CN106591341A - Cloning method for plasmid vector and kit - Google Patents
Cloning method for plasmid vector and kit Download PDFInfo
- Publication number
- CN106591341A CN106591341A CN201710030080.9A CN201710030080A CN106591341A CN 106591341 A CN106591341 A CN 106591341A CN 201710030080 A CN201710030080 A CN 201710030080A CN 106591341 A CN106591341 A CN 106591341A
- Authority
- CN
- China
- Prior art keywords
- dna
- gene
- digestion
- restriction enzyme
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a cloning method for a plasmid vector and a kit. The method comprises the following steps: amplifying a plasmid so as to obtain two DNA fragments, allowing the two DNA fragments to include two functional genes, i.e., a replicon and a resistant gene screening marker, respectively, and subjecting the two DNA fragments to enzyme digestion and connection so as to form the whole sequences of complete functional replicon and resistant gene screening marker genes; and subjecting the two fragments and a target DNA fragment to digestion with restriction endonuclease capable of being digested into sticky ends, carrying out connection by using T7 DNA ligase or E. coli DNA ligase, and then carrying out transformation into a homologous recombinant Escherichia coli strain with functional defect for screening. The kit is composed of the two DNA fragments obtained after amplification of the plasmid, digestion with the restriction endonuclease and purification. The cloning method and kit provided by the invention have the characteristics that 1) the cloning efficiency of the target DNA fragment is improved, and false positive results are reduced; and 2) the kit is convenient and fast to use.
Description
Technical field
The invention belongs to biology field.It is related to the cloning process of a plasmid vector, specifically a kind of plasmid is carried
The cloning process and kit of body.
Background technology
It is to pick up by oneself or buy plasmid to build plasmid recon usual way, through a series of steps such as digestion, connection, conversion
Suddenly, finally screening obtains positive transformant.Existing enzyme incision technology is it cannot be guaranteed that complete, therefore the plasmid of endonuclease reaction 100%
Can there is the plasmid of non-digestion and the plasmid of single endonuclease digestion after carrier digestion, can not be thorough using methods such as agarose gel purifications
Remove.The plasmid of single endonuclease digestion in subsequent coupled reaction can recirculation again, form plasmid.Although the plasmid of single endonuclease digestion is carried
Body Jing dephosphorylations can be reduced and connected certainly.The plasmid of these non-digestions and the plasmid of single endonuclease digestion can cause subsequently to screen positive transformant
When there is empty carrier.
The content of the invention
First purpose of the present invention is to provide the cloning process of a plasmid vector.
Second object of the present invention is to provide a kind of kit for plasmid vector clone.
Plasmid vector can be stable hereditary in Host Strains, it usually needs while the condition for meeting has：DNA is formed and closed
Close circulus, indicate with replicon and resistant gene screening.
The technical scheme that the present invention solves above-mentioned technical problem is as follows：
1. the cloning process of a plasmid vector
It by plasmid amplification is two DNA fragmentations that this method is, makes the two fragments respectively containing replicon or resistant gene
Selection markers the two functional genes, respectively use can be cut into the restriction enzyme of viscous end for the two fragments and target DNA fragment
Enzyme digestion, then be attached with the high T7 DNA ligases of viscous end joint efficiency or E.coli DNA ligases, it is transformed into same
The Escherichia coli of source recombination function defect are screened.
Concrete operation step is as follows：
1) synthetic primer, is two DNA fragmentations with PCR method amplification plasmid vector；In the two DNA fragmentations, wherein one
Terminal sequence containing enzyme A in restrictive and：A. two DNA fragmentations are respectively containing replicon or resistant gene selection markers the two work(
The full sequence of energy gene；Or mono- section of full sequence containing replicon functional gene of b. and resistant gene selection markers function base
The partial gene sequence of cause, and it can be complete with the functional gene sequence complementation of leading portion resistant gene selection markers that another section then contains
The gene order of resistance function；Or mono- section of full sequence containing resistant gene selection markers functional gene of c. and duplication subfunction
The partial gene sequence of gene, and it can complementary with leading portion replicon functional gene sequence be complete copy function that another section then contains
Gene order.
Just constitute after this two segment DNAs sequence carries out digestion, coupled reaction with restriction enzyme A complete replicon,
Resistant gene selection markers functional gene.
The other end of the two DNA fragmentations contains restriction enzyme B, C.
Further, restriction enzyme B, C is on MCS (multiple cloning site, MCS)
Enzyme.
2) template is digested with Dpn I.
3) the two DNA fragmentation restriction enzyme A digestions, the DNA fragmentation that obtains after purification are respectively designated as DNA pieces
Section 1, DNA fragmentation 2.
DNA fragmentation 1, DNA fragmentation 2 use respectively restriction enzyme B, C digestion, purifying；Target DNA fragment is with restricted
Enzyme cutting B, C digestion, purifying.
4) these three DNA fragmentations are attached.
5) competent escherichia coli cell is converted, is coated in screening flat board and cultivates.
6) screen.
Above-mentioned restriction enzyme A, B, C are the enzyme that can be cut into cohesive end.
Above-mentioned ligase is T7 DNA ligases or E.coli DNA ligases.
Above-mentioned competent cell is Escherichia coli, and its bacterial strain is AG1, BLR, DB3.1, DC10B, DH1, DH5 α, DH5 α
pir、DH5αpir116variant、DH10B、DH12S、E.cloni(r)5alpha、E.cloni(r)10G、E.cloni(r)
10GF'、EPI300、ER2267、HB101、HMS174(DE3)、High-Control(tm)10G、IJ1126、IM01B、IM08B、
IM30B、IM93B、JM108、JM109、Mach1、MFDpir、OmniMAX2、SM10(λpir)、STBL2、STBL4、SURE、
SURE2、TOP10、Top10F'、XL1-Blue、XL1-Blue MRF'、XL2-Blue、XL2-Blue MRF'、XL10-Gold、
Prepared by XL10-Gold KanR and its derivative strain.
2. a kind of kit of the clone for plasmid vector
A kit is constituted with a kind of above-mentioned DNA fragmentation 1 of the cloning process of plasmid vector, DNA fragmentation 2, -20 DEG C cold
Freeze and preserve, ice bath thaws when using.
The present invention has several technical characterstics：
1) plasmid fragments of PCR amplifications digest template with Dpn I, eliminate the pollution of plasmid empty carrier.
2) two segment DNA fragments of the plasmid vector of PCR amplifications are single respectively containing replicon or resistant gene selection markers
Even if fragment recirculation in subsequent reaction can not grow in screening flat board.
3) two fragments of PCR amplifications plasmid are the DNA fragmentation of flat end or 3 ' ends with " A " base, the two
DNA fragmentation and target DNA fragment use can be cut into the digestion with restriction enzyme of viscous end；Coupled reaction is using viscous end connection effect
The high T7 DNA ligases of rate or E.coli DNA ligases.If two DNA fragmentation enzymes for obtaining PCR amplification plasmid vectors
Cut and thoroughly be not also difficult to connect, reduce the formation of empty carrier.
4) Host Strains are using recombination deficient mutant coli strain and its derivative strain.This kind of bacterium homologous recombination function lacks
Lose, even if making two segment DNA fragments of the plasmid vector of PCR amplifications thorough without digestion, it is also difficult to which homologous recombination forms ring-type matter
Grain.
5) kit is easy to use made by this method, alternative almost all of commercial plasmids.
Specific embodiment
With reference to specific embodiment, the present invention is described in further detail.It should be understood that these embodiments are intended merely to
The present invention is illustrated, rather than limits the scope of the present invention by any way.
Embodiment 1
PCR expands respectively the ori (replicon) and AmpR (ampicillin resistance gene) of plasmid vector pUC19 and makes examination
The clone of agent box and bacillus subtilis saccharase gene, specific operating procedure is as follows：
1. the preparation of kit
Concrete operations are as follows：
Synthetic primer：
M13F:5'TGTAAAACGACGGCCAGT 3',
OR:5'TCCAGATCTCGTCAGACCCCGTAGAAA 3'(underscores are the restriction enzyme sites of Bgl II)
AMPR:5'AAGAGATCTTGAGTAAACTTGGTCTGA 3'(underscores are the restriction enzyme sites of Bgl II)
M13R:5'CAGGAAACAGCTATGAC 3'。
It is flat end with primer M13F/OR, AMPR/M13R and product with plasmid vector pUC19 as template
PrimeSTAR HS DNA Polymerase (TAKARA) expands respectively the ori and MCS, AmpR and MCS of pUC19, reaction system
And condition is as follows：
Reaction system is designed as 100uL total systems, specifically 5 × PCR Buffer (buffer solution) 20uL, and concentration is 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration for 10mM each 2uL of upstream and downstream primer, concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), are mended with aqua sterilisa
Sufficient 100uL systems.
Reaction condition is：94 DEG C of 3min denaturations, 94 DEG C of 30s denaturation in circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；72 DEG C are continued to extend 10min after PCR reaction cycles, then 16 DEG C of preservations.
Amplified production purifies respectively QIAquick Gel Extraction Kit (TIANGEN) with DNA carries out Ago-Gel recovery purifying, M13F/
The purpose fragment about 1.6kb that the purpose fragment about 1.1kb that OR is reclaimed, AMPR/M13R are reclaimed.QuickCut Dpn Ⅰ(TAKARA)
Digestion template, after purification, then with QuickCut Bgl II (TAKARA) digestion, purifying.Fragment Jing of primer M13F/OR amplifications
DNA fragmentation 1 is named as after above-mentioned process, the fragment of primer AMPR/M13R amplifications is named as DNA fragmentation 2 Jing after above-mentioned process.
, containing ori functional genes and MCS, containing AmpR functional genes and MCS, the two fragments are in Bgl II for DNA fragmentation 2 for DNA fragmentation 1
Complete ori and AmpR functional genes are may make up after the connection of site.The kit of the present embodiment is by DNA fragmentation 1, the structure of DNA fragmentation 2
Into, -20 DEG C of several months can be stored in, ice bath thaws when using.
2. the clone of bacillus subtilis saccharase gene
A.PCR expands bacillus subtilis saccharase gene
The target DNA fragment of this experiment is the invertase base obtained from bacillus subtilis WB600 genomic DNA amplifications
Cause.
Design primer：
SU980：5'GAGGGATCCATGACAGCACATGACCAGGA 3', (underscore is the restriction enzyme sites of BamH I)
SU981：5'GAACTGCAGAGATGGCTCAGATTTCACAT 3'(underscores are the restriction enzyme sites of Pst I)
With bacillus subtilis WB600 genomic DNAs template, expanded with primer SU980/SU981 PCR.Reaction system
And condition is as follows：
Reaction system is designed as 100uL total systems, specifically 5 × PCR Buffer (buffer solution) 20uL, and concentration is 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration for 10mM each 2uL of upstream and downstream primer, concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), are mended with aqua sterilisa
Sufficient 100uL systems.
Reaction condition is：94 DEG C of 3min denaturations, 94 DEG C of 30s denaturation in circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；72 DEG C are continued to extend 10min after PCR reaction cycles, then 16 DEG C of preservations.
Amplified production purifies respectively QIAquick Gel Extraction Kit (TIANGEN) with DNA carries out Ago-Gel recovery purifying, recovery
Purpose fragment about 1.5kb,
B. digestion, connection and conversion
Bacillus subtilis saccharase gene QuickCut I/QuickCut of Pst BamH I that PCR amplifications are obtained
(TAKARA) double digestion, purifying, are named as SUC fragments.
The kit in the present embodiment is taken out from -20 DEG C of refrigerators, ice bath thaws.The QuickCut Pst I of DNA fragmentation 1
(TAKARA) digestion, QuickCut BamH I (TAKARA) digestion of DNA fragmentation 2, purifies respectively.Wherein Pst I, BamH I
It is the restriction enzyme of MCS.
Jing digestions, DNA fragmentation 1 after purification, DNA fragmentation 2 and tri- fragment E.coli DNA ligases of SUC
(TAKARA) connect, linked system is：
10×E.coli DNA Ligase Buffer:1uL,
10×BSA：1uL,
DNA fragmentation 1:2uL,
DNA fragmentation 2:2uL,
SUC:2uL,
E.coli DNA Ligase:1uL,
Reaction condition stands overnight for 16 DEG C.
Using bacillus coli DH 5 alpha as Host Strains, competent cell is made.It is big that previous step connection product is transformed into competence
Enterobacteria DH5 α, are coated in screening flat board, 37 DEG C of incubated overnights.Screening flat board is the LB flat boards containing 100ug/mL Amp, its
Surface adds 40mL X-gal liquid storages and 4 μ l IPTG liquid storages, is smoothened solution with aseptic glass rod, 3-4 is placed at being placed in 37 DEG C little
When, the liquid for making media surface is absorbed completely.
3) screening and result
When single bacterium colony in screening flat board grows to suitable size, flat board is placed in into 4 DEG C of a few hours, makes colour developing complete.Statistics
As a result such as following table：
Embodiment 2
PCR expand respectively plasmid vector pUC19ori (replicon) can complementary two parts sequence for complete function gene and
AmpR (ampicillin resistance gene) repertoires gene order makes kit and bacillus subtilis saccharase gene
Clone, specific operating procedure is as follows：
1) preparation of kit
Concrete operations are as follows：
Design primer：
M13F:5'TGTAAAACGACGGCCAGT 3',
OR1:5'CACCGCCTACATACCTC 3',
OR21:5'TCAGTTCGGTGTAGGTC 3',
M13R:5'CAGGAAACAGCTATGAC 3'。
It is flat end with primer M13F/OR1, OR21/M13R and product with plasmid vector pUC19 as template
PrimeSTAR HS DNA Polymerase (TAKARA) expands respectively the part ori sequences and MCS of pUC19, part ori sequences
Row, whole AmpR and MCS, reaction system and condition it is as follows：
Reaction system is designed as 100uL total systems, specifically 5 × PCR Buffer (buffer solution) 20uL, and concentration is 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration for 10mM each 2uL of upstream and downstream primer, concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), are mended with aqua sterilisa
Sufficient 100uL systems.
Reaction condition is：94 DEG C of 3min denaturations, 94 DEG C of 30s denaturation in circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；72 DEG C are continued to extend 10min after PCR reaction cycles, then 16 DEG C of preservations.
Amplified production purifies respectively QIAquick Gel Extraction Kit (TIANGEN) with DNA carries out Ago-Gel recovery purifying, M13F/
The purpose fragment about 1.9kb that the purpose fragment about 0.9kb that OR1 is reclaimed, OR21/M13R are reclaimed.QuickCut Dpn Ⅰ
(TAKARA) template, after purification is digested, then with QuickCut AlwN I (NEB) digestion, purifying.Primer M13F/OR1 amplifications
Fragment is named as DNA fragmentation 1 Jing after above-mentioned process, and the fragment of primer OR21/M13R amplifications is named as DNA pieces Jing after above-mentioned process
Section 2, containing part ori functional genes and MCS, DNA fragmentation 2 is containing part ori functional genes, whole AmpR work(for DNA fragmentation 1
Energy gene and MCS, two fragments may make up complete ori and AmpR functional genes after the connection of the sites of AlwN I.The present embodiment
Kit be made up of DNA fragmentation 1, DNA fragmentation 2, -20 DEG C of several months can be stored in, ice bath thaws when using.
2) clone of bacillus subtilis saccharase gene
A.PCR expands bacillus subtilis saccharase gene
The target DNA fragment of this experiment is the invertase base obtained from bacillus subtilis WB600 genomic DNA amplifications
Cause.
Design primer：
SU980：5'GAGGGATCCATGACAGCACATGACCAGGA 3', (underscore is the restriction enzyme sites of BamH I)
SU981：5'GAACTGCAGAGATGGCTCAGATTTCACAT 3'(underscores are the restriction enzyme sites of Pst I)
With bacillus subtilis WB600 genomic DNAs template, expanded with primer SU980/SU981PCR.Reaction system
And condition is as follows：
Reaction system is designed as 100uL total systems, specifically 5 × PCR Buffer (buffer solution) 20uL, and concentration is 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration for 10mM each 2uL of upstream and downstream primer, concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), are mended with aqua sterilisa
Sufficient 100uL systems.
Reaction condition is：94 DEG C of 3min denaturations, 94 DEG C of 30s denaturation in circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；72 DEG C are continued to extend 10min after PCR reaction cycles, then 16 DEG C of preservations.
Amplified production purifies respectively QIAquick Gel Extraction Kit (TIANGEN) with DNA carries out Ago-Gel recovery purifying, recovery
Purpose fragment about 1.5kb,
B. digestion, connection and conversion
Bacillus subtilis saccharase gene QuickCut I/QuickCut of Pst BamH I that PCR amplifications are obtained
(TAKARA) double digestion, purifying, are named as SUC fragments.
The kit in the present embodiment is taken out from -20 DEG C of refrigerators, ice bath thaws.The QuickCut Pst I of DNA fragmentation 1
(TAKARA) digestion, QuickCut BamH I (TAKARA) digestion of DNA fragmentation 2, purifies respectively.Wherein Pst I, BamH I
It is the restriction enzyme of MCS.
Jing digestions, DNA fragmentation 1 after purification, DNA fragmentation 2 and tri- fragment E.coli DNA ligases of SUC
(TAKARA) connect, linked system is：
10×E.coli DNA Ligase Buffer:1uL,
10×BSA：1uL,
DNA fragmentation 1:2uL,
DNA fragmentation 2:2uL,
SUC:2uL,
E.coli DNA Ligase:1uL,
Reaction condition stands overnight for 16 DEG C.
Using bacillus coli DH 5 alpha as Host Strains, competent cell is made.It is big that previous step connection product is transformed into competence
Enterobacteria DH5 α, are coated in screening flat board, 37 DEG C of incubated overnights.Screening flat board is the LB flat boards containing 100ug/mL Amp, its
Surface adds 40mL X-gal liquid storages and 4 μ l IPTG liquid storages, is smoothened solution with aseptic glass rod, 3-4 is placed at being placed in 37 DEG C little
When, the liquid for making media surface is absorbed completely.
3) screening and result
When single bacterium colony in screening flat board grows to suitable size, flat board is placed in into 4 DEG C of a few hours, makes colour developing complete.Statistics
As a result such as following table：
Embodiment 3
PCR expands respectively plasmid vector pUC19AmpR (ampicillin resistance gene) can be complementary for complete function gene
Partial sequence and ori (replicon) repertoires gene order make kit and bacillus subtilis saccharase gene gram
Grand, specific operating procedure is as follows：
1) preparation of kit
Concrete operations are as follows：
Design primer：
M13F:5'TGTAAAACGACGGCCAGT 3',
Cfr2:5'GCTGGCTGGTTTATTG 3'
Cfr1:5'CGGGAGGGCTTACCAT 3'
M13R:5'CAGGAAACAGCTATGAC 3'。
It is flat end with primer M13F/Cfr2, Cfr1/M13R and product with plasmid vector pUC19 as template
PrimeSTAR HS DNA Polymerase (TAKARA) expands respectively the part AmpR sequences and MCS of pUC19, part AmpR,
Whole ori sequences and MCS, reaction system and condition it is as follows：
Reaction system is designed as 100uL total systems, specifically 5 × PCR Buffer (buffer solution) 20uL, and concentration is 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration for 10mM each 2uL of upstream and downstream primer, concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), are mended with aqua sterilisa
Sufficient 100uL systems.
Reaction condition is：94 DEG C of 3min denaturations, 94 DEG C of 30s denaturation in circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；72 DEG C are continued to extend 10min after PCR reaction cycles, then 16 DEG C of preservations.
Amplified production purifies respectively QIAquick Gel Extraction Kit (TIANGEN) with DNA carries out Ago-Gel recovery purifying, M13F/
The purpose fragment about 1.4kb that Cfr2 and Cfr1/M13R is reclaimed.QuickCut Dpn I (TAKARA) digestion templates, after purification,
Cfr10 I (TAKARA) digestion, purifying are used again.The fragment of primer M13F/Cfr2 amplifications is named as DNA fragmentation Jing after above-mentioned process
The fragment of 1, primer Cfr1/M13R amplification is named as DNA fragmentation 2 Jing after above-mentioned process, and DNA fragmentation 1 contains part AmpR functions
Gene and MCS, containing part AmpR functional genes, whole ori functional genes and MCS, two fragments are in Cfr10 for DNA fragmentation 2
Complete ori and AmpR functional genes are may make up after the connection of I site.The kit of the present embodiment is by DNA fragmentation 1, DNA fragmentation 2
Constitute, -20 DEG C of several months can be stored in, ice bath thaws when using.
2) clone of bacillus subtilis saccharase gene
A.PCR expands bacillus subtilis saccharase gene
The target DNA fragment of this experiment is the invertase base obtained from bacillus subtilis WB600 genomic DNA amplifications
Cause.
Design primer：
SU980：5'GAGGGATCCATGACAGCACATGACCAGGA 3', (underscore is the restriction enzyme sites of BamH I)
SU981：5'GAACTGCAGAGATGGCTCAGATTTCACAT 3'(underscores are the restriction enzyme sites of Pst I)
With bacillus subtilis WB600 genomic DNAs template, expanded with primer SU980/SU981PCR.Reaction system
And condition is as follows：
Reaction system is designed as 100uL total systems, specifically 5 × PCR Buffer (buffer solution) 20uL, and concentration is 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration for 10mM each 2uL of upstream and downstream primer, concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), are mended with aqua sterilisa
Sufficient 100uL systems.
Reaction condition is：94 DEG C of 3min denaturations, 94 DEG C of 30s denaturation in circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；72 DEG C are continued to extend 10min after PCR reaction cycles, then 16 DEG C of preservations.
Amplified production purifies respectively QIAquick Gel Extraction Kit (TIANGEN) with DNA carries out Ago-Gel recovery purifying, recovery
Purpose fragment about 1.5kb,
B. digestion, connection and conversion
Bacillus subtilis saccharase gene QuickCut I/QuickCut of Pst BamH I that PCR amplifications are obtained
(TAKARA) double digestion, purifying, are named as SUC fragments.
The kit in the present embodiment is taken out from -20 DEG C of refrigerators, ice bath thaws.The QuickCut Pst I of DNA fragmentation 1
(TAKARA) digestion, QuickCut BamH I (TAKARA) digestion of DNA fragmentation 2, purifies respectively.Wherein Pst I, BamH I
It is the restriction enzyme of MCS.
Jing digestions, DNA fragmentation 1 after purification, DNA fragmentation 2 and tri- fragment E.coli DNA ligases of SUC
(TAKARA) connect, linked system is：
10×E.coli DNA Ligase Buffer:1uL,
10×BSA：1uL,
DNA fragmentation 1:2uL,
DNA fragmentation 2:2uL,
SUC:2uL,
E.coli DNA Ligase:1uL,
Reaction condition stands overnight for 16 DEG C.
Using bacillus coli DH 5 alpha as Host Strains, competent cell is made.It is big that previous step connection product is transformed into competence
Enterobacteria DH5 α, are coated in screening flat board, 37 DEG C of incubated overnights.Screening flat board is the LB flat boards containing 100ug/mL Amp, its
Surface adds 40mL X-gal liquid storages and 4 μ l IPTG liquid storages, is smoothened solution with aseptic glass rod, 3-4 is placed at being placed in 37 DEG C little
When, the liquid for making media surface is absorbed completely.
3) screening and result
When single bacterium colony in screening flat board grows to suitable size, flat board is placed in into 4 DEG C of a few hours, makes colour developing complete.Statistics
As a result such as following table：
SEQUENCE LISTING
<110>Nanning Bangerke Biotechnology Co., Ltd
<120>The cloning process and kit of one plasmid vector
<140>
<160> 10
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>For expanding the DNA sequence dna of pUC19 MCS
<400> 1
TGTAAAACGA CGGCCAGT 18
<210> 2
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>For expanding the DNA sequence dna of pUC19 MCS
<400> 2
CAGGAAACAG CTATGAC 17
<210> 3
<211> 29
<212> DNA
<213>Artificial sequence
<220>
<223>For expanding the DNA sequence dna of bacillus subtilis WB600 genome saccharase genes
<400> 3
GAGGGATCCA TGACAGCACA TGACCAGGA 29
<210> 4
<211> 29
<212> DNA
<213>Artificial sequence
<220>
<223>For expanding the DNA sequence dna of bacillus subtilis WB600 genome saccharase genes
<400> 4
GAACTGCAGA GATGGCTCAG ATTTCACAT 29
<210> 5
<211> 27
<212> DNA
<213>Artificial sequence
<220>
<223>For expanding the DNA sequence dna of pUC19 ori
<400> 5
TCCAGATCTC GTCAGACCCC GTAGAAA 27
<210> 6
<211> 27
<212> DNA
<213>Artificial sequence
<220>
<223>For expanding the DNA sequence dna of pUC19 AmpR
<400> 6
AAGAGATCTT GAGTAAACTT GGTCTGA 27
<210> 7
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>Can the complementary DNA sequence dna for complete ori functional genes for expanding pUC19
<400> 7
CACCGCCTAC ATACCTC 17
<210> 8
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>Can the complementary DNA sequence dna for complete ori functional genes for expanding pUC19
<400> 8
TCAGTTCGGT GTAGGTC 17
<210> 9
<211> 16
<212> DNA
<213>Artificial sequence
<220>
<223>Can the complementary DNA sequence dna for complete AmpR functional genes for expanding pUC19
<400> 9
GCTGGCTGGT TTATTG 16
<210> 10
<211> 16
<212> DNA
<213>Artificial sequence
<220>
<223>Can the complementary DNA sequence dna for complete AmpR functional genes for expanding pUC19
<400> 10
CGGGAGGGCT TACCAT 16
Claims (5)
1. the cloning process of a plasmid vector, it is characterised in that it by plasmid amplification is two DNA fragmentations to be, makes the two pieces
Section respectively containing replicon or resistant gene selection markers the two functional genes, with target DNA fragment distinguish by the two fragments
With the digestion with restriction enzyme that can be cut into viscous end, then with the high T7DNA ligases of viscous end joint efficiency or E.coli
DNA ligase is attached, and the Escherichia coli for being transformed into homologous recombination functional defect are screened, and specific operating procedure is such as
Under：
1) synthetic primer, is two DNA fragmentations with PCR method amplification plasmid vector；
In the two DNA fragmentations, wherein a terminal sequence contain restriction enzyme A, two DNA fragmentations respectively containing replicon or
The full sequence of resistant gene selection markers the two functional genes or one section of full sequence containing replicon functional gene and
The partial gene sequence of resistant gene selection markers functional gene, and another section then containing can be with leading portion resistant gene selection markers
The complementary gene order for complete resistance function of functional gene sequence or one section are containing resistant gene selection markers functional gene
The partial gene sequence of full sequence and replicon functional gene, and another section then containing can be with leading portion replicon functional gene sequence
The complementary gene order for complete copy function of row；
Complete replicon, resistance are just constituted after this two segment DNAs sequence carries out digestion, coupled reaction with restriction enzyme A
Genescreen mark function gene；
The other end of the two DNA fragmentations contains restriction enzyme B, C；
Further, restriction enzyme B, C is the enzyme on MCS (multiple cloning site, MCS)；
2) digestion of Dpn I template；
3) the two DNA fragmentations restriction enzyme A digestion, the DNA fragmentation for obtaining after purification be respectively designated as DNA fragmentation 1,
DNA fragmentation 2, DNA fragmentation 1, DNA fragmentation 2 use respectively restriction enzyme B, C digestion, purifying；Target DNA fragment is with restricted
Restriction endonuclease B, C digestion, purifying；
4) three DNA fragmentations are attached；
5) competent escherichia coli cell is converted, is coated in screening flat board and cultivates；
6) screen.
2. the cloning process of a plasmid vector according to claim 1, it is characterised in that restriction enzyme A, B, C
For the enzyme of cohesive end can be cut into.
3. the cloning process of a plasmid vector according to claim 1, it is characterised in that ligase used is T7
DNA ligase or E.coli DNA ligases.
4. the cloning process of a plasmid vector according to claim 1, it is characterised in that described coli strain
For AG1, BLR, DB3.1, DC10B, DH1, DH5 α, DH5 α pir, DH5 α pir116variant, DH10B, DH12S, E.cloni
(r)5alpha、E.cloni(r)10G、E.cloni(r)10GF'、EPI300、ER2267、HB101、HMS174(DE3)、High-
Control(tm)10G、IJ1126、IM01B、IM08B、IM30B、IM93B、JM108、JM109、Mach1、MFDpir、
OmniMAX2、SM10(λpir)、STBL2、STBL4、SURE、SURE2、TOP10、Top10F'、XL1-Blue、XL1-Blue
MRF', XL2-Blue, XL2-Blue MRF', XL10-Gold, XL10-Gold KanR and its derivative strain.
5. a kind of kit of the clone for plasmid vector, it is characterised in that kit is by the DNA fragmentation in claim 1
1st, DNA fragmentation 2 is constituted, the freezen protective under the conditions of -20 DEG C, and ice bath thaws when using.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710030080.9A CN106591341B (en) | 2017-01-16 | 2017-01-16 | The cloning process and kit of one plasmid vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710030080.9A CN106591341B (en) | 2017-01-16 | 2017-01-16 | The cloning process and kit of one plasmid vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106591341A true CN106591341A (en) | 2017-04-26 |
| CN106591341B CN106591341B (en) | 2019-06-25 |
Family
ID=58585886
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710030080.9A Active CN106591341B (en) | 2017-01-16 | 2017-01-16 | The cloning process and kit of one plasmid vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591341B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333537A (en) * | 2007-06-29 | 2008-12-31 | 浙江工业大学 | Expression type pre-T vector, preparation thereof and applications |
| CN102719471A (en) * | 2012-06-05 | 2012-10-10 | 中国科学院广州生物医药与健康研究院 | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium |
| CN102787114A (en) * | 2012-08-11 | 2012-11-21 | 复旦大学 | Efficient directional seamless DNA (deoxyribonucleic acid) segment connecting method |
| CN104109685A (en) * | 2013-12-19 | 2014-10-22 | 首都医科大学 | Biomedical molecule cloning method |
| CN104313044A (en) * | 2014-09-30 | 2015-01-28 | 天根生化科技（北京）有限公司 | Zero-background cloning vector as well as preparation method and application thereof |
| CN105400809A (en) * | 2015-12-21 | 2016-03-16 | 生工生物工程（上海）股份有限公司 | Cloning vector and preparation and application thereof |
-
2017
- 2017-01-16 CN CN201710030080.9A patent/CN106591341B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333537A (en) * | 2007-06-29 | 2008-12-31 | 浙江工业大学 | Expression type pre-T vector, preparation thereof and applications |
| CN102719471A (en) * | 2012-06-05 | 2012-10-10 | 中国科学院广州生物医药与健康研究院 | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium |
| CN102787114A (en) * | 2012-08-11 | 2012-11-21 | 复旦大学 | Efficient directional seamless DNA (deoxyribonucleic acid) segment connecting method |
| CN104109685A (en) * | 2013-12-19 | 2014-10-22 | 首都医科大学 | Biomedical molecule cloning method |
| CN104313044A (en) * | 2014-09-30 | 2015-01-28 | 天根生化科技（北京）有限公司 | Zero-background cloning vector as well as preparation method and application thereof |
| CN105400809A (en) * | 2015-12-21 | 2016-03-16 | 生工生物工程（上海）股份有限公司 | Cloning vector and preparation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106591341B (en) | 2019-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wasels et al. | A two-plasmid inducible CRISPR/Cas9 genome editing tool for Clostridium acetobutylicum | |
| Song et al. | CRISPR-Cas9D10A nickase-assisted genome editing in Lactobacillus casei | |
| Stabb et al. | RP4-based plasmids for conjugation between Escherichia coli and members of the Vibrionaceae | |
| Martinez-Morales et al. | Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons used during construction | |
| TW201829773A (en) | Cas9 expression plasmid, gene editing system of escherichia coli and method thereof | |
| CN106676119B (en) | The seamless genetic manipulation carrier of bacterium and its construction method and application | |
| CN104212830B (en) | A kind of bacillus subtilis Self-controlled expression system and construction method thereof and application | |
| CN103361376B (en) | Riemerella anatipestifer-escherichia coli shuttle expression vector as well as construction method and application thereof | |
| WO2017045281A1 (en) | Vibrio universal suicide vector for gene knockout and use thereof | |
| CN105505975A (en) | Bacillus gene traceless knockout/knockin plasmid and method, and kit | |
| JP2017018061A (en) | Method for producing transformant | |
| JP2022524044A (en) | Pool-type genome editing of microorganisms | |
| JP2009524406A (en) | Modular genomes for synthetic biology and metabolic engineering | |
| CN109929788B (en) | Bacterial strain with ccdB negative screening effect and construction method thereof | |
| CN106591341B (en) | The cloning process and kit of one plasmid vector | |
| CN112980891B (en) | Coli genome editing tool based on CRISPR-Cas | |
| BRPI0811501B1 (en) | Expression system for producing one or more target polypeptide(s), their use, and method for producing an antibiotic-free target polypeptide | |
| CN105002129B (en) | The Shewanella WP3 bacterial strain and its construction method of the height engagement rate of transform and application | |
| WO2023015870A1 (en) | Method for constructing strain for producing recombinant protein containing unnatural amino acids, and strain obtained therefrom | |
| Emmerson et al. | Generation of gene deletions and gene replacements in Escherichia coli O157: H7 using a temperature sensitive allelic exchange system | |
| CN103614408A (en) | prcK gene knocked-out suicide plasmid pYTKLKRT and construction method thereof | |
| Matsumoto-Mashimo et al. | A new family of conditional replicating plasmids and their cognate Escherichia coli host strains | |
| CN101899431B (en) | Rapid and efficient DNA recombination method and kit | |
| CN106754606A (en) | The screening technique of the unmarked deletion mutant of citrus processing hfq genes | |
| WO2006051127A1 (en) | Control of gene expression with the use of a transcription attenuator |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |