CN104313044A - Zero-background cloning vector as well as preparation method and application thereof - Google Patents
Zero-background cloning vector as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN104313044A CN104313044A CN201410520443.3A CN201410520443A CN104313044A CN 104313044 A CN104313044 A CN 104313044A CN 201410520443 A CN201410520443 A CN 201410520443A CN 104313044 A CN104313044 A CN 104313044A
- Authority
- CN
- China
- Prior art keywords
- cloning vector
- microlitre
- vector
- seq
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a method for preparing a zero-background cloning vector, and application of the zero-background cloning vector. The method for preparing the zero-background cloning vector comprises the following steps: providing a DNA segment as shown in the sequence SEQ ID NO:6; performing first PCR amplification by taking pUC19 plasmid as a template and utilizing primers as shown in the sequences SEQ ID NO:7-8, thereby obtaining a pUC19 vector segment; performing homologous recombination on the DNA segment and the pUC19 vector segment, thereby obtaining a vector framework; converting the vector framework into competent cells, and extracting the plasmid, thereby obtaining a previous vector of the zero-background cloning vector; and performing enzyme digestion on the previous vector of the zero-background cloning vector by using EcoRV enzyme, thereby obtaining the zero-background cloning vector. The vector obtained by using the method can be directly used for connecting flat tail end products, the vector self-connection background is low, the positive rate of cloning is high, blue and white screening is not needed, rapid and effective cloning can be achieved within a short time, the cloning efficiency is high, and the effect is good.
Description
Technical field
The present invention relates to technical field of bioengineering, particularly, relate to zero background cloning vector and its preparation method and application, more specifically, the present invention relates to the method for preparation zero background cloning vector, zero background cloning vector and preparing the purposes in goal gene cloning vector, and preparing the method for goal gene cloning vector.
Background technology
The genetic engineering of present stage relates to a large amount of gene clone technologies, gene fragment is inserted in cloning vector, the convenient long-term molecular biology manipulations preserving gene and downstream.The carrier of cloning vector common on market such as with thymus pyrimidine T protruding terminus (hereinafter referred to as carrier T) is that application beta-galactosidase gene carries out indigo plant-hickie screening mostly, inferior position is that blue hickie ratio is higher, and also there is false-positive situation in hickie, the step each flat board being coated the bromo-4-of 5-chloro-3-indoles-β-D-galactoside (hereinafter referred to as X-Gal) and isopropylthio-β-D-galactoside (hereinafter referred to as IPTG) is also more loaded down with trivial details.Carrier T directly can only connect thymus nucleic acid (hereinafter referred to as the DNA) fragment of end with adenine base A tail, and the fidelity of reproduction of the polysaccharase that Taq enzyme etc. are similar is not as high-fidelity enzyme, and the fragment amplified exists the risk of mispairing.When Insert Fragment is greater than 3 kilobase time, cloning efficiency is very low.
And except carrier T, also having some at present about the report of zero background carrier containing virulent gene, this zero novel background flush end cloning vector can avoid the shortcoming of some common vectors.But, when utilizing virulent gene carrier construction, in order to expand numerous plasmid vector, the reading frame of virulent gene destruction makes gene not express by the general blocking-up sequence that adopts, thus likely cause there is the interference that the non-enzyme of trace cuts clean plasmid, there is certain influence to the quality of carrier.
Thus, present stage is badly in need of a kind of zero background flush end cloning vector that can effectively solve the problem.
Summary of the invention
The present invention is intended at least to solve one of technical problem existed in prior art.For this reason, one object of the present invention is to propose a kind of connection that can be directly used in flat end products, reduces carrier from the background that connects, improves the positive rate of clone, and can realize the zero background cloning vector of cloning fast and effectively at short notice.
First, it should be noted that, the present invention completes based on the following discovery of contriver:
(aminoacid sequence is as SEQ ID NO for ribonuclease gene; Shown in 1, nucleotide sequence is as shown in SEQ ID NO:2), derive from bacillus amyloliquefaciens (Bacillus amyloliquefaciens), to encode a kind of rnase, can degrade Yeast Nucleic Acid (hereinafter referred to as RNA), be lethal when not having its arrestin concerning cell.Such as, replicon conventional in gene clone carrier can copy efficiently in intestinal bacteria, in each cell, copy reaches 200-300, but, at the hybrid promoter (hereinafter referred to as Tac promotor) of Lac operon (hereinafter referred to as Lac promotor), lactose and tryptophane, and under the promoters driven such as Lac operon form (hereinafter referred to as Lac UV5 promotor) of sudden change, ribonuclease gene can great expression, Bacillus coli cells will be killed, therefore, rnase is all lethal concerning common intestinal bacteria.Further, the promotor of tissue specific expression is utilized effectively can to drive ribonuclease gene specifically expressing in this tissue of host.
Cell-lethal toxicity (Control of cell death, hereinafter referred to as ccdB) a kind of toxic protein of genetic expression, in the antitoxic situation of shortage, a kind of albumen of interference e. coli dna gyrase, thus suppress the growth of Bacillus coli communis, kill and wound host cell.And the intestinal bacteria of DB3.1 can tolerate the plasmid breeding containing ccdB gene, facilitate the extraction of plasmid.Utilizing the intestinal bacteria of DB3.1 to breed carrier, by increasing ribosome bind site sequence, allowing ccdB gene a large amount in DB3.1 bacterial strain express, non-enzyme can be reduced and cut the background that clean vector causes.
Contriver finds, the construction strategy of two virus gene is adopted to build zero background cloning vector: to adopt ccdB virulent gene as the intervening sequence of zero background carrier, namely block by the sequence of ccdB gene the reading frame destroying ribonuclease gene (including multiple clone site), ribonuclease gene can be made on the one hand to be retained on carrier but not express, object carrier can be obtained when cutting ccdB gene, ribonuclease gene just can be expressed, and the reading frame destroying ribonuclease gene after inserting exogenous sequences causes protein inactivation, thus reach the effect of zero background clone, on the other hand, when carrier enzyme is cut, the supercoiled plasmid enzyme restriction of such as sex change usually having minute quantity is incomplete, and by introducing ccdB gene, complete non-enzyme is cut plasmid completely and can not be expressed, and this can ensure the quality of carrier.The zero background cloning vector containing ribonuclease gene entire reading frame can kill Bacillus coli cells after recirculation, only has the carrier successfully connecting foreign gene just can grow bacterium colony on flat board.This positive-selecting strategy screens in vain without the need to indigo plant, can greatly accelerate colony screening process.
At present, the gene of use encoding ribose nuclease is not yet had to build the report that zero background carrier carries out flush end clone.
Thus, according to an aspect of the present invention, the invention provides a kind of method preparing zero background cloning vector.According to embodiments of the invention, the method comprises the following steps: provide the DNA fragmentation shown in SEQ ID NO:6; With pUC19 plasmid for template, the primer shown in SEQ ID NO:7-8 is utilized to carry out the first pcr amplification, to obtain pUC19 carrier segments; Described DNA fragmentation and described pUC19 carrier segments are carried out homologous recombination, to obtain carrier framework; Described carrier framework transformed competence colibacillus cell is extracted plasmid, to obtain the front carrier of zero background cloning vector; And adopt EcoRV enzyme to carry out enzyme to carrier before described zero background cloning vector to cut, to obtain zero background cloning vector.
The discovery that contriver is surprised, the zero background cloning vector obtained by the method can be directly used in the connection of flat end products and goal gene fragment, carrier is low from the background connected, the positive rate of clone is high, screen in vain without the need to indigo plant, namely can realize at short notice cloning fast and effectively, cloning efficiency is high, effective, and then the structure of object carrier can be effective to.
According to a further aspect in the invention, present invention also offers a kind of zero background cloning vector.According to embodiments of the invention, this zero background cloning vector is prepared by the method for foregoing preparation zero background cloning vector.Contriver is surprised to find, this zero background cloning vector is relative to common carrier T superior performance, the connection of flat end products and goal gene fragment can be directly used in, carrier is low from the background connected, and the positive rate of clone is high, screens in vain without the need to indigo plant, can realize at short notice cloning fast and effectively, cloning efficiency is high, effective, and then can be effective to the structure of object carrier.
According to another aspect of the invention, aforesaid zero background cloning vector is preparing the purposes in goal gene cloning vector.According to embodiments of the invention, this zero background cloning vector efficiently can connect the goal gene fragment of different lengths, be particularly suited for the connection of the goal gene of large fragment, and joint efficiency and positive rate are very high, connect product and can directly transform conventional coli strain, thus, can be directly used in and prepare goal gene cloning vector.Particularly, goal gene fragment is effectively connected on zero background carrier, goal gene cloning vector can be obtained, after sequence verification, the preservation of sequential analysis and gene order can be directly used in, or by the method for subclone, the goal gene in this goal gene cloning vector is transferred on suitable expression vector, build destination gene expression carrier, for use in protein expression or transgenic research.
In accordance with a further aspect of the present invention, the invention provides a kind of method preparing goal gene cloning vector.According to embodiments of the invention, the method comprises: goal gene fragment be connected with zero background cloning vector, then transform, cultivate, screening positive clone, to obtain goal gene cloning vector.Contriver is surprised to find, the method is utilized can efficiently to connect any goal gene fragment with the different lengths of flat end or sticky end by aforesaid zero background cloning vector, be particularly suited for the connection of large fragment goal gene fragment, and joint efficiency and positive rate are very high, connect product and can directly transform conventional coli strain, thus can effectively prepare goal gene cloning vector.Further, this goal gene cloning vector, after sequence verification, the preservation of sequential analysis and gene order can be directly used in, or by the method for subclone, the goal gene in this goal gene cloning vector is transferred on suitable expression vector, build destination gene expression carrier, for use in protein expression or transgenic research.
Additional aspect of the present invention and advantage will part provide in the following description, and part will become obvious from the following description, or be recognized by practice of the present invention.
Accompanying drawing explanation
Above-mentioned and/or additional aspect of the present invention and advantage will become obvious and easy understand from accompanying drawing below combining to the description of embodiment, wherein:
Fig. 1 shows the schematic flow sheet of the method preparing zero background cloning vector according to an embodiment of the invention;
Fig. 2 shows according to one embodiment of present invention, the Vector map of the front carrier of zero background cloning vector;
Fig. 3 shows according to one embodiment of present invention, the electrophorogram of front carrier after EcoRV enzyme is cut of zero background cloning vector;
Fig. 4 shows according to one embodiment of present invention, and zero background cloning vector connects the bacterium colony PCR electrophoresis detection result after the flat terminal fragment of 700bp;
Fig. 5 shows according to one embodiment of present invention, and zero background cloning vector connection 700bp glues the bacterium colony PCR electrophoresis detection result after terminal fragment;
Fig. 6 shows according to one embodiment of present invention, and zero background cloning vector connects the bacterium colony PCR electrophoresis detection result after the flat terminal fragment of 2000 base;
Fig. 7 shows according to one embodiment of present invention, and zero background cloning vector connects the bacterium colony PCR electrophoresis detection result after the flat terminal fragment of 8000 base.
Embodiment
Embodiments of the invention are described below in detail.Embodiment described below is exemplary, only for explaining the present invention, and can not be interpreted as limitation of the present invention.
It should be noted that, term " first ", " second " only for describing object, and can not be interpreted as instruction or hint relative importance or imply the quantity indicating indicated technical characteristic.Thus, be limited with " first ", the feature of " second " can express or impliedly comprise one or more these features.Further, in describing the invention, except as otherwise noted, the implication of " multiple " is two or more.
According to an aspect of the present invention, the invention provides a kind of method preparing zero background cloning vector.With reference to figure 1, according to embodiments of the invention, the method comprises the following steps:
S100: the DNA fragmentation shown in SEQ ID NO:6 is provided
DNA fragmentation shown in SEQ ID NO:6 is provided, this DNA fragmentation comprises the intervening sequence of ribonuclease gene that LacUV5 promotor (SEQ ID NO:4) drives and ccdB gene (SEQ ID NO:5), wherein, SEQ ID NO:6 sequence is specific as follows:
TTCCCGACTG?GAAAGCAATT?GGCAGTGAGC?GCAACGCAAT?TAATGTGAGT?TAGCTCACTC?60
ATTAGGCACC?CCAGGCTTTA?CACTTTATGC?TTCCGGCTCG?TATAATGTGT?GGAATTGTGA?120
GCGGATAACA?ATTTCACACA?GGAGGTTTAA?ACTTTAAAAT?GGCTCAGGTT?ATCAACACCT?180
TCGACGGTGT?TGCTGACTAC?CTGCAGACCT?ACCACAAACT?GCCGGACAAC?TACATCACCA?240
AATCTGAAGC?TCAGGCTCTG?GGTTGGGAGC?GGATAACAAT?TTCACACAGG?AAACAGCTAT?300
GCCCATGCTT?ACGCCAAGAT?TTAGGTGACA?CTATAGAATA?CTCAAGCTAT?GCATCCAACG?360
CGTTGGGAGC?TCTCCCATAT?GGTCGACCTG?CAGGCGGCCG?CGAATTCACT?AGGATATCTA?420
AGGAGATTTA?CATGCAGTTC?AAGGTTTACA?CCTATAAAAG?AGAGAGCCGC?TATCGCCTGT?480
TTGTGGATGT?ACAGAGTGAT?ATTATTGACA?CGCCCGGGCG?ACGGATGGTG?ATCCCCCTGG?540
CCAGTGCACG?TCTGCTGTCA?GATAAAGTCT?CCCGTGAACT?TTACCCGGTG?GTGCATATCG?600
GGGATGAAAG?CTGGCGCATG?ATGACCACCC?AGATGGTCAG?TGTGCCGGTC?TCCGTCATCG?660
GAGAAGAAGT?GGCTGATCTC?AGCCACCGCG?AAAATGACAT?CAAAAACGCC?ATTAATCTGA?720
TGTTCTGGGG?AATATAAAGC?GGCCGATATC?GAATTCCCGC?GGCCGCCATG?GCGGCCGGGA?780
GCATGCGACG?TCGGGCCCAA?TTCGCCCTAT?AGTGAGTCGT?ATTACAATTC?ACTGGCCGTC?840
GTTTTACAAC?GTCGTGACTG?GGAAAACCCT?GGCGGCTTCT?AAAGGTAACC?TGGCTGACGT?900
TGCTCCGGGT?AAATCTATCG?GTGGTGACAT?CTTCTCTAAC?CGTGAAGGTA?AACTGCCGGG?960
TAAATCTGGT?CGTACCTGGC?GTGAAGCTGA?CATCAACTAC?ACCTCTGGTT?TCCGTAACTC?1020
TGACCGTATC?CTGTACTCTT?CTGACTGGCT?GATCTACAAA?ACCACCGACC?ACTACCAGAC?1080
CTTCACCAAA?ATCCGTTAAG?GCCTCGTGAT?ACGCCTATT?1119
According to embodiments of the invention, provide the DNA fragmentation shown in SEQ ID NO:6 by following steps:
First, by the primer mixing shown in SEQ ID NO:9-69, to obtain primer mixture, wherein, each primer sequence is as shown in the table:
Then, the second pcr amplification is carried out to described primer mixture, to obtain the second pcr amplification product.According to embodiments of the invention, the reaction system of described second pcr amplification is: the micromolar described primer mixture of 10 microlitre 50,0.5 microlitre high-fidelity DNA polymerase, 10 microlitre 5X the 2nd PCR reaction mixtures, distilled water complements to 50 microlitres.Thus, PCR efficiency is high.According to embodiments of the invention, the response procedures of described second pcr amplification is: 95 DEG C 3 minutes; 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 1 minute, circulate 25 times; 68 DEG C 5 minutes; Be cooled to room temperature.
Finally, utilize the primer shown in SEQ ID NO:9 and SEQ ID NO:69, described second pcr amplification product is carried out the 3rd pcr amplification, to obtain the 3rd pcr amplification product, described 3rd pcr amplification product is the DNA fragmentation shown in SEQ ID NO:6.According to embodiments of the invention, the reaction system of described 3rd pcr amplification is the primer shown in 0.5 microlitre 50 micromole SEQ ID NO:9, primer shown in 0.5 microlitre 50 micromole SEQ ID NO:69,0.5 microlitre high-fidelity DNA polymerase, 10 microlitre 5X the 3rd PCR reaction mixtures, second pcr amplification product described in 1 microlitre, distilled water complements to 50 microlitres.Thus, PCR reaction efficiency is high.According to embodiments of the invention, the response procedures of described 3rd pcr amplification is: 95 DEG C 3 minutes; 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 2 minutes, circulate 30 times; 68 DEG C 5 minutes; Be cooled to room temperature.Thus, high by above-mentioned PCR combined coefficient, accuracy is good.
S200: obtain pUC19 carrier segments
With pUC19 plasmid for template, utilize the primer shown in SEQ ID NO:7-8 to carry out the first pcr amplification, to obtain pUC19 carrier segments, wherein, primer sequence is as follows:
PUC19 forward primer: AATTGCTTTCCAGTCGGGAA (SEQ ID NO:7)
PUC19 reverse primer: GCCTCGTGAT ACGCCTATT (SEQ ID NO:8)
According to embodiments of the invention, the reaction system of described first pcr amplification is the primer shown in 0.5 microlitre 10 micromole SEQ ID NO:7, primer shown in 0.5 microlitre 10 micromole SEQ ID NO:8,10 nanogram pUC19 plasmids, 0.5 microlitre high-fidelity DNA polymerase, 10 microlitre 5X the one PCR reaction mixtures, distilled water complements to 50 microlitres, and according to embodiments of the invention, the response procedures of described first pcr amplification is: 95 DEG C 3 minutes; 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 2 minutes, circulate 30 times; 68 DEG C 5 minutes; Be cooled to room temperature.
It should be noted that, the kind of the PCR kit that aforesaid first pcr amplification, the second pcr amplification and the 3rd pcr amplification adopt is not particularly limited, can require to select suitable PCR kit according to actual experiment, and then, correspondingly, a described PCR reaction mixture, the 2nd PCR reaction mixture and the 3rd PCR reaction mixture are respectively the reaction mixture in selected test kit.Such as, the product F ast HiFidelity PCR Kit of TIANGEN Biotech (Beijing) Co., Ltd. can be adopted to carry out described first pcr amplification, the second pcr amplification and the 3rd pcr amplification, and then a described PCR reaction mixture, the 2nd PCR reaction mixture and the 3rd PCR reaction mixture are the reaction mixture in this test kit (Fast HiFidelity PCR Kit).
S300: DNA fragmentation and pUC19 carrier segments are carried out homologous recombination
Described DNA fragmentation and described pUC19 carrier segments are carried out homologous recombination, to obtain carrier framework.According to embodiments of the invention, gene clone test kit is utilized to carry out described homologous recombination.Thus, homologous recombination efficiency is high.According to embodiments of the invention, the reaction system of described homologous recombination is: 10 microlitre 2X gene clone reaction mixtures, and pUC19 carrier segments described in DNA fragmentation, 2 microlitres described in 5 microlitres, distilled water complements to 50 microlitres.According to embodiments of the invention, under room temperature, carry out described homologous recombination 30 minutes.
It should be noted that, the kind of the gene clone test kit that homologous recombination can adopt is not particularly limited, and can require to select according to actual experiment, and then correspondingly, described gene clone reaction mixture is the reaction mixture carried in selected test kit.Such as, TaKaRa product can be adopted
hD Cloning Kit carries out described homologous recombination, and then described gene clone reaction mixture is the reaction mixture in this test kit.
S400: carrier framework transformed competence colibacillus cell is extracted plasmid
Described carrier framework transformed competence colibacillus cell is extracted plasmid, to obtain the front carrier of zero background cloning vector.It should be noted that, in this article, sometimes also by " the front carrier of zero background cloning vector " referred to as " before zero background carrier ".According to some embodiments of the present invention, before zero background, the Vector map of carrier as shown in Figure 2.According to embodiments of the invention, described competent cell is competent escherichia coli cell DB3.1.Thus ccdB gene can in DB3.1 bacterial strain expression amount high.
S500:EcoRV enzyme enzyme cuts the front carrier of zero background cloning vector
Adopt EcoRV enzyme to carry out enzyme to carrier before described zero background cloning vector to cut, to obtain zero background cloning vector.Wherein, according to some embodiments of the present invention, before zero background after EcoRV enzyme is cut, the electrophoretogram of carrier as shown in Figure 3.According to embodiments of the invention, at 37 DEG C, carry out described enzyme cut 2-4 hour.According to embodiments of the invention, the reaction system that described enzyme is cut is: 10 microlitre 10X enzyme cutting buffering liquids, and the front carrier of zero background cloning vector described in 1-10 microgram, 1-10 microlitre 10 U/ microlitre EcoRV enzyme, distilled water complements to 100 microlitres.According to one embodiment of present invention, adopt Thermo product F ermentas EcoRV Restriction Enzymes to carry out described enzyme to cut.
According to embodiments of the invention, the method comprises further: digestion products is carried out agarose gel electrophoresis, and reclaims the large fragment of purifying about 3000 base, and described large fragment is described zero background cloning vector.
The discovery that contriver is surprised, the zero background cloning vector obtained by the method can be directly used in the connection of flat end products and goal gene fragment, carrier is low from the background connected, the positive rate of clone is high, screen in vain without the need to indigo plant, namely can realize at short notice cloning fast and effectively, cloning efficiency is high, effective, and then the structure of object carrier can be effective to.
According to a further aspect in the invention, present invention also offers a kind of zero background cloning vector.According to embodiments of the invention, this zero background cloning vector is prepared by the method for foregoing preparation zero background cloning vector.Contriver is surprised to find, this zero background cloning vector is relative to common carrier T superior performance, the connection of flat end products and goal gene fragment can be directly used in, carrier is low from the background connected, and the positive rate of clone is high, screens in vain without the need to indigo plant, can realize at short notice cloning fast and effectively, cloning efficiency is high, effective, and then can be effective to the structure of object carrier.
According to another aspect of the invention, aforesaid zero background cloning vector is preparing the purposes in goal gene cloning vector.According to embodiments of the invention, this zero background cloning vector efficiently can connect the goal gene fragment of different lengths, be particularly suited for the connection of the goal gene of large fragment, and joint efficiency and positive rate are very high, connect product and can directly transform conventional coli strain, thus, can be directly used in and prepare goal gene cloning vector.Particularly, goal gene fragment is effectively connected on zero background carrier, goal gene cloning vector can be obtained, after sequence verification, the preservation of sequential analysis and gene order can be directly used in, or by the method for subclone, the goal gene in this goal gene cloning vector is transferred on suitable expression vector, build destination gene expression carrier, for use in protein expression or transgenic research.
According to embodiments of the invention, goal gene fragment is connected with described zero background cloning vector, then transforms, cultivate, screening positive clone, to obtain goal gene cloning vector.
According to embodiments of the invention, rapid ligation buffer and T4 DNA ligase is utilized to carry out described connection.Thus, cloning vector efficiently can connect the object fragment of different lengths, has higher joint efficiency and positive rate especially for large fragment, and performance is better than common carrier T.
According to embodiments of the invention, described rapid ligation buffer comprises: the Tutofusin tris of 20 ~ 200 mmoles; The magnesium chloride of 5 ~ 50 mmoles; The dithiothreitol (DTT) of 0.5 ~ 50 mmole; The deoxyribonucleoside triphosphate of 0.1 ~ 1 mmole; The Triphosaden of 0.3 ~ 3 mmole; The hydrochloric acid spermidine of 0.5 ~ 10 mmole; And 50 ~ 1000 bSAs of mg/ml.
In accordance with a further aspect of the present invention, the invention provides a kind of method preparing goal gene cloning vector.According to embodiments of the invention, the method comprises: goal gene fragment be connected with zero background cloning vector, then transform, cultivate, screening positive clone, to obtain goal gene cloning vector.Contriver is surprised to find, the method is utilized can efficiently to connect any goal gene fragment with the different lengths of flat end or sticky end by aforesaid zero background cloning vector, be particularly suited for the connection of large fragment goal gene fragment, and joint efficiency and positive rate are very high, connect product and can directly transform conventional coli strain, thus can effectively prepare goal gene cloning vector.Further, this goal gene cloning vector is after sequence verification, the preservation of sequential analysis and gene order can be directly used in, or by the method for subclone, the goal gene in this goal gene cloning vector is transferred on suitable expression vector, build destination gene expression carrier, for use in protein expression or transgenic research.
According to embodiments of the invention, rapid ligation buffer and T4 DNA ligase is utilized to carry out described connection.Thus, cloning vector efficiently can connect the object fragment of different lengths, has higher joint efficiency and positive rate especially for large fragment, and performance is better than common carrier T.
According to embodiments of the invention, described rapid ligation buffer comprises: the Tutofusin tris of 20 ~ 200 mmoles; The magnesium chloride of 5 ~ 50 mmoles; The dithiothreitol (DTT) of 0.5 ~ 50 mmole; The deoxyribonucleoside triphosphate of 0.1 ~ 1 mmole; The Triphosaden of 0.3 ~ 3 mmole; The hydrochloric acid spermidine of 0.5 ~ 10 mmole; And 50 ~ 1000 bSAs of mg/ml.
According to embodiments of the invention, under room temperature, carry out described connection 5-30 minute.
It should be noted that, zero background cloning vector of the present invention at least has the following advantages:
1, zero background cloning vector of the present invention have employed the virulent gene of rnase as positive screening system, can the various PCR primer of high-efficient cloning and any DNA fragmentation with flat end or sticky end, and to phosphorylation or unphosphorylated DNA fragmentation all effective.Positive selection carrier is connected with Insert Fragment only to be needed within 5 minutes, to obtain the Positive recombinant clones more than 95%.The flat end PCR primer increased by the polysaccharase (as: Pfu polysaccharase) with proofreading activity directly can be connected into cloning vector.The PCR primer increased by polysaccharase (as: Taq polysaccharase) or the polymerase mixture without proofreading activity needs to carry out end flat end (5 minutes) with heat-stable DNA flat end enzyme in the pre-connection.Connect product and can directly transform conventional coli strain.
2, zero background cloning vector of the present invention contains lethal ribonuclease gene (including multiple clone site), multiple clone site inserts exogenous sequences can cause enzyme gene inactivation, therefore only have the bacterium having transformed recombinant plasmid to survive and form colonies, and the nuclease that the vector expression of recirculation is lethal (inserting without exogenous sequences), kill Bacillus coli cells after conversion.
3, zero background cloning vector of the present invention, under the effect of T4 DNA ligase and rapid ligation buffer, efficiently can connect the fragment of different lengths, have higher joint efficiency and positive rate especially for large fragment, performance is better than common carrier T.
4, goal gene fragment is effectively connected on zero background carrier, goal gene cloning vector can be obtained, after sequence verification, it can be directly used in the preservation of sequential analysis and gene order, or by the method for subclone, the goal gene in this goal gene cloning vector is transferred on suitable expression vector, build destination gene expression carrier, for use in protein expression or transgenic research.Particularly, restriction endonuclease sites that can be suitable in the design of the two ends of goal gene, the method of connection is cut by enzyme, from goal gene cloning vector, goal gene is cut, then expression vector is connected to, after successfully constructing, the work such as follow-up protein expression or transgenic research can be carried out.
Below in conjunction with embodiment, the solution of the present invention is made an explanation.It will be understood to those of skill in the art that the following examples only for illustration of the present invention, and should not be considered as limiting scope of the present invention.Unreceipted concrete technology or condition in embodiment, (such as show with reference to J. Pehanorm Brooker etc. according to the technology described by the document in this area or condition, " Molecular Cloning: A Laboratory guide " that Huang Peitang etc. translate, the third edition, Science Press) or carry out according to product description.Agents useful for same or the unreceipted production firm person of instrument, be and by the conventional products of commercial acquisition, such as, can be able to purchase from TIANGEN Biotech (Beijing) Co., Ltd..
The preparation of embodiment 1 zero background cloning vector
Prepare zero background cloning vector, first need the front carrier of a structure zero background cloning vector, contriver selects the pUC19 plasmid of high copy to transform.Step is as follows:
(1) gene order shown in synthetic SEQ ID NO:6, it comprises the intervening sequence of ribonuclease gene that LacUV5 promotor (SEQ ID NO:4) drives, ccdB gene (SEQ ID NO:5), and multiple clone site (SEQ ID NO:3).Synthetic primer is as follows:
(2) primer aqua sterilisas all in above-mentioned (1) being diluted to concentration is 50 micromoles per liter, each primer is drawn 5 microlitres and is added to the mixed solution forming a primer in a PCR pipe, then Fast HiFidelity PCR Kit (TIANGEN Biotech (Beijing) Co., Ltd. is utilized, article No.: KP202), adopt quick exo+ polymerase to carry out assembling the first round amplification of PCR, system is as follows:
| Composition in assembling PCR system | Reaction system |
| 5X reaction mixture | 10 microlitres |
| Primer mixture | 10 microlitres |
| High-fidelity DNA polymerase (2.5 units/microlitre) | 0.5 microlitre |
| Distilled water | Supply 50 microlitres |
Polymerase chain reaction denaturation condition is: 95 DEG C, 3 minutes.PCR cycling condition is: 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 1 minute, circulate 25 times.PCR supplements extension condition: 68 DEG C 5 minutes.Finally reaction system is cooled to room temperature.
(3) PCR primer in 1 microlitre above-mentioned (2) is got as template, utilize Fast HiFidelity PCR Kit (TIANGEN Biotech (Beijing) Co., Ltd., article No.: KP202) to carry out second and take turns PCR, system is as follows:
| Composition in assembling PCR system | Reaction system |
| 5X reaction mixture | 10 microlitres |
| Forward primer F1 | 0.5 microlitre |
| Reverse primer R29 | 0.5 microlitre |
| High-fidelity DNA polymerase (2.5 units/microlitre) | 0.5 microlitre |
| PCR primer in above-mentioned (2) | 1 microlitre |
| Distilled water | Supply 50 microlitres |
Polymerase chain reaction denaturation condition is: 95 DEG C, 3 minutes.Polymerase chain reaction cycling condition is: 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 2 minutes, circulate 30 times.Supplement extension condition be: 68 DEG C 5 minutes.Finally reaction system is cooled to room temperature.
After above-mentioned amplified reaction, obtain the DNA fragmentation of 1119 base pairs, wherein 20, rear and front end base is and the 2678-2697 bit base place of pUC19 carrier and 600-619 bit base place sequence homology respectively.
(4) at the 2678-2697 base place of pUC19 plasmid vector and 600-619 base place design pair of primers,
PUC19 forward primer: AATTGCTTTCCAGTCGGGAA (SEQ ID NO:7);
PUC19 reverse primer: GCCTCGTGAT ACGCCTATT (SEQ ID NO:8).
Then, it is 10 micromoles per liter that above-mentioned primer aqua sterilisa is diluted to concentration, respectively get 0.5 microlitre, with 10 nanogram pUC19 plasmids for template, utilize Fast HiFidelity PCR Kit (TIANGEN Biotech (Beijing) Co., Ltd., article No.: KP202) carry out PCR, wherein, in reaction system, all the other components comprise 0.5 microlitre high-fidelity DNA polymerase, 10 microlitre 5 X reaction mixtures, then add distilled water and supply the amplification that 50 microlitres carry out polymerase chain reaction (PCR).Polymerase chain reaction denaturation condition is: 95 DEG C 3 minutes.Polymerase chain reaction cycling condition is: 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 2 minutes, circulate 30 times.Supplement extension condition be: 68 DEG C 5 minutes.Finally be cooled to room temperature.
Above-mentioned amplification obtains the carrier framework of remaining pUC19, is about 2000 base pairs.
(5) amplified production of the carrier framework of the pUC19 of all the other 2000 base pairs obtained in the gene fragment of obtain in (3) 1119 base pairs and (4) is utilized
hD Cloning Kit (TaKaRa) carries out homologous recombination, and reaction system is as follows:
| Composition in homologous recombination system | Reaction system |
| 2X reaction mixture | 10 microlitres |
| (3) gene fragment (50 nanograms/microlitre) obtained in | 5 microlitres |
| (4) the pUC19 carrier segments (50 nanograms/microlitre) obtained in | 2 microlitres |
| Distilled water | Supply 50 microlitres |
Room temperature reaction 30 minutes.
The recombinant products getting above-mentioned 5 microlitres joins in 50 ul of E. coli competent cells (DB3.1), and ice bath is after 30 minutes, and 42 degree of thermal shocks 90 seconds, after adding the LB substratum of 350 microlitres, hatch 45 minutes for 180 revs/min in 37 DEG C of shaking tables.Get 150 microlitre bacterium liquid and carry out coated plate.Flat board is placed on 37 DEG C of overnight incubation.
(6) the single bacterium colony in the flat board of picking above-mentioned (5) carries out sequencing, as the front carrier of making zero background cloning vector after checking is correct.Wherein, before zero background, the Vector map of carrier is as shown in Figure 2.
Utilize Fermentas EcoRV Restriction Enzymes (Thermo, article No.: ER0301), carrier before zero background built above is carried out EcoRV enzyme and cuts, enzyme cuts system as following table, and 37 DEG C of enzymes cut 2-4 hour.
| Enzyme cuts the composition in system | Reaction system |
| 10 × damping fluid | 10 microlitres |
| The plasmid of carrier before zero background | 1-10 microgram |
| EcoRV (10U/ microlitre) | 1-10 microlitre |
| Distilled water | Mend to 100 microlitres |
Digestion products is carried out agarose gel electrophoresis, 100 volts of electrophoresis 1-2 hour, at this moment the small segment of about 300 bases and the large fragment carrier of about 3000 bases can be seen, the carrier blade of large fragment is cut, utilize the sepharose DNA of TIANGEN Biotech's (in this article sometimes also referred to as " sky root ") to reclaim test kit (article No.: DP209) to reclaim, namely obtain zero background cloning vector after the vector purification of large fragment, after measuring concentration, carrier is determined to 25 nanograms/microlitre.
For polymerase chain reaction product and the digestion products of flush end, can directly connect.Add 5 microlitre 2X rapid ligation buffer, 25 nanogram zero background cloning vectors, the DNA Insert Fragment of 50-200 nanogram, the T4 DNA ligase of 1 microlitre, adds distilled water and supplies 10 microlitres.
For the polymerase chain reaction product of sticky end, add 5 microlitre 2X rapid ligation buffer, the DNA Insert Fragment of 50-200 nanogram, 0.5 microlitre flat end enzyme, adds distilled water and supplies 8.5 microlitres.Springing centrifuge tube is to mix content gently, of short duration centrifugal 3-5 second.Above mixed reaction solution is placed in 70 DEG C of reactions 5 minutes, is placed on of short duration cooling on ice.And then in the reaction system of flat end, add 25 nanogram zero background cloning vectors and 0.5 microlitre T4 DNA ligase.
Fragment room temperature lower than 3000 bases connects 5 minutes, and the fragment room temperature being greater than 3000 bases connects 30 minutes.Due to the validity of zero background cloning vector and the efficient connection of rapid ligation buffer, the connection of Insert Fragment can obtain the positive rate up to 100%.
Embodiment 2 uses the implementation method of the connection gene fragment of zero background cloning vector
1, the acquisition of goal gene fragment
With lambda phage DNA for template, design primer is as follows:
The forward primer (hereinafter referred to as 700-F) of 700 base gene fragments: GAGGGCAAGTATCGTTTCCA (SEQ ID NO:70)
The reverse primer (hereinafter referred to as 700-R) of 700 base gene fragments: ACTGGAAAGCAACGAAGTCC (SEQ ID NO:71)
The forward primer (hereinafter referred to as 2K-F) of 2000 base gene fragments: ATCTGCCTTTACGGGGATTT (SEQ ID NO:72)
The reverse primer (hereinafter referred to as 2K-R) of 2000 base gene fragments: GTACAGCCAAAGGCATCCAT (SEQ ID NO:73)
The forward primer (hereinafter referred to as 8K-F) of 8000 base gene fragments: ATCCCATGTCGGCAAGCATAAGC (SEQ ID NO:74)
The reverse primer (hereinafter referred to as 8K-R) of 8000 base gene fragments: ATCGCTCTGAATTGCAGCATCCG (SEQ ID NO:75)
Then, pcr amplification is carried out with above-mentioned primer respectively, to obtain goal gene fragment to be connected.Particularly:
With lambda phage DNA for template, with 700-F and 700-R for primer, utilize 2X Taq PCR MasterMix mixture (sky root, article No.: KT201) to carry out the sticky RLM-RACE of PCR primer, obtain the sticky end PCR primer of 700 bases.
With lambda phage DNA for template, utilize Fast HiFidelity PCR Kit (sky root, article No.: KP202) carry out PCR primer flush end amplification, wherein, with 700-F and 700-R for primer amplification obtains the PCR primer of 700 bases, obtain the PCR primer of 2000 bases with 2K-F and 2K-R for primer amplification, utilize 8K-F and 8K-R to obtain the PCR primer of 8000 bases for primer amplification.
Wherein, the response procedures of above-mentioned each PCR is:
PCR denaturation condition is: 95 DEG C 3 minutes; PCR cycling condition is: 94 DEG C 30 seconds, 55 DEG C of annealing 30 seconds, 68 DEG C of 2 minutes/kilobase extend, and circulate 35 times; PCR supplements extension condition: 68 DEG C 5 minutes.Finally reaction system is cooled to room temperature.
Then, the various PCR primer of above-mentioned acquisition are carried out agarose gel electrophoresis respectively, to reclaim the fragment of purifying gained, thus obtain 4 kinds of goal gene fragments: the PCR primer of the sticky end PCR primer of 700 bases, the PCR primer of 700 bases, the PCR primer of 2000 bases and 8000 bases.
2, the carrier of goal gene fragment connects
Then, utilize zero background cloning vector of preparation in embodiment 1, respectively ligation is carried out to the gene fragment of above-mentioned gained, specific as follows:
(1) sticky end PCR primer
For sticky end PCR primer, before carrying out ligation, according to following reaction system preparation flat end reaction system, and carry out flat end according to following steps: springing centrifuge tube is to mix content gently, of short duration centrifugal 3-5 second.Mixed reaction solution is placed in 70 DEG C of reactions 5 minutes, is placed on of short duration cooling on ice.
Note: the heat-resisting polymerase of any high-fidelity can be adopted to carry out described flat end, the Pfu archaeal dna polymerase of such as sky root, fast high-fidelity DNA polymerase.
Then, then in the reaction system of flat end, add following composition to above-mentioned, under room temperature, carry out ligation 5-30 minute, connect product to obtain:
| Composition | Reaction system |
| Zero background cloning vector (25 nanograms/microlitre) | 1 microlitre |
| T4 DNA ligase (5 units/microlitre) | 0.5 microlitre |
(2) flat end PCR primer
For flat end PCR primer, under room temperature, carry out ligation 5-30 minute according to following reaction system, connect product to obtain:
Blunt end cloning system
Wherein, the composition of 2 × quick ligation damping fluid comprises: Tutofusin tris (Tris) 20 ~ 200 mmole, magnesium chloride 5 ~ 50 mmole, dithiothreitol (DTT) (DTT) 0.5 ~ 50 mmole, deoxyribonucleoside triphosphate (dNTPs) 0.1 ~ 1 mmole, Triphosaden (ATP) 0.3 ~ 3 mmole, hydrochloric acid spermidine 0.5 ~ 10 mmole and bSA (BSA) 50 ~ 1000 mg/ml.
Wherein, the fragment room temperature being less than 3 kilobase connects 5 minutes, and the fragment room temperature being greater than more than 3 kilobase connects 30 minutes.
3, the qualification of product is connected
Respectively each connection product of above-mentioned acquisition is identified (multiple repetition is established in experiment), specific as follows:
Get 5 microlitres and connect the competent cell (2 × 10 that product joins the Top10 of 50 microlitres
8cfu/ microgram) in, ice bath is after 30 minutes, and 42 degree of thermal shocks 90 seconds, after adding the LB substratum of 350 microlitres, in 37 DEG C of shaking tables, the rotating speed of 180 revs/min hatches 45 minutes.Then, get 150 microlitre bacterium liquid and carry out coated plate.Flat board is placed on 37 DEG C of overnight incubation.
Then, the bacterium colony on random picking flat board, carries out bacterium colony PCR, and wherein, PCR system is as follows:
| Composition in bacterium colony PCR system | Reaction system |
| 2X reaction mixture | 10 microlitres |
| Forward primer (10 micromoles per liter) | 0.5 microlitre |
| Reverse primer (10 micromoles per liter) | 0.5 microlitre |
| Archaeal dna polymerase (2.5 units/microlitre) | 0.5 microlitre |
| Distilled water | Supply 20 microlitres |
PCR condition is identical with the condition in step 1 during " acquisition of gene fragment " pcr amplification.Carry out electrophoresis after PCR terminates, detect Insert Fragment positive rate, electrophoresis result is shown in Fig. 4-7.As Fig. 4-7, NTC represents negative control, all the other each bands represent that having chosen reference numbers clones number accordingly respectively.
From the result of Fig. 4-7, after 700 bases glue the connection of end, the flat end of 700 base and the flat end of 2000 bases, bacterium inspection result is the positive rate of 100%, is the positive rate of 94% compared with bacterium inspection result after the connection of the flat end of large fragment 8000 base.
| Insert Fragment | Colony number | Positive rate |
| 700 bases glue end | 1000 | 100％ |
| The flat end of 700 base | 1000 | 100％ |
| The flat end of 2000 base | 1000 | 100％ |
| The flat end of 8000 base | 800 | 94％ |
Thus, very strong joint efficiency and cloning efficiency can be had by zero background cloning vector of preparation in comprehensive evaluation embodiment 1 from colony number and positive rate after connecting.
In the description of this specification sheets, specific features, structure, material or feature that the description of reference term " embodiment ", " some embodiments ", " example ", " concrete example " or " some examples " etc. means to describe in conjunction with this embodiment or example are contained at least one embodiment of the present invention or example.In this manual, identical embodiment or example are not necessarily referred to the schematic representation of above-mentioned term.And the specific features of description, structure, material or feature can combine in an appropriate manner in any one or more embodiment or example.
Although illustrate and describe embodiments of the invention, those having ordinary skill in the art will appreciate that: can carry out multiple change, amendment, replacement and modification to these embodiments when not departing from principle of the present invention and aim, scope of the present invention is by claim and equivalents thereof.
Claims (10)
1. prepare a method for zero background cloning vector, it is characterized in that, comprise the following steps:
DNA fragmentation shown in SEQ ID NO:6 is provided;
With pUC19 plasmid for template, the primer shown in SEQ ID NO:7-8 is utilized to carry out the first pcr amplification, to obtain pUC19 carrier segments;
Described DNA fragmentation and described pUC19 carrier segments are carried out homologous recombination, to obtain carrier framework;
Described carrier framework transformed competence colibacillus cell is extracted plasmid, to obtain the front carrier of zero background cloning vector; And
Adopt EcoRV enzyme to carry out enzyme to carrier before described zero background cloning vector to cut, to obtain zero background cloning vector.
2. method according to claim 1, is characterized in that, provides the DNA fragmentation shown in SEQ ID NO:6 by following steps:
By the primer mixing shown in SEQ ID NO:9-69, to obtain primer mixture;
Second pcr amplification is carried out to described primer mixture, to obtain the second pcr amplification product; And
Utilize the primer shown in SEQ ID NO:9 and SEQ ID NO:69, described second pcr amplification product is carried out the 3rd pcr amplification, to obtain the 3rd pcr amplification product, described 3rd pcr amplification product is the DNA fragmentation shown in SEQ ID NO:6,
Optionally, the reaction system of described second pcr amplification is: the micromolar described primer mixture of 10 microlitre 50,0.5 microlitre high-fidelity DNA polymerase, 10 microlitre 5X the 2nd PCR reaction mixtures, and distilled water complements to 50 microlitres,
Optionally, the response procedures of described second pcr amplification is: 95 DEG C 3 minutes; 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 1 minute, circulate 25 times; 68 DEG C 5 minutes; Be cooled to room temperature,
Optionally, the reaction system of described 3rd pcr amplification is the primer shown in 0.5 microlitre 50 micromole SEQ ID NO:9, primer shown in 0.5 microlitre 50 micromole SEQ ID NO:69,0.5 microlitre high-fidelity DNA polymerase, 10 microlitre 5X the 3rd PCR reaction mixtures, second pcr amplification product described in 1 microlitre, distilled water complements to 50 microlitres
Optionally, the response procedures of described 3rd pcr amplification is: 95 DEG C 3 minutes; 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 2 minutes, circulate 30 times; 68 DEG C 5 minutes; Be cooled to room temperature.
3. method according to claim 1, it is characterized in that, the reaction system of described first pcr amplification is the primer shown in 0.5 microlitre 10 micromole SEQ ID NO:7, primer shown in 0.5 microlitre 10 micromole SEQ ID NO:8,10 nanogram pUC19 plasmids, 0.5 microlitre high-fidelity DNA polymerase, 10 microlitre 5X the one PCR reaction mixtures, distilled water complements to 50 microlitres
Optionally, the response procedures of described first pcr amplification is: 95 DEG C 3 minutes; 94 DEG C 30 seconds, 55 DEG C annealing 30 seconds, 68 DEG C 2 minutes, circulate 30 times; 68 DEG C 5 minutes; Be cooled to room temperature.
4. method according to claim 1, is characterized in that, utilizes gene clone test kit to carry out described homologous recombination,
Optionally, the reaction system of described homologous recombination is: 10 microlitre 2X gene clone reaction mixtures, pUC19 carrier segments described in DNA fragmentation, 2 microlitres described in 5 microlitres, and distilled water complements to 50 microlitres,
Optionally, under room temperature, described homologous recombination is carried out 30 minutes.
5. method according to claim 1, is characterized in that, described competent cell is competent escherichia coli cell DB3.1,
Optionally, at 37 DEG C, carry out described enzyme cut 2-4 hour,
Optionally, the reaction system that described enzyme is cut is: 10 microlitre 10X enzyme cutting buffering liquids, and the front carrier of zero background cloning vector described in 1-10 microgram, 1-10 microlitre 10U/ microlitre EcoRV enzyme, distilled water complements to 100 microlitres.
6. method according to claim 1, is characterized in that, comprises further:
Digestion products is carried out agarose gel electrophoresis, and reclaims the large fragment of purifying about 3000 base, described large fragment is described zero background cloning vector.
7. a zero background cloning vector, it is prepared by the method described in any one of claim 1-6.
8. zero background cloning vector according to claim 7 is preparing the purposes in goal gene cloning vector.
9. purposes according to claim 8, is characterized in that, goal gene fragment is connected with described zero background cloning vector, then transforms, cultivates, screening positive clone, to obtain goal gene cloning vector,
Optionally, rapid ligation buffer and T4DNA ligase enzyme is utilized to carry out described connection,
Optionally, described rapid ligation buffer comprises:
The Tutofusin tris of 20 ~ 200 mmoles;
The magnesium chloride of 5 ~ 50 mmoles;
The dithiothreitol (DTT) of 0.5 ~ 50 mmole;
The deoxyribonucleoside triphosphate of 0.1 ~ 1 mmole;
The Triphosaden of 0.3 ~ 3 mmole;
The hydrochloric acid spermidine of 0.5 ~ 10 mmole; And
The bSA of 50 ~ 1000 mg/ml.
10. prepare a method for goal gene cloning vector, it is characterized in that, comprising:
Goal gene fragment is connected with described zero background cloning vector, then transforms, cultivates, screening positive clone, to obtain goal gene cloning vector,
Optionally, rapid ligation buffer and T4DNA ligase enzyme is utilized to carry out described connection,
Optionally, described rapid ligation buffer comprises:
The Tutofusin tris of 20 ~ 200 mmoles;
The magnesium chloride of 5 ~ 50 mmoles;
The dithiothreitol (DTT) of 0.5 ~ 50 mmole;
The deoxyribonucleoside triphosphate of 0.1 ~ 1 mmole;
The Triphosaden of 0.3 ~ 3 mmole;
The hydrochloric acid spermidine of 0.5 ~ 10 mmole; And
The bSA of 50 ~ 1000 mg/ml,
Optionally, under room temperature, described connection 5-30 minute is carried out.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410520443.3A CN104313044B (en) | 2014-09-30 | 2014-09-30 | Zero-background cloning vector as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410520443.3A CN104313044B (en) | 2014-09-30 | 2014-09-30 | Zero-background cloning vector as well as preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104313044A true CN104313044A (en) | 2015-01-28 |
| CN104313044B CN104313044B (en) | 2017-04-26 |
Family
ID=52368355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410520443.3A Active CN104313044B (en) | 2014-09-30 | 2014-09-30 | Zero-background cloning vector as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104313044B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200074A (en) * | 2015-09-21 | 2015-12-30 | 华侨大学 | Method for constructing cloning vector by means of DNA non-specific binding protein HU protein |
| CN106591341A (en) * | 2017-01-16 | 2017-04-26 | 南宁邦尔克生物技术有限责任公司 | Cloning method for plasmid vector and kit |
| CN107760703A (en) * | 2016-08-23 | 2018-03-06 | 南京理工大学 | A kind of flat end cloning vector pUB857 of zero background and its construction method and application |
| CN112921050A (en) * | 2021-02-26 | 2021-06-08 | 通用生物系统（安徽）有限公司 | High-efficiency zero-background assembly method without homology and multiple long fragments |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101818164A (en) * | 2010-01-14 | 2010-09-01 | 华南理工大学 | False positive-free blunt end cloning vector and preparation method thereof |
| CN102628057B (en) * | 2012-03-21 | 2013-06-19 | 中国科学院武汉病毒研究所 | Vector for non-background directed cloning of PCR products, preparation method thereof and application thereof |
| CN103205449B (en) * | 2013-04-23 | 2014-12-24 | 天根生化科技（北京）有限公司 | Method for quickly cloning genes by using universal buffer liquid |
-
2014
- 2014-09-30 CN CN201410520443.3A patent/CN104313044B/en active Active
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200074A (en) * | 2015-09-21 | 2015-12-30 | 华侨大学 | Method for constructing cloning vector by means of DNA non-specific binding protein HU protein |
| CN107760703A (en) * | 2016-08-23 | 2018-03-06 | 南京理工大学 | A kind of flat end cloning vector pUB857 of zero background and its construction method and application |
| CN106591341A (en) * | 2017-01-16 | 2017-04-26 | 南宁邦尔克生物技术有限责任公司 | Cloning method for plasmid vector and kit |
| CN106591341B (en) * | 2017-01-16 | 2019-06-25 | 南宁邦尔克生物技术有限责任公司 | The cloning process and kit of one plasmid vector |
| CN112921050A (en) * | 2021-02-26 | 2021-06-08 | 通用生物系统（安徽）有限公司 | High-efficiency zero-background assembly method without homology and multiple long fragments |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104313044B (en) | 2017-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Motohashi | A simple and efficient seamless DNA cloning method using SLiCE from Escherichia coli laboratory strains and its application to SLiP site-directed mutagenesis | |
| Wang et al. | Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli | |
| Zhou et al. | Universal TA cloning | |
| Kakirde et al. | Gram negative shuttle BAC vector for heterologous expression of metagenomic libraries | |
| CN113186319B (en) | Primer, kit and method for detecting Nocardia seriolae | |
| US11708576B2 (en) | Recombinant Escherichia coli expressing fusion protein of formamidase and phosphite dehydrogenase and construction method and use thereof | |
| CN104313044A (en) | Zero-background cloning vector as well as preparation method and application thereof | |
| CN107164395B (en) | Molecular marker of algal toxin degrading bacteria, algal toxin degrading bacteria and preparation method of algal toxin degrading bacteria | |
| CN116096892A (en) | Enzyme with RuvC domain | |
| Wong et al. | Genetic tools for streamlined and accelerated pathway engineering in Yarrowia lipolytica | |
| Nguyen et al. | Demonstration of horizontal gene transfer from genetically engineered Thermosynechococcus elongatus BP1 to wild-type E. coli DH5α | |
| Kwon et al. | High-throughput cloning for biophysical applications | |
| CN105087517B (en) | A method of recombination multienzyme complex and the seamless clone of external homologous recombination | |
| CN109593743A (en) | Novel C RISPR/ScCas12a albumen and preparation method thereof | |
| WO2019100431A1 (en) | Tandem dna element capable of enhancing protein synthesis efficiency | |
| CN103205449B (en) | Method for quickly cloning genes by using universal buffer liquid | |
| US11198879B2 (en) | Mixture of cell extract and method for site-directed cloning | |
| CN110863004A (en) | Yeast two-hybrid vector, construction method and application thereof in protein interaction | |
| CN103849640B (en) | A kind of oligonucleotide and the method for plasmid cotransformation for the point mutation of intestinal bacteria indispensable gene can be eliminated | |
| Benbelgacem et al. | Palm Oil Mill Effluent Metagenome for Cellulose-Degrading Enzymes. | |
| CN106834321A (en) | A kind of efficient connection method of DNA fragmentation with carrier and its application and kit | |
| Cotârlet et al. | Comparative study for establishing the efficiency of some methods for chromosomal DNA extraction from cold adapted streptomycetes | |
| US11807901B2 (en) | Methods and kits for using recombinant microorganisms as direct reagents in biological applications | |
| Hasnain et al. | A strategy of TaDof1 cassette development in plant expression vector to enhance nitrogen assimilation in wheat. | |
| CN101195830B (en) | Construction method for large fragment DNA clone carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |