CN104357345B - The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof - Google Patents
The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof Download PDFInfo
- Publication number
- CN104357345B CN104357345B CN201410427200.5A CN201410427200A CN104357345B CN 104357345 B CN104357345 B CN 104357345B CN 201410427200 A CN201410427200 A CN 201410427200A CN 104357345 B CN104357345 B CN 104357345B
- Authority
- CN
- China
- Prior art keywords
- oil tea
- colletotrichum
- bacterial strain
- strain
- pathogen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
Abstract
The invention discloses bacterial strain and the application process thereof of a kind of antagonism oil tea new anthrax pathogen.Separate from oil tea healthy plant 6 kinds of former bacterium of new Oil Tea Anthracnose and a kind it has been reported that the former bacterium of Oil Tea Anthracnose there is the interior raw antagonistic strain of high inhibition effect, provide strain excellent for utilizing antagonistic bacterium to prevent and treat oil tea multiple anthrax cause of disease targetedly.The Endophytic antagonistic bacteria multiple Oil Tea Anthracnose of sustainable efficient control of new screening, environmentally safe, it is ensured that Oleum Camelliae safety, there is significant economy, Social Ecology benefit.
Description
Technical field
The invention belongs to oil tea biological control of diseases technical field, be specifically related to a kind of antagonism preventing and treating multiple cellulitis of oil tea charcoal sick
Former bacterial strain and application process thereof.
Background technology
Oil tea (Camellia oleifera) is China distinctive woody edible oil material seeds, and the Yi Shi world four is the most woody
One of oil plant seeds, oneself has the cultivation of more than 2000 year and utilizes history.In Oleum Camelliae, unsaturated fatty acid content is high, it is possible to decrease blood
Fat, liver fat, prevent thrombosis, coronary heart disease and atherosclerosis are had good preventive effect.The main integrated distribution of oil tea
In Hunan, Jiangxi and Guangxi, wherein Hunan Province is the maximum oil tea place of production of China and maximum Oleum Camelliae consumption area.But it is raw in reality
In product, production and the health management of oil tea are had a strong impact on by multiple diseases.
One of the Major Diseases in Oil Tea Anthracnose China oil tea producing region, often causes serious shedding, bud drop, fallen leaves, branch withered, very
Become feeble and die to whole strain, cause heavy economic losses.The fruit drop rate that thus disease causes, generally at 20%-40%, reaches 60% time serious
Above.Though late period, disease fruit can be gathered, but seed oil content greatly reduces.Once there is this disease on producing in oil tea, will result in tight
The economic loss of weight.At present, domestic scholars thinks that Oil Tea Anthracnose is by colletotrichum gloeosporioides Penz (Colletotrichum
Gloeosporioides Penz.) cause.We pass through pathogenicbacteria separation, Pathogenicity, and combining form feature and Duo Ji
Because of Molecular Identification, finding in addition to colletotrichum gloeosporioides Penz, the most other 6 kinds of new cause of diseases also can cause serious Oil Tea Anthracnose,
These cause of diseases are Colletotrichum fructicola, Colletotrichum siamense, Colletotrichum
Karstii, Colletotrichum sp.1, Colletotrichum sp.2, Glomerella cingulata.Preventing and treating at present
The technology of Oil Tea Anthracnose and method almost all are for colletotrichum gloeosporioides Penz (Colletotrichum gloeosporioides
Penz.) this kind of cause of disease, the Oil Tea Anthracnose that have ignored other is former, thus results in the reality at Stand control Oil Tea Anthracnose
During application, poor effect, cause the waste of great human and financial resources.At present, do not have any except for glue spore charcoal
The relevant skill of cellulitis bacterium (Colletotrichum gloeosporioides Penz.) preventing and treating other cause of disease of Oil Tea Anthracnose outward
Art research and report.
Therefore, strengthen the research dynamics to Oil Tea Anthracnose, improve the Prevention Technique of anthrax multiple to oil tea, particularly
Biological prevention, has become as the task of top priority that oil tea produces.Compared with chemical pesticide control, application antagonistic microbe preventing and treating
Not only effective to sensitive germ disease, and the germ disease developing immunity to drugs oneself is the most effective.The most short of money
Antimicrobial separation obtains, and has further promoted the exploitation of these strains, thus has improve the effective of plant disease
Preventing and treating.If can be the angle of main pathogenic from which pathogen, filter out antagonism pathogen targetedly
Microorganism, it will the preventing and treating to Oil Tea Anthracnose has positive effect.
Summary of the invention
It is an object of the invention to provide bacterial strain and application process, this bacterium of a kind of antagonism preventing and treating multiple new anthrax of oil tea
Strain can be good at antagonism suppression and causes several newfound pathogenic bacterium of Oil Tea Anthracnose, and prevention effect is compared to reporting for work
The antagonistic strain of preventing and treating Oil Tea Anthracnose to get well, and 7 kinds of anthrax pathogen can be played inhibitory action simultaneously, with strong points.
The bacterial strain of a kind of antagonism oil tea new anthrax pathogen, described bacterial strain is Methylotrophic bacillus cereus
(Bacillus methylotrophicus), deposit number is CCTCC NO:M 2014386.
The application process of described bacterial strain, causes the mycelial growth of the pathogen of Oil Tea Anthracnose for antagonism.Specifically
7 kinds of anthrax pathogen of Oil Tea Anthracnose are caused: Colletotrichum fructicola for antagonism,
Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1,
Colletotrichum sp.2, Glomerella cingulata and the mycelia of Colletotrichum gloeoporioide
Growth.
The application process of described bacterial strain, causes the spore germination of the pathogen of Oil Tea Anthracnose for suppression.Specifically
For suppressing to cause 7 kinds of anthrax pathogen of Oil Tea Anthracnose: Colletotrichum fructicola,
Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1,
Colletotrichum sp.2, Glomerella cingulata and the spore of Colletotrichum gloeoporioide
Sprout.
The application process of described bacterial strain, for preventing and treating the anthrax of oil tea.
The present invention separates the main pathogenic fungi to Oil Tea Anthracnose from oil tea healthy plant high inhibition effect
Antagonistic strain, especially 6 kinds of new Oil Tea Anthracnose pathogen are all had preferable antagonism, raw antagonism in simultaneously measuring
The antimicrobial spectrum of bacterial strain, provides strain excellent for utilizing antagonistic microbe to prevent and treat Oil Tea Anthracnose research targetedly.Antagonistic Fungi
Biological control continuous and effective controls Oil Tea Anthracnose, protects environment, it is ensured that the safety of Oleum Camelliae, has significant economy, society
Ecological benefits.
The Methylotrophic bacillus cereus (Bacillus methylotrophicus) of the present invention is August 20 in 2014
Day is preserved in China typical culture collection center, and deposit number is CCTCC NO:M2014386, and address is Wuhan City, Hubei Province
Luo Jia Shan, Wuchang (Wuhan University).
Accompanying drawing explanation
The anthrax scab that Figure 1A causes on oil tea blade, (PDA culture medium, C is front to C, D pure culture feature, and D is
Reverse side) B conidium；
The anthrax scab that Fig. 2 A causes on oil tea blade, (PDA culture medium, C is front to C, D pure culture feature, and D is
Reverse side) B conidium；
The anthrax scab that Fig. 3 A causes on oil tea blade, (PDA culture medium, C is front to C, D pure culture feature, and D is
Reverse side) B conidium；
The anthrax scab that Fig. 4 A causes on oil tea blade, (PDA culture medium, C is front to C, D pure culture feature, and D is
Reverse side) B conidium；
The anthrax scab that Fig. 5 A causes on oil tea blade, (PDA culture medium, C is front to C, D pure culture feature, and D is
Reverse side) B conidium；
The anthrax scab that Fig. 6 A causes on oil tea blade, (PDA culture medium, C is front to C, D pure culture feature, and D is
Reverse side) B conidium；
The anthrax scab that Fig. 7 A causes on oil tea blade, (PDA culture medium, C is front to C, D pure culture feature, and D is
Reverse side) B conidium；
Fig. 8 is to build Colletotrichum spp. system according to ITS-CAL-GAPDH 3 gene collating sequence N-J method
System grows tree；
Fig. 9 is the 68 strain antagonistic strains inhibitory action to pathogen Glomerella cingulata；
Figure 10 is the 68 strain antagonistic strains inhibitory action to pathogen Colletotrichum sp.1；
Figure 11 is the 68 strain antagonistic strains inhibitory action to pathogen Colletotrichum siamense；
Figure 12 is the 68 strain antagonistic strains inhibitory action to pathogen Colletotrichum sp.2；
Figure 13 is the 68 strain antagonistic strains inhibitory action to pathogen Colletotrichum karstii；
Figure 14 is the 68 strain antagonistic strains inhibitory action to pathogen Colletotrichum fructicola；
Figure 15 is the 68 strain antagonistic strains inhibition figures to pathogen Colletotrichum gloeoporioide；
Figure 16 is the 68 strain endogenetic bacterias inhibitory action to 7 kinds of Anthracnose Pathogen bacterium；
Figure 17 is No. 49 antagonistic bacterium forms.
Detailed description of the invention
It is intended to further illustrate the present invention below in conjunction with embodiment, and the unrestricted present invention.
Embodiment 1: separation that Oil Tea Anthracnose is former and qualification
The separation of pathogen and cultivation
Oil tea disease leaf picks up from Hunan, Jiangxi, Guangxi, Hainan, Fujian, Hubei and Chongqing.Use conventional separation technique, from sick leaf
Sick strong intersection tissue separates, and after pure culture slant culture, 4 DEG C of Refrigerator stores are standby.
Pathogens is observed
Observe colony characteristics, optical microphotograph Microscopic observation mycelia feature, conidium form, and measure its size.
Tieback is tested
To country's Approved variety ' Hua Xin ' oil tea plants leaf, with 75% ethanol surface sterilization process, fine needle dips point
Puncture Camellia Leaves after bacterium spore suspension, processes with aquesterilisa and compares (CK), and in vitro observes Occurrence and development of disease
Situation, and inoculation sequela leaf is carried out pathogenic bacteria separates.
Pathogenic bacteria polygenic PCR amplification and sequence analysis
The extraction of pathogen DNA
The extraction of pathogen DNA.Isolated strains is inoculated on PDA plate and activates, dark in 28 DEG C of incubators
Cultivate after 6d, with the spoon of sterilizing, mycelia is scraped, weigh 0.5g in mortar, add 1mL lysate, 3/10 volume quartz
Sand, proceeds in 1.5mL EP pipe after grinding fully, and 65 DEG C of water-bath 10min are subsequently adding 600 μ L7.5mol/L NaCl solution, ice
After bath 8min, 13000r/min is centrifuged 5min；Take in the EP pipe that 600 μ L of supernatant liquid to are new, add 400 μ L chloroforms: isoamyl alcohol
(24:1), mixing；Take 500 μ L of supernatant after stratification to manage to another new EP, add 0.1 times of volume NaAc and the nothing of 2 times of volumes
Water-ethanol, 14000g collects DNA after being centrifuged 8min, washes DNA2 time with 70% ethanol；After ethanol volatilizees, dissolve with 0.1 × TE
DNA ,-20 DEG C of preservations.
Gene Selection and purpose fragment amplification and order-checking
The bacterial strain that all separation screenings are obtained by we, selects ribosome transcribed spacer (ITS), glyceraldehyde 3-phosphate to take off
Hydrogenase gene (GAPDH) and Calmodulin gene (CAL) expand and check order.Corresponding pcr amplification primer thing is shown in Table 1.PCR produces
Thing entrusts the order-checking of Shanghai Bo Shang Bioisystech Co., Ltd.
1, table test the primer and annealing temperature list
Bacterial strain polygenic system is grown tree and is built
3 genes of each bacterial strain that order-checking is obtained, each after Clustal W software comparison and manual correction
Gene joins end to end respectively according to the order of ITS-CAL-GAPDH, and downloads and contain ITS in GenBank simultaneously, and 3 genes are also
Carry out homology analysis after joining end to end according to the order of ITS-CAL-GAPDH, build all bacterial strains 3 with software MEGA4.0
The N-J phylogenetic tree of the assortment of genes.
Result and analysis
Pathogenicbacteria separation and Pathogenicity
From Hunan, Jiangxi, Guangxi, Hainan, Fujian, Hubei separates with the oil tea producing region in 7 provinces such as Chongqing, purification obtains
Morphological characteristic doubtful anthrax pathogen 269 strain, is tested by tieback, it has been found that 35 fungal strains can cause the symptom of anthrax.
These scab tissues are carried out pathogenicbacteria separation again, it is thus achieved that the bacterium colony consistent with former inoculating strain morphological characteristic and mitogenetic spore
Son；Sterilized water (CK) processes and does not all find scab, is not also separated to pathogenic bacteria.Thus can determine that, this 35 fungal strain that we separate
It it is the pathogen causing Oil Tea Anthracnose.35 fungal strains, according to morphological feature, can be divided into 7 classes, we respectively with FA, FB, FC,
FD, FE, FF, FG represent.
(1) FF class bacterial strain
Conidium is straight, cylindric or fusiform, and the blunt circle in two ends is smooth, colourless, 13-17 μm (Fig. 1, B).
In PDA culture medium, the speed of growth, 11.3-14.3mm/day, bacterium colony is light grey to Dark grey, circular, rule, limit
Edge color is the most shallow；Back side black, forms black concentricity (Fig. 1, C, D) sometimes.Conidium is straight, cylindric, the blunt circle in two ends, single
Spore, smooth, colourless.
Bacterial strain research and host: strains separation is from oil tea disease leaf.Oil tea causes oval light brown pit, sick strong friendship
Water stain shape (Fig. 1, A) at boundary.Fig. 1, A are the anthrax scabs caused on oil tea excised leaf.
(2) FC class bacterial strain
In bacterium colony PDA culture medium, the speed of growth, 11.2-13.3mm/day, bacterium colony is light grey, and fine hair shape, edge is whole
Together；The back side is outwards gradually become dark brown (Fig. 2, C, D) by rice water color from center.Conidium monospore, directly, cylindric, two ends
Blunt circle, colourless, smooth, 12-15 μm (Fig. 2, B).
Bacterial strain research and host: strains separation, from oil tea disease leaf, causes light brown ellipse to brown at blade edge or top
Circle or the scab (Fig. 2, A) of strip.Fig. 2, A are the anthrax scabs caused on oil tea excised leaf.
(3) FK class bacterial strain
Conidium monospore, smooth, cylindric, base portion is truncate, the blunt circle in top, and base portion is wider, tapered to top, tapered.
On PDA, speed of growth 10.1-11.7mm/day, bacterium colony fine hair shape, neat in edge；Slightly band yellow (Fig. 3, C,
D) conidium monospore, directly, cylindric, colourless, 15-19 μm.Base portion is truncate, the blunt circle in top (Fig. 3, B).
Bacterial strain research and host: strains separation from oil tea disease leaf, blade causes the closely oval scab of dark brown (Fig. 3,
A).Fig. 3, A are the anthrax scabs caused on oil tea excised leaf.
(4) FG class bacterial strain
Conidium is straight, sometimes at middle part around contracting, and the blunt circle in two ends, colourless 11-18 μm.
In PDA culture medium, speed of growth 9.7-12.7mm/day, bacterium colony is various, light gray to Dark grey, fine hair shape,
Neat in edge；Back side rice water color is to dark brown, boundary zone point yellow (Fig. 4, C, D).Conidium Chinese red, conidium cylinder
Shape, the blunt circle in two ends, smooth, there is oily ball (Fig. 4, B).
Bacterial strain research and host: strains separation, from oil tea disease leaf, hygrophanous subcircular scab, gradually sink, the later stage becomes
Brown, has dispersion stain (by conidium heap blackening) (Fig. 4, A).Fig. 4, A are the anthraxs caused on oil tea excised leaf
Scab.
(5) FA class bacterial strain
The narrowest corynebacterium of conidium oblong or one end, colourless, unit cell, yardstick is 13-17 μm (Fig. 5, B).
In PDA culture medium, speed of growth 9.9-12.9mm/day, bacterium colony Lycoperdon polymorphum Vitt, aerial hyphae is dilute, is close to culture medium,
Neat in edge, back side black the greenest (Fig. 5, C, D).Conidium is straight, cylindric or fusiform, and the blunt circle in two ends is smooth, colourless
(Fig. 5, B).
Bacterial strain research and host: strains separation, from oil tea disease leaf, scab yellowish-brown on leaf, edge bronzing, has above
Chinese red stickum, i.e. pathogenic bacteria conidium (Fig. 5, A).Produce bronzing fusiformis streak after children's basal part of stem morbidity, expand afterwards
Browning, slightly concave sunken, scab has Chinese red goo.Fig. 5, A are the anthrax scabs caused on oil tea excised leaf.
(6) FB class bacterial strain
Conidium, monospore, colourless, smooth, two terminal circle length 13-19 μm (Fig. 6, B).
In PDA culture medium, speed of growth 9.9-16.4mm/day, bacteria colony white is to Lycoperdon polymorphum Vitt, flat, neat in edge；The back of the body
In the middle of face, black is outwards somewhat light yellow (Fig. 6, C, D).
Bacterial strain research and host: strains separation, in oil tea disease leaf, produces brown circle at blade proximal edge or at nearly blade tip
Shape, oval scab (Fig. 6, A).Fig. 6, A are the anthrax scabs caused on oil tea excised leaf.
(7) FD class bacterial strain
Conidium, monospore, colourless, smooth, two terminal circle length 12-18 μm (Fig. 7, B).
In PDA culture medium, growth is relatively slow, 2.4-5.7mm/day bacterium colony fine hair shape, Lycoperdon polymorphum Vitt, and circular, the back side is light brown extremely
Black (Fig. 7, C, D).
Bacterial strain research and host: strains separation, in oil tea disease leaf, forms light brown subcircular or bar shaped scab (Fig. 7, A).
Fig. 7, A are the anthrax scabs caused on oil tea excised leaf.
Bacterial strain polygenic system developmental analysis
35 pathogenic strains belong to other kind of bacterial strain with the anthrax downloaded from Genbank and (splice ITS, CAL and GAPDH3 base
Because of sequence) display of the phylogenetic tree (Fig. 8) that builds, 35 bacterial strain copolymerization are 7 branches: wherein, and the Ith has 10 FF class bacterium
It is one that strain gathers with all C.fructicola participating in analyzing, and the IIth has 1 FD class bacterial strain and C.alienum to gather is one
, but supporting rate is the highest, and title is fixed tentatively as Colletotrichum sp.2, the IIIth have 10 FC class bacterial strains with
It is one that C.siamense gathers, and the IVth has 5 FG class bacterial strains and C.gloeosporioides to gather is one, and the Vth has 4
It is one that FB class bacterial strain not bacterial strain with other gathers, and suspected of a novel species, title is fixed tentatively as Colletotrichum sp.1,
VI has 4 FA class bacterial strains and Glomerella cingulata to gather is one, the VIIth have 1 FE class bacterial strain with
It is one that C.karstii gathers.In polygenic system tree, 7 branch's bacterial strains can belong to other kinds with anthrax and well distinguish.Root
According to the morphological feature of each bacterial strain, consulting Fungal identification handbook, grow tree in conjunction with polygenic system, we identify and are separated to
Pathogen has 6 oil tea New Records: C.fructicola, C.siamense, C.karstii, Colletotrichum
Sp.1, Colletotrichum sp.2, Glomerella cingulata and 1 have reported kind: C.gloeosporioides.
Embodiment 2: antagonistic bacterium separates, screening
Separate material: from Liuyang oil tea Demonstration Base, the blade choosing C. olelfera healthy plant carries out dividing of endophyte
From.
For examination endogenetic bacteria: obtained by susceptible oil tea blade separation screening.
For examination pathogen: 7 kinds of oily Anthracnose Pathogen bacterium, embodiment 1 separates, identifies acquisition.
For examination culture medium:
PDA: glucose 20.0g, Rhizoma Solani tuber osi 200.0g, agar 18.0g, distilled water 1000ml；
NB: Carnis Bovis seu Bubali cream 3.0g, peptone 10.0g, sodium chloride 5g, distilled water 1000ml, pH7.2-7.4.
The isolation and purification of endogenetic bacteria:
Randomly selecting 20 tea oil trees from the oil tea demonstration test base of liuyang hunan, each tree takes 10 Camellia Leaves
Sheet, loads in bag, the labelling time, place.Suitable health is chosen after being rinsed well by the oil tea seedling leaf tap water adopted back
Camellia Leaves tissue, cuts into the bar shaped of 3cm, soaks 15s, then use aseptic water washing 30s, repeat to rinse 3 in 75% ethanol
Secondary, being finally cut into size is the square of about 6mm, is placed in PDA culture medium under sterile working, numbers the most one by one and in training
Support and case is cultivated 3-7d, in case purification.
When after the antibacterial culturing separated to certain time, a little with Inoculating needle picking, and aseptically use line
Method is inoculated in PDA culture medium, is placed in incubator cultivation, to reach the purpose of purification.
Flat board face-off method screening:
Use flat board face-off method that Antagonistic Fungi raw in the oil tea Seedling of isolated is screened, obtain resistant strain.Will be straight
Footpath is that the Oil Tea Anthracnose pathogen bacterium cake of 6mm is aseptically placed in PDA plate central authorities, then with toothpick dip to be measured carefully
Bacterium, equidistant point connects 4 kinds of endogenetic bacterias, is placed in 28 DEG C of cultivations in incubator, the size of observed and recorded inhibition zone and having after 5 days
Nothing, is repeated 3 times, and 6 bacterial strains selecting fungistatic effect best carry out multiple sieve.
The mensuration of interior raw antagonistic strain antimicrobial spectrum:
Flat board face-off method is used to measure the antagonistic strain antagonism to 7 kinds of pathogen: to be cut into by the pathogen that 7 kinds activate
0.5cm's is square, is seeded in PDA plate central authorities under aseptic condition respectively, and surrounding inoculates separated purification at pathogen 2cm
Antagonistic bacterium, every ware connects four kinds, often processes 3 times and repeats, is placed in dark culturing in incubator, and every day observes, and measures inhibition zone
Size.
Result and analysis
The isolation and purification of Endophytic antagonistic bacteria
According to single colonial morphology, size, color, smooth surface degree, separation, purification from the antibacterial that all separation obtain
Obtaining 68 strain endogenetic bacterias (being shown in Table 2), strain number is followed successively by No. 1-No. 70 (No. 21 and No. 53 is mistake numbering).Can from table
To find out, isolating host tree totally 5 strain of effective antagonistic bacterium, account for the 25% of sum, separation of bacterial quantity is relatively low, and bacterial population
Amount obvious difference, No. 4 tea oil trees have isolated 32 strain antibacterials, and No. 2 tea oil trees are only isolated to 1 strain antibacterial.Oil at present is described
Surely the tea oil tree having grown Endophytic antagonistic bacteria in tea woods only accounts for sub-fraction, is not have interior raw antagonism thin in most tea oil tree
Bacterium, one of this major reason being probably Oil Tea Anthracnose generation.
The separation of endogenetic bacteria in table 2 Camellia Leaves
Interior raw antagonistic strain antimicrobial spectrum measures
With 7 kinds of Oil Tea Anthracnose bacterium C.fructicola, C.siamense, C.karstii, C.gloeoporioide,
Glomerella cingulata, Colletotrichum sp.1 and Colletotrichum sp.2 various pathogenic bacteria are instruction
Bacterium, uses flat board face-off method to measure the bacteriostasis of 68 bacterial strains (see Fig. 9-15；Figure 16).As can be seen from the figure No. 5, No. 8,
No. 38, No. 48, No. 49,6 antagonistic bacteriums such as No. 65 all 7 kinds of pathogenic bacterias are all had stronger inhibitory action, account for bacterial strain sum
8.82%；Wherein No. 49 bacterium antagonistic activities are the strongest, the antibacterial bandwidth of 7 kinds of Oil Tea Anthracnose bacterium is both greater than 7mm, this is described
Bacterium can be used for preventing and treating by these 7 kinds of microbial Oil Tea Anthracnoses of cause of disease.
The inhibitory action that 7 kinds of anthrax archesporiums of oil tea are sprouted by embodiment 3:49 antagonistic bacterium
Use microscope slide sessile drop method.After Oil Tea Anthracnose pathogenic bacteria is cultivated 10d in (22 DEG C) incubator on PDA plate,
Transfer to fill in the test tube of aquesterilisa with transfering loop picking sorus, concussion is made into spore suspension (5 × 10 after shaking up8Individual/
ML), standby.Take 100uL spore suspension, with 100uL fermenation raw liquid be diluted 10 times, the fermentation liquid of 100 times and 100uL and send out
Ferment filtrate mixes respectively, is added drop-wise on concave slide, to drip sterilized water for comparison.Often process and be repeated 3 times, be placed in 28 DEG C of incubators
Middle cultivation, microscopy spore germination situation after 48h, calculate spore germination rate.As seen from the results in Table 3, the proferment of No. 49 bacterial strains
Liquid suffers from obvious inhibitory action, wherein to spore germination to the growth of 7 kinds of conidial sproutings of anthrax bacteria and germ tube
Suppression ratio between 95.8%-95.2%, fermentation liquid is diluted rear inhibition and is gradually lowered.No. 49 strain fermentation filtrates pair
The inhibition of spore germination is the most fairly obvious, and inhibition of germination is between 89.7%-90.3%, and result shows, bacterial strain
May create during fermentation culture and anthrax bacteria is had the metabolite of inhibitory action.
The impact on anthrax bacteria conidia germination of the table 3 endophytic bacterial controlled effect culture fluid
Embodiment 4:49 antagonistic bacterium Analysis and Identification
Morphological Identification
Colonial morphology: No. 49 bacterial strains are on culture medium flat plate, and 30 DEG C of cultivations, bacterium colony surface folding, bacterium colony expansion rate is relatively
Hurry up, be creamy white, initial stage edge is wavy, and central uplift is opaque, not chromogenesis (see Figure 17).
Thalli morphology: observe under optical microscope that thalline is shaft-like, Gram-positive, produce spore, middle life, spore
Oval (see Figure 17).
Genomic DNA test kit (Beijing hundred Tyke Bioisystech Co., Ltd) extracts.16S rDNA universal primer sets
Meter: 16SL:5'AGAGTTTGATCCTGGCTCAG3', 16SR:5'ACGGCTACCTTGTTACGACT3'.PCR reaction system (50
μ L): DNA1.5 μ g, each 1.5 μ L of primer, dNTP4 μ L, 10 × Buffer5.0 μ L, Taq enzyme 0.5 μ L, ddH2O36 μ L.Amplification journey
Sequence is 95 DEG C of denaturations 4min, 30 circulations (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 90s), and 72 DEG C extend 10min.4 DEG C of preservations.
PCR order-checking is completed by Beijing Bo Maide biotechnology Co., Ltd.By bacterial strain 16SrDNA sequence at http: //
Carrying out Blast comparison analysis in www.ncbi.nlm.nlh.gov website, the bacterial strain of known 16S rDNA is carried out with GenBank
Highest homology compares.
Searched for by Blast homology, find No. 49 bacterial strains and the Bacillus in Genbank
Methylotrophicus homology is 100%, combining form feature, and we identify that No. 49 Endophytic antagonistic bacterias are
Bacillus methylotrophicus, it may be assumed that Methylotrophic bacillus cereus.
The present invention is total to isolated 68 strain endogenetic bacteria from oil tea infected leaves, through flat board face-off screening, obtains 7 kinds
Oil Tea Anthracnose pathogenic bacteria has bacterial strain 1 strain of strong antagonistic effect.By cultivating shape, morphologic observation and Molecular Identification etc., identifying should
Bacterium is Methylotrophic bacillus cereus, and result of study is that Biological control oil tea multiple anthrax pathogen provides strain excellent.
Claims (3)
1. the bacterial strain of an antagonism oil tea new anthrax pathogen, it is characterised in that described bacterial strain is Methylotrophic spore bar
Bacterium (Bacillus methylotrophicus), deposit number is CCTCC NO:M 2014386.
2. the application of the bacterial strain described in claim 1, it is characterised in that
7 kinds of anthrax pathogen: Colletotrichumfructicola of Oil Tea Anthracnose are caused for antagonism,
Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1,
Colletotrichum sp.2, Glomerella cingulata and the mycelia of Colletotrichum gloeoporioide
Growth.
3. the application of the bacterial strain described in claim 1, it is characterised in that
7 kinds of anthrax pathogen: Colletotrichumfructicola of Oil Tea Anthracnose are caused for suppression,
Colletotrichum siamense, Colletotrichum karstii, Colletotrichum sp.1,
Colletotrichum sp.2, Glomerella cingulata and the spore of Colletotrichum gloeoporioide
Sprout.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410427200.5A CN104357345B (en) | 2014-08-27 | 2014-08-27 | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410427200.5A CN104357345B (en) | 2014-08-27 | 2014-08-27 | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104357345A CN104357345A (en) | 2015-02-18 |
| CN104357345B true CN104357345B (en) | 2016-08-17 |
Family
ID=52524659
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410427200.5A Active CN104357345B (en) | 2014-08-27 | 2014-08-27 | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104357345B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108085269B (en) * | 2017-11-23 | 2019-12-06 | 中国农业科学院麻类研究所 | Bacillus methylotrophicus strain IBFCBF-2 and application thereof |
| CN112029665B (en) * | 2020-08-03 | 2022-05-17 | 中国热带农业科学院环境与植物保护研究所 | Rubber tree colletotrichum resistant strain HcgHNQZ1736 and application thereof in drug resistance research |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074272A (en) * | 2012-12-17 | 2013-05-01 | 漳州三炬生物科技有限公司 | Bacillus methylotrophicus Sanju-04 and its application |
| KR20130096870A (en) * | 2012-02-23 | 2013-09-02 | 이기성 | Novel antifungal bacterium bacillus methylotrophicus lks26 |
| CN103805534A (en) * | 2013-11-28 | 2014-05-21 | 中国农业科学院农业资源与农业区划研究所 | Bacillus methylotrophicus, microorganism bacterium agents and application of bacillus methylotrophicus and microorganism bacterium agents |
-
2014
- 2014-08-27 CN CN201410427200.5A patent/CN104357345B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130096870A (en) * | 2012-02-23 | 2013-09-02 | 이기성 | Novel antifungal bacterium bacillus methylotrophicus lks26 |
| CN103074272A (en) * | 2012-12-17 | 2013-05-01 | 漳州三炬生物科技有限公司 | Bacillus methylotrophicus Sanju-04 and its application |
| CN103805534A (en) * | 2013-11-28 | 2014-05-21 | 中国农业科学院农业资源与农业区划研究所 | Bacillus methylotrophicus, microorganism bacterium agents and application of bacillus methylotrophicus and microorganism bacterium agents |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104357345A (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103695356B (en) | A kind of bacillus amyloliquefaciens and microbiobacterial agent and application thereof | |
| CN109762777B (en) | One plant of Paenibacillus polymyxa bacterial strain and its application | |
| CN103215210B (en) | Bacillus siamensis and application of bacillus siamensis in preparation of microbial seaweed fertilizer | |
| CN104711209A (en) | Bacillus amyloliquefaciens B011 for preventing and treating tobacco bacterial wilt and application thereof | |
| CN107058160B (en) | One plant of peanut rhizosphere bacillus amyloliquefaciens and its application | |
| CN106399129A (en) | Trichoderma harzianum strain and application thereof | |
| CN105543132A (en) | Bacillus methylotrophicus YB-F7 and application thereof in preventing plant diseases | |
| CN102329756A (en) | Streptomyces albospinus strain BWL15-4 for preventing and treating banana vascular wilt and application thereof | |
| CN101935616A (en) | Rhododendron mycorrhizal fungi bacterial strain, culture medium and culture method thereof | |
| CN106676049A (en) | Bacillus amyloliquefaciens strain and application thereof | |
| CN104560827A (en) | Biocontrol actinomycete strain for preventing and controlling tobacco bacterial wilt and application thereof | |
| CN110423707A (en) | Bacillus subtilis strain NH-6 and its application | |
| CN105018391A (en) | Bacillus vallismortis NBIF-001 and fermentation process and application | |
| CN102329755A (en) | Nonabsorbent streptomyces ahygroscopicus strain BWL58 for preventing and treating banana vascular wilt and application thereof | |
| CN103642734A (en) | Microbacterium maritypicum and application thereof in preventing sugar beet disease-causing organisms | |
| CN106591144A (en) | Multi-functional trichoderma strain and application thereof | |
| CN109112069B (en) | Biocontrol endophytic fungus and application thereof | |
| CN101942403B (en) | Bacillus pumilus as well as culture method and application thereof | |
| CN106222241A (en) | The screening technique of raw biocontrol bacterial strain in a kind of banana blight | |
| CN103146609B (en) | Pseudomonas fluorescens and method for preventing phytophthora capsici thereby | |
| CN107129935A (en) | A kind of DSE bacterium and its application in blueberry growth and drought resisting is improved | |
| CN106434490A (en) | Ginseng bacterium TY15-2 with effects of disease prevention and growth promotion and application thereof | |
| CN104357345B (en) | The bacterial strain of the multiple new anthrax pathogen of a kind of antagonism oil tea and application process thereof | |
| CN109321500A (en) | One bacillus amyloliquefaciens bacterial strain and its application in prevention and treatment Oil Tea Anthracnose evil | |
| CN105462882B (en) | A kind of pseudomonas aeruginosa and its application for preventing crop verticillium wilt |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211201 Address after: 201306 2nd floor, no.979 Yunhan Road, Lingang New Area, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: Shanghai hechengqin Intellectual Property Service Co.,Ltd. Address before: 410004 No. 498 South Shaoshan Road, Hunan, Changsha Patentee before: CENTRAL SOUTH University OF FORESTRY AND TECHNOLOGY Effective date of registration: 20211201 Address after: 554300 No. 4, Binjiang Avenue, Bijiang District, Tongren City, Guizhou Province Patentee after: Guizhou Camellia Industry Comprehensive Development Co.,Ltd. Address before: 201306 2nd floor, no.979 Yunhan Road, Lingang New Area, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee before: Shanghai hechengqin Intellectual Property Service Co.,Ltd. |