea biological control of diseases technical field, be specifically related to bacterial strain and the application method thereof of the multiple subcutaneous ulcer cause of disease of a kind of antagonism control oil tea charcoal.
Background technology
Oil tea (Camellia oleifera) is China distinctive woody edible oil material seeds, and one of large woody oil tree species in the Yi Shi world four, oneself has the cultivation of more than 2000 year and utilizes history.In tea oil, unsaturated fatty acid content is high, can reduce blood fat, liver fat, prevent thrombosis, have good prophylactic effect to coronary heart disease and atherosclerosis.The main integrated distribution of oil tea in Hunan, Jiangxi and Guangxi, wherein Hunan Province is the maximum oil tea place of production of China and maximum tea oil consumption area.But in actual production, the production of oil tea and health management have been subject to having a strong impact on of multiple diseases.
One of the Major Diseases in Oil Tea Anthracnose China oil tea producing region, often cause serious shedding, bud drop, fallen leaves, branch withered, even whole strain decline, causes heavy economic losses.The fruit drop rate that causes of disease is usually at 20%-40% thus, reaches more than 60% time serious.Though late period, sick fruit can be gathered, seed oil content greatly reduces.Oil tea produces upper once there is this disease, will cause serious financial loss.At present, domestic scholars thinks that Oil Tea Anthracnose is caused by colletotrichum gloeosporioides Penz (Colletotrichum gloeosporioides Penz.).We are by pathogenicbacteria separation, Pathogenicity, and combining form characteristic sum polygene Molecular Identification, find except colletotrichum gloeosporioides Penz, also have other 6 kinds of new cause of diseases also can cause serious Oil Tea Anthracnose, these cause of diseases are Colletotrichumfructicola, Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1, Colletotrichumsp.2, Glomerella cingulata.The techniques and methods of current control Oil Tea Anthracnose is all almost for colletotrichum gloeosporioides Penz (Colletotrichum gloeosporioides Penz.) this kind of cause of disease, the Oil Tea Anthracnose that have ignored other is former, thus cause when the practical application of Stand control Oil Tea Anthracnose, poor effect, causes the waste of great human and financial resources.At present, without any except for the relation technological researching of other cause of disease of control Oil Tea Anthracnose except colletotrichum gloeosporioides Penz (Colletotrichum gloeosporioides Penz.) and report.
Therefore, strengthen, to the research dynamics of Oil Tea Anthracnose, improving the Prevention Technique to the multiple anthrax of oil tea, particularly biological prevention, become the task of top priority that oil tea produces.Compared with chemical pesticide control, the control of application antagonistic microbe is not only effective to the germ disease of sensitivity, and the germ disease developed immunity to drugs to oneself is also effective.The separation of effective antagonistic microbe obtains, and has further promoted the exploitation of these bacterial classifications, thus has improve effective control of Plant diseases.If can be the angle of main pathogenic from which pathogenic bacteria, filter out the microorganism of antagonism pathogenic bacteria targetedly, positive effect will be had to the control of Oil Tea Anthracnose.
Summary of the invention
The object of this invention is to provide bacterial strain and the application method thereof of the multiple new anthrax of a kind of antagonism control oil tea, this bacterial strain can be good at several newfound pathogenic bacterium that antagonism suppresses to cause Oil Tea Anthracnose, prevention effect will be got well compared to the antagonistic strain of the control Oil Tea Anthracnose of having reported for work, and restraining effect can be played to 7 kinds of anthrax pathogenic bacterias simultaneously, with strong points.
A bacterial strain for the new anthrax pathogenic bacteria of antagonism oil tea, described bacterial strain is Methylotrophic genus bacillus (Bacillusmethylotrophicus), and deposit number is CCTCC NO:M 2014386.
The application method of described bacterial strain, causes the mycelial growth of the pathogenic bacteria of Oil Tea Anthracnose for antagonism.Specifically cause 7 kinds of anthrax pathogenic bacterias of Oil Tea Anthracnose for antagonism: Colletotrichum fructicola, Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1, the mycelial growth of Colletotrichum sp.2, Glomerella cingulata and Colletotrichum gloeoporioide.
The application method of described bacterial strain, for suppressing the spore germination of the pathogenic bacteria causing Oil Tea Anthracnose.Specifically for suppressing the 7 kinds of anthrax pathogenic bacterias causing Oil Tea Anthracnose: Colletotrichum fructicola, Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1, the spore germination of Colletotrichum sp.2, Glomerella cingulata and Colletotrichum gloeoporioide.
The application method of described bacterial strain, for preventing and treating the anthrax of oil tea.
The present invention separates from oil tea healthy plant the antagonistic strain the main pathogenic fungi of Oil Tea Anthracnose being had to high inhibition effect, especially good antagonistic action is all had to 6 kinds of new Oil Tea Anthracnose pathogenic bacterias, the antimicrobial spectrum of raw antagonistic strain in Simultaneously test, prevents and treats Oil Tea Anthracnose research targetedly for utilizing antagonistic microbe and provides strain excellent.Antagonistic Fungi biological control continuous and effective controls Oil Tea Anthracnose, protects environment, ensures the safety of tea oil, has significant economy, Social Ecology benefit.
Methylotrophic genus bacillus of the present invention (Bacillus methylotrophicus) is preserved in China typical culture collection center on August 20th, 2014, deposit number is CCTCC NO:M2014386, and address is Luojiashan, Wuchang, Wuhan City, Hubei Province (Wuhan University).
Accompanying drawing explanation
The anthrax scab that Figure 1A causes on oil tea blade, C, D pure culture feature (PDA substratum, C is front, and D is reverse side) B conidium;
The anthrax scab that Fig. 2 A causes on oil tea blade, C, D pure culture feature (PDA substratum, C is front, and D is reverse side) B conidium;
The anthrax scab that Fig. 3 A causes on oil tea blade, C, D pure culture feature (PDA substratum, C is front, and D is reverse side) B conidium;
The anthrax scab that Fig. 4 A causes on oil tea blade, C, D pure culture feature (PDA substratum, C is front, and D is reverse side) B conidium;
The anthrax scab that Fig. 5 A causes on oil tea blade, C, D pure culture feature (PDA substratum, C is front, and D is reverse side) B conidium;
The anthrax scab that Fig. 6 A causes on oil tea blade, C, D pure culture feature (PDA substratum, C is front, and D is reverse side) B conidium;
The anthrax scab that Fig. 7 A causes on oil tea blade, C, D pure culture feature (PDA substratum, C is front, and D is reverse side) B conidium;
Fig. 8 builds Colletotrichum spp. phylogenetic tree according to ITS-CAL-GAPDH 3 gene collating sequence N-J method;
Fig. 9 is that 68 strain antagonistic strains are to the restraining effect of pathogenic bacteria Glomerella cingulata;
Figure 10 is that 68 strain antagonistic strains are to the restraining effect of pathogenic bacteria Colletotrichum sp.1;
Figure 11 is that 68 strain antagonistic strains are to the restraining effect of pathogenic bacteria Colletotrichum siamense;
Figure 12 is that 68 strain antagonistic strains are to the restraining effect of pathogenic bacteria Colletotrichum sp.2;
Figure 13 is that 68 strain antagonistic strains are to the restraining effect of pathogenic bacteria Colletotrichum karstii;
Figure 14 is that 68 strain antagonistic strains are to the restraining effect of pathogenic bacteria Colletotrichum fructicola;
Figure 15 is that 68 strain antagonistic strains are to the inhibition figure of pathogenic bacteria Colletotrichum gloeoporioide;
Figure 16 is that 68 strain endogenetic bacterias are to the restraining effect of 7 kinds of Anthracnose Pathogen bacterium;
Figure 17 is No. 49 antagonistic bacterium forms.
Embodiment
Be intended to further illustrate the present invention below in conjunction with embodiment, and unrestricted the present invention.
Embodiment 1: the Isolation and ldentification that Oil Tea Anthracnose is former
The separation and ientification of pathogenic bacteria
The sick leaf of oil tea picks up from Hunan, Jiangxi, Guangxi, Hainan, Fujian, Hubei and Chongqing.Adopt conventional separation technique, be good for intersection tissue from sick leaf disease and be separated, after pure growth slant culture, 4 DEG C of Refrigerator stores are for subsequent use.
Pathogens is observed
Observe colony characteristics, optical microphotograph Microscopic observation mycelia feature, conidium form, and measure its size.
Tieback is tested
To national Approved variety ' Hua Xin ' oil tea plants leaf, with 75% ethanol surface sterilization process, fine needle dips puncture Camellia Leaves after isolate spore suspension, compare (CK) with aqua sterilisa process, in vitro observes Occurrence and development of disease situation, and carries out germ to inoculation sequela leaf and be separated.
The polygenic pcr amplification of germ and sequential analysis
The extraction of pathogenic bacteria DNA
The extraction of pathogenic bacteria DNA.Isolated strains is inoculated on PDA flat board and activates, in 28 DEG C of incubators after dark culturing 6d, with the spoon of sterilizing, mycelia is scraped, take 0.5g in mortar, add 1mL lysate, 3/10 volume quartz sand, proceed in 1.5mL EP pipe after grinding fully, 65 DEG C of water-bath 10min, then add 600 μ L7.5mol/L NaCl solution, the centrifugal 5min of 13000r/min after ice bath 8min; Get 600 μ L supernatant liquors in a new EP pipe, add 400 μ L chloroforms: primary isoamyl alcohol (24:1), mixing; Get 500 μ L supernatants after stratification to another new EP pipe, add the dehydrated alcohol of 0.1 times of volume NaAc and 2 times volume, collect DNA after the centrifugal 8min of 14000g, wash DNA2 time with 70% ethanol; After ethanol volatilization, with 0.1 × TE dissolving DNA ,-20 DEG C of preservations.
Gene Selection and object fragment amplification and order-checking
The bacterial strain that we obtain all separation screenings, selects rrna transcribed spacer (ITS), glyceraldehyde 3-phosphate dehydro-genase gene (GAPDH) and Calmodulin gene (CAL) to carry out increasing and checks order.Corresponding pcr amplification primer is in table 1.PCR primer entrusts the order-checking of Shanghai Bo Shang Bioisystech Co., Ltd.
This test of table 1 the primer and annealing temperature list
Bacterial strain polygenic system is grown tree and is built
By 3 genes of each bacterial strain that order-checking obtains, each gene through Clustal W software comparison and after manual correction joins end to end respectively according to the order of ITS-CAL-GAPDH, and download in GenBank simultaneously containing ITS, carry out homology analysis after 3 genes also join end to end according to the order of ITS-CAL-GAPDH, build the N-J phylogenetic tree of all bacterial strains 3 assortments of genes with software MEGA4.0.
Results and analysis
Pathogenicbacteria separation and Pathogenicity
From Hunan, Jiangxi, Guangxi, Hainan, Fujian, Hubei and 7 provinces such as Chongqing oil tea producing region is separated, purifying obtains the strain of morphological specificity doubtful anthrax pathogenic bacteria 269, tested by tieback, we find that 35 fungal strains can cause the symptom of anthrax.These scabs are organized and again carries out pathogenicbacteria separation, obtain the bacterium colony consistent with former inoculating strain morphological specificity and conidium; Sterilized water (CK) process does not all find scab, is not separated to germ yet.Can determine thus, this 35 fungal strain that we are separated is the pathogenic bacteria causing Oil Tea Anthracnose.35 fungal strains, according to morphological feature, can be divided into 7 classes, and we represent with FA, FB, FC, FD, FE, FF, FG respectively.
(1) FF class bacterial strain
Conidium is straight, cylindric or fusiform, and the blunt circle in two ends is smooth, colourless, 13-17 μm (Fig. 1, B).
On PDA substratum, the speed of growth, 11.3-14.3mm/day, bacterium colony is light grey to Dark grey, circular, rule, and edge color is slightly shallow; Back side black, forms black concentricity (Fig. 1, C, D) sometimes.Conidium is straight, cylindric, the blunt circle in two ends, and monospore is smooth, colourless.
Bacterial strain research and host: strains separation is from the sick leaf of oil tea.Oil tea causes oval light brown pit, the sick strong water stain shape (Fig. 1, A) of intersection.Fig. 1, A are the anthrax scabs caused on oil tea excised leaf.
(2) FC class bacterial strain
On bacterium colony PDA substratum, the speed of growth, 11.2-13.3mm/day, bacterium colony is light grey, fine hair shape, neat in edge; The back side outwards gradually becomes Vandyke brown (Fig. 2, C, D) by thin rice gruel look from center.Conidium monospore, directly, cylindric, the blunt circle in two ends, colourless, smooth, 12-15 μm (Fig. 2, B).
Bacterial strain research and host: strains separation, from the sick leaf of oil tea, causes the light brown scab (Fig. 2, A) arriving brown ellipse or strip at blade edge or top.Fig. 2, A are the anthrax scabs caused on oil tea excised leaf.
(3) FK class bacterial strain
Conidium monospore, smooth, cylindric, base portion is truncate, the blunt circle in top, and base portion is wider, gradually thin to top, in taper.
On PDA, speed of growth 10.1-11.7mm/day, bacterium colony fine hair shape, neat in edge; Slightly be with yellow (Fig. 3, C, D) conidium monospore, directly, cylindric, colourless, 15-19 μm.Base portion is truncate, the blunt circle (Fig. 3, B) in top.
Bacterial strain research and host: strains separation, from the sick leaf of oil tea, blade causes the nearly oval scab (Fig. 3, A) of Vandyke brown.Fig. 3, A are the anthrax scabs caused on oil tea excised leaf.
(4) FG class bacterial strain
Conidium is straight, sometimes at middle part around contracting, the blunt circle in two ends, colourless 11-18 μm.
On PDA substratum, speed of growth 9.7-12.7mm/day, bacterium colony is various, light grey to Dark grey, fine hair shape, neat in edge; Back side thin rice gruel look to Vandyke brown, peripheral zone point yellow (Fig. 4, C, D).Conidium orange, conidium is cylindric, the blunt circle in two ends, smooth, has oily ball (Fig. 4, B).
Bacterial strain research and host: strains separation is from the sick leaf of oil tea, and hygrophanous subcircular scab, sink gradually, later stage browning look, has dispersion stain (piling blackening by conidium) (Fig. 4, A).Fig. 4, A are the anthrax scabs caused on oil tea excised leaf.
(5) FA class bacterial strain
The slightly narrow corynebacterium in conidium oblong or one end, colourless, unit cell, yardstick is 13-17 μm (Fig. 5, B).
On PDA substratum, speed of growth 9.9-12.9mm/day, bacterium colony grey, aerial hyphae is rare, is close to substratum, neat in edge, back side black slightly green (Fig. 5, C, D).Conidium is straight, cylindric or fusiform, the blunt circle in two ends, smooth, colourless (Fig. 5, B).
Bacterial strain research and host: strains separation is from the sick leaf of oil tea, and scab tawny on leaf, edge sorrel, has orange viscous substance above, i.e. germ conidium (Fig. 5, A).Produce sorrel fusiformis streak, rear expansion browning after the morbidity of children's basal part of stem, slightly depression, scab has orange goo.Fig. 5, A are the anthrax scabs caused on oil tea excised leaf.
(6) FB class bacterial strain
Conidium, monospore, colourless, smooth, two terminal circle length 13-19 μm (Fig. 6, B).
On PDA substratum, speed of growth 9.9-16.4mm/day, bacteria colony white is to grey, flat, neat in edge; In the middle of the back side, black outwards somewhat light yellow (Fig. 6, C, D).
Bacterial strain research and host: strains separation, in the sick leaf of oil tea, produces brown circle, oval scab (Fig. 6, A) at blade proximal edge place or nearly blade tip place.Fig. 6, A are the anthrax scabs caused on oil tea excised leaf.
(7) FD class bacterial strain
Conidium, monospore, colourless, smooth, two terminal circle length 12-18 μm (Fig. 7, B).
On PDA substratum, growth is comparatively slow, 2.4-5.7mm/day bacterium colony fine hair shape, grey, and circular, the back side is light brown to black (Fig. 7, C, D).
Bacterial strain research and host: strains separation, in the sick leaf of oil tea, forms light brown subcircular or bar shaped scab (Fig. 7, A).Fig. 7, A are the anthrax scabs caused on oil tea excised leaf.
Bacterial strain polygenic system developmental analysis
35 pathogenic strains belong to other kind of bacterial strain with the anthrax downloaded from Genbank and (splice ITS, CAL and GAPDH3 gene order) build phylogenetic tree (Fig. 8) display, 35 bacterial strain copolymerization are 7 branches: wherein, Ith has 10 FF class bacterial strains and all C.fructicola participating in analyzing to gather is one, IIth has 1 FD class bacterial strain and C.alienum to gather is one, but supporting rate is not high, title is fixed tentatively as Colletotrichum sp.2, IIIth has 10 FC class bacterial strains and C.siamense to gather is one, IVth has 5 FG class bacterial strains and C.gloeosporioides to gather is one, Vth has 4 FB class bacterial strains not gather with other bacterial strain is one, suspected of a novel species, title is fixed tentatively as Colletotrichum sp.1, VIth has 4 FA class bacterial strains and Glomerella cingulata to gather is one, VIIth has 1 FE class bacterial strain and C.karstii to gather is one.In polygenic system tree, 7 branch's bacterial strains can belong to other kinds with anthrax and well distinguish.According to the morphological feature of each bacterial strain, consult Fungal identification handbook, tree is grown in conjunction with polygenic system, we identify that be separated to pathogenic bacteria has 6 oil tea New Records: C.fructicola, C.siamense, C.karstii, Colletotrichum sp.1, Colletotrichum sp.2, Glomerellacingulata and 1 report kind: C.gloeosporioides.
Embodiment 2: antagonistic bacterium is separated, screening
Parting material: from Liuyang oil tea Demonstration Base, the blade choosing C. olelfera healthy plant carries out the separation of endophyte.
For examination endogenetic bacteria: obtained by susceptible oil tea blade separation screening.
For examination pathogenic bacteria: 7 kinds of oily Anthracnose Pathogen bacterium, embodiment 1 is separated, identifies acquisition.
For examination substratum:
PDA: glucose 20.0g, potato 200.0g, agar 18.0g, distilled water 1000ml;
NB: extractum carnis 3.0g, peptone 10.0g, sodium-chlor 5g, distilled water 1000ml, pH7.2-7.4.
The isolation and purification of endogenetic bacteria:
Random selecting 20 tea oil trees from the oil tea demonstration test base of liuyang hunan, every tree gets 10 oil tea blades, loads in bag, mark time, place.Suitable healthy oil tealeaves tissue is chosen after the oil tea seedling leaf tap water adopted back is clean, cut into the bar shaped of 3cm, 15s is soaked in 75% ethanol, then aseptic water washing 30s is used, repeat flushing 3 times, being finally cut into size is the square of about 6mm, is placed in PDA substratum under aseptic technique, last numbering one by one also cultivates 3-7d, in order to purifying in incubator.
When the microbial culture be separated is after certain hour, a little with inoculating needle picking, and aseptically adopt method of scoring to be inoculated on PDA substratum, be placed in incubator and cultivate, to reach the object of purifying.
Dull and stereotyped face-off method screening:
Adopting dull and stereotyped face-off method to screen being separated raw Antagonistic Fungi in the oil tea seedling that obtains, obtaining resistant strain.Be that the Oil Tea Anthracnose pathogenic bacteria bacterium cake of 6mm is aseptically placed in the dull and stereotyped central authorities of PDA by diameter, then tested bacteria is dipped with toothpick, equidistant point connects 4 kinds of endogenetic bacterias, be placed in incubator 28 DEG C cultivation, after 5 days observed and recorded inhibition zone size and with or without, repeat 3 times, 6 bacterial strains selecting fungistatic effect best carry out multiple sieve.
The mensuration of interior raw antagonistic strain antimicrobial spectrum:
Dull and stereotyped face-off method is adopted to measure antagonistic strain to the antagonistic action of 7 kinds of pathogenic bacterias: the pathogenic bacteria that 7 kinds activate is cut into the square of 0.5cm, the dull and stereotyped central authorities of PDA are seeded in respectively under aseptic condition, surrounding inoculates the antagonistic bacterium of separation and purification apart from pathogenic bacteria 2cm place, every ware connects four kinds, often process and repeat for 3 times, be placed in dark culturing in incubator, every day observes, and measures the size of inhibition zone.
Results and analysis
The isolation and purification of Endophytic antagonistic bacteria
According to single colonial morphology, size, color, smooth surface degree, from the bacterium that all separation obtain, separation, purifying obtain 68 strain endogenetic bacterias (see table 2), and strain number is followed successively by No. 1-No. 70 (No. 21 and No. 53 is mistake numbering).As can be seen from the table, isolate host tree totally 5 strains of effective antagonistic bacterium, account for 25% of sum, separation of bacterial quantity is lower, and bacterial number obvious difference, No. 4 tea oil trees have isolated 32 strain bacteriums, and No. 2 tea oil trees have only been separated to 1 strain bacterium.Illustrate that the tea oil tree surely having grown Endophytic antagonistic bacteria in current camellia oleifera lam only accounts for sub-fraction, do not have Endophytic antagonistic bacteria in most tea oil tree, this may be one of major reason of Oil Tea Anthracnose generation.
The separation of endogenetic bacteria in table 2 Camellia Leaves
Interior raw antagonistic strain antimicrobial spectrum measures
With 7 kinds of Oil Tea Anthracnose bacterium C.fructicola, C.siamense, C.karstii, C.gloeoporioide, Glomerellacingulata, Colletotrichum sp.1 and Colletotrichum sp.2 various pathogenic bacteria for indicator, dull and stereotyped face-off method is adopted to measure the bacteriostatic action of 68 bacterial strains (see Fig. 9-15; Figure 16).6 antagonistic bacteriums such as can be seen from the figure No. 5, No. 8, No. 38, No. 48, No. 49, No. 65 all have stronger restraining effect to all 7 kinds of germs, account for 8.82% of bacterial strain sum; Wherein No. 49 bacterium antagonistic activities are the strongest, are all greater than 7mm to the antibacterial bandwidth of 7 kinds of Oil Tea Anthracnose bacterium, illustrate that this bacterium can be used for control by these 7 kinds of microbial Oil Tea Anthracnoses of cause of disease.
The restraining effect that embodiment 3:49 antagonistic bacterium is sprouted oil tea 7 kinds of anthrax protospores
Adopt slide glass sessile drop method.After Oil Tea Anthracnose germ is cultivated 10d in (22 DEG C) incubator on PDA flat board, transfer to transfering loop picking sorus and fill in the test tube of aqua sterilisa, after concussion shakes up, be made into spore suspension (5 × 10
8individual/mL), for subsequent use.Get 100uL spore suspension, mix respectively with 100uL fermenation raw liquid with by dilution 10 times, the fermented liquid of 100 times and 100uL ferment filtrate, be added drop-wise on depression slide, to drip sterilized water for contrast.Often process repetition 3 times, be placed in 28 DEG C of incubators and cultivate, microscopy spore germination situation after 48h, calculate spore germination rate.As seen from the results in Table 3, the growth of fermenation raw liquid to 7 kinds of conidial sproutings of anthrax bacteria and germ tube of No. 49 bacterial strains has obvious restraining effect, wherein to the inhibiting rate of spore germination between 95.8%-95.2%, fermented liquid is diluted rear inhibition to be reduced gradually.No. 49 strain fermentation filtrates are also fairly obvious to the inhibition of spore germination, and inhibition of germination is between 89.7%-90.3%, and result shows, bacterial strain may create in fermentation culture process has inhibiting meta-bolites to anthrax bacteria.
Table 3 endophytic bacterial controlled effect nutrient solution is on the impact of anthrax bacteria conidia germination
Embodiment 4:49 antagonistic bacterium Analysis and Identification
Morphological Identification
Colonial morphology: No. 49 bacterial strains are on culture medium flat plate, and 30 DEG C of cultivations, bacterium colony surface folding, bacterium colony propagation rate is very fast, and be creamy white, initial stage edge is wavy, and central uplift is opaque, not chromogenesis (see Figure 17).
Thalli morphology: it is shaft-like for observing thalline under opticmicroscope, Gram-positive, produces gemma, middle life, gemma ellipse (see Figure 17).
Genomic dna test kit (Beijing hundred Tyke Bioisystech Co., Ltd) extracts.16S rDNA universal primer designs: 16SL:5'AGAGTTTGATCCTGGCTCAG3', 16SR:5'ACGGCTACCTTGTTACGACT3'.PCR reaction system (50 μ L): DNA1.5 μ g, primer each 1.5 μ L, dNTP4 μ L, 10 × Buffer5.0 μ L, Taq enzyme 0.5 μ L, ddH2O36 μ L.Amplification program is 95 DEG C of denaturation 4min, 30 circulations (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 90s), and 72 DEG C extend 10min.4 DEG C of preservations.PCR order-checking is completed by Beijing Bo Maide biotechnology limited liability company.Bacterial strain 16SrDNA sequence is carried out Blast compare of analysis in http://www.ncbi.nlm.nlh.gov website, carries out highest homology with the bacterial strain of 16S rDNA known in GenBank and compare.
Searched for by Blast homology, find that the Bacillus methylotrophicus homology in No. 49 bacterial strains and Genbank is 100%, combining form feature, we identify that No. 49 Endophytic antagonistic bacterias are Bacillus methylotrophicus, that is: Methylotrophic genus bacillus.
The present invention is divided into from obtaining 68 strain endogenetic bacterias from oil tea infected leaves, through flat board face-off screening, obtains bacterial strain 1 strain 7 kinds of Oil Tea Anthracnose germs being had to strong antagonistic effect.By cultivating shape, morphologic observation and Molecular Identification etc., identify that this bacterium is Methylotrophic genus bacillus, result of study is that the multiple anthrax pathogenic bacteria of biological control oil tea provides strain excellent.
Claims (6)
1. a bacterial strain for the new anthrax pathogenic bacteria of antagonism oil tea, is characterized in that, described bacterial strain is Methylotrophic genus bacillus (Bacillus methylotrophicus), and deposit number is CCTCC NO:M 2014386.
2. the application method of bacterial strain according to claim 1, is characterized in that, causes the mycelial growth of the pathogenic bacteria of Oil Tea Anthracnose for antagonism.
3. the application method of bacterial strain according to claim 2, it is characterized in that, 7 kinds of anthrax pathogenic bacterias of Oil Tea Anthracnose are caused: Colletotrichum fructicola for antagonism, Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1, Colletotrichum sp.2, the mycelial growth of Glomerella cingulata and Colletotrichumgloeoporioide.
4. the application method of bacterial strain according to claim 1, is characterized in that, for suppressing the spore germination of the pathogenic bacteria causing Oil Tea Anthracnose.
5. the application method of bacterial strain according to claim 4, it is characterized in that, for suppressing the 7 kinds of anthrax pathogenic bacterias causing Oil Tea Anthracnose: Colletotrichum fructicola, Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1, Colletotrichum sp.2, the spore germination of Glomerella cingulata and Colletotrichumgloeoporioide.
6. the application method of bacterial strain according to claim 1, is characterized in that, for preventing and treating the anthrax of oil tea.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410427200.5A CN104357345B (en) | 2014-08-27 | 2014-08-27 | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410427200.5A CN104357345B (en) | 2014-08-27 | 2014-08-27 | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104357345A true CN104357345A (en) | 2015-02-18 |
| CN104357345B CN104357345B (en) | 2016-08-17 |
Family
ID=52524659
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410427200.5A Active CN104357345B (en) | 2014-08-27 | 2014-08-27 | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104357345B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108085269A (en) * | 2017-11-23 | 2018-05-29 | 中国农业科学院麻类研究所 | Methylotrophic Bacillus strain IBFCBF-2 and its application |
| CN112029665A (en) * | 2020-08-03 | 2020-12-04 | 中国热带农业科学院环境与植物保护研究所 | Rubber tree colletotrichum resistant strain HcgHNQZ1736 and application thereof in drug resistance research |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130096870A (en) * | 2012-02-23 | 2013-09-02 | 이기성 | Novel antifungal bacterium bacillus methylotrophicus lks26 |
| CN103074272A (en) * | 2012-12-17 | 2013-05-01 | 漳州三炬生物科技有限公司 | Bacillus methylotrophicus Sanju-04 and its application |
| CN103805534B (en) * | 2013-11-28 | 2016-07-06 | 中国农业科学院农业资源与农业区划研究所 | A kind of Methylotrophic bacillus and microbial bacterial agent and their application |
-
2014
- 2014-08-27 CN CN201410427200.5A patent/CN104357345B/en active Active
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108085269A (en) * | 2017-11-23 | 2018-05-29 | 中国农业科学院麻类研究所 | Methylotrophic Bacillus strain IBFCBF-2 and its application |
| CN112029665A (en) * | 2020-08-03 | 2020-12-04 | 中国热带农业科学院环境与植物保护研究所 | Rubber tree colletotrichum resistant strain HcgHNQZ1736 and application thereof in drug resistance research |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104357345B (en) | 2016-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103695356B (en) | A kind of bacillus amyloliquefaciens and microbiobacterial agent and application thereof | |
| CN103215210B (en) | Bacillus siamensis and application of bacillus siamensis in preparation of microbial seaweed fertilizer | |
| CN103981102B (en) | DSE bacterial strain 24L-4 and the application on Herba Dendrobii is produced thereof | |
| CN102329756B (en) | Streptomyces albospinus strain BWL15-4 for preventing and treating banana vascular wilt and application thereof | |
| CN107058160B (en) | One plant of peanut rhizosphere bacillus amyloliquefaciens and its application | |
| CN105543132A (en) | Bacillus methylotrophicus YB-F7 and application thereof in preventing plant diseases | |
| CN101935616A (en) | Rhododendron mycorrhizal fungi bacterial strain, culture medium and culture method thereof | |
| CN105018391B (en) | A kind of dead paddy bacillus NBIF 001 and fermentation process and application | |
| CN104560827A (en) | Biocontrol actinomycete strain for preventing and controlling tobacco bacterial wilt and application thereof | |
| CN102703333B (en) | Mycorrhizal fungi strain efficiently growing with rhododendron seedling | |
| CN103642734A (en) | Microbacterium maritypicum and application thereof in preventing sugar beet disease-causing organisms | |
| CN110468057A (en) | One plants endogenetic disk both-end hair spore category fungi M7SB 41 and its application | |
| CN106222241A (en) | The screening technique of raw biocontrol bacterial strain in a kind of banana blight | |
| CN106591144A (en) | Multi-functional trichoderma strain and application thereof | |
| CN104450560B (en) | One plant of nematicide Sphingobacterium bacterial strain and its application | |
| CN103146609B (en) | Pseudomonas fluorescens and method for preventing phytophthora capsici thereby | |
| Salamone et al. | Clonostachys rosea, a potential biological control agent for Rhizoctonia solani AG-3 causing black scurf on potato | |
| CN101942403B (en) | Bacillus pumilus as well as culture method and application thereof | |
| CN104560735B (en) | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases | |
| CN103981101A (en) | DSE (Dark Septate Endophyte) strain and application of DSE strain in production of sugarcane | |
| CN104531543B (en) | Grey green soy bean endogenetic fungus TPL25 and its application in controlling plant diseases | |
| CN104357345B (en) | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof | |
| CN105462882B (en) | A kind of pseudomonas aeruginosa and its application for preventing crop verticillium wilt | |
| CN109370923B (en) | Method for maintaining viability of needle mushroom | |
| CN114395487B (en) | Walnut root rot pathogen ML-1, biocontrol microbial inoculum and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211201 Address after: 201306 2nd floor, no.979 Yunhan Road, Lingang New Area, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: Shanghai hechengqin Intellectual Property Service Co.,Ltd. Address before: 410004 No. 498 South Shaoshan Road, Hunan, Changsha Patentee before: CENTRAL SOUTH University OF FORESTRY AND TECHNOLOGY Effective date of registration: 20211201 Address after: 554300 No. 4, Binjiang Avenue, Bijiang District, Tongren City, Guizhou Province Patentee after: Guizhou Camellia Industry Comprehensive Development Co.,Ltd. Address before: 201306 2nd floor, no.979 Yunhan Road, Lingang New Area, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee before: Shanghai hechengqin Intellectual Property Service Co.,Ltd. |
|
| TR01 | Transfer of patent right |