CN106591341B - The cloning process and kit of one plasmid vector - Google Patents
The cloning process and kit of one plasmid vector Download PDFInfo
- Publication number
- CN106591341B CN106591341B CN201710030080.9A CN201710030080A CN106591341B CN 106591341 B CN106591341 B CN 106591341B CN 201710030080 A CN201710030080 A CN 201710030080A CN 106591341 B CN106591341 B CN 106591341B
- Authority
- CN
- China
- Prior art keywords
- dna
- digestion
- dna fragmentation
- kit
- restriction enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the cloning process of a plasmid vector and kits.1. it is two DNA fragmentations that method, which is by plasmid amplification, the two segments are made to contain replicon or resistant gene selection markers the two functional genes respectively, the two segments just constitute the full sequence of complete replicon, resistant gene selection markers functional gene after digestion, connection.Use can be cut into the digestion with restriction enzyme of viscous end respectively for the two segments and target DNA fragment, then be attached with T7DNA ligase or E.coli DNA ligase, and the Escherichia coli for being transformed into homologous recombination functional defect are screened.2. kit by above-mentioned from plasmid amplification, and after digestion with restriction enzyme, purification process two DNA fragmentations composition.Feature of the present invention: 1) improving the cloning efficiency of target DNA fragment, reduces false positive；2) kit is easy to use, quick.
Description
Technical field
The invention belongs to molecular biology fields.It is related to the cloning process of a plasmid vector, specifically a kind of plasmid carries
The cloning process and kit of body.
Background technique
Building plasmid recon usual way is self-carry or purchase plasmid, by a series of steps such as digestion, connection, conversion
Suddenly, finally screening obtains positive transformant.Existing enzyme incision technology cannot be guaranteed the complete of endonuclease reaction 100%, therefore plasmid
Can there are the plasmid of non-digestion and the plasmid of single endonuclease digestion after carrier digestion, it can not be thorough using the methods of agarose gel purification
It removes.The plasmid of single endonuclease digestion in subsequent connection reaction can recirculation again, form plasmid.Although the plasmid of single endonuclease digestion carries
Body can be reduced through dephosphorylation to be connected certainly.The plasmid of these non-digestions and the plasmid of single endonuclease digestion will cause then screening positive transformant
When there is empty carrier.
Summary of the invention
The first purpose of the invention is to provide the cloning process of a plasmid vector.
A second object of the present invention is to provide a kind of kits for plasmid vector clone.
Plasmid vector can stablize heredity in host strain, it usually needs while the condition met has: Plasmid DNA formation is closed
It closes cyclic structure, there is replicon and resistant gene screening mark.
The technical scheme to solve the above technical problems is that
1. the cloning process of a plasmid vector
It is two DNA fragmentations that this method, which is by plasmid amplification, the two segments is made to contain replicon or resistant gene respectively
The two functional genes of selection markers, the two segments and target DNA fragment are respectively with the restriction enzyme that can be cut into viscous end
Enzyme digestion, then be attached with viscous end joint efficiency high T7 DNA ligase or E.coli DNA ligase, it is transformed into same
The Escherichia coli of source recombination function defect are screened.
Specific steps are as follows:
1) synthetic primer is two DNA fragmentations with PCR method amplification plasmid vector；In the two DNA fragmentations, wherein one
Terminal sequence containing enzyme A in restrictive and: two DNA fragmentations of a. contain replicon or resistant gene selection markers the two function respectively
The full sequence of energy gene；Or mono- section of full sequence containing replicon functional gene of b. and resistant gene selection markers function base
The partial gene sequence of cause, and another section then containing can it is complementary with leading portion resistant gene selection markers functional gene sequence be complete
The gene order of resistance function；Or mono- section of full sequence containing resistant gene selection markers functional gene of c. and duplication subfunction
The partial gene sequence of gene, and another section, which then contains, complementary with leading portion replicon functional gene sequence to be complete copy function
Gene order.
When this two segment DNAs sequence with restriction enzyme A carry out digestion, connection react after just constitute complete replicon,
Resistant gene selection markers functional gene.
The other end of the two DNA fragmentations contains restriction enzyme B, C.
Further, restriction enzyme B, C is on multiple cloning sites (multiple cloning site, MCS)
Enzyme.
2) template is digested with Dpn I.
3) the restriction enzyme A digestion of the two DNA fragmentations, the DNA fragmentation obtained after purification are respectively designated as DNA piece
Section 1, DNA fragmentation 2.
DNA fragmentation 1, DNA fragmentation 2 use restriction enzyme B, C digestion, purifying respectively；Target DNA fragment is in restricted
Enzyme cutting B, C digestion, purifying.
4) these three DNA fragmentations are attached.
5) competent escherichia coli cell is converted, is coated in screening flat board and cultivates.
6) it screens.
Above-mentioned restriction enzyme A, B, C are the enzyme that can be cut into cohesive end.
Above-mentioned ligase is T7 DNA ligase or E.coli DNA ligase.
Above-mentioned competent cell is Escherichia coli, bacterial strain AG1, BLR, DB3.1, DC10B, DH1, DH5 α, DH5 α
pir、DH5αpir116variant、DH10B、DH12S、E.cloni(r)5alpha、E.cloni(r)10G、E.cloni(r)
10GF'、EPI300、ER2267、HB101、HMS174(DE3)、High-Control(tm)10G、IJ1126、IM01B、IM08B、
IM30B、IM93B、JM108、JM109、Mach1、MFDpir、OmniMAX2、SM10(λpir)、STBL2、STBL4、SURE、
SURE2、TOP10、Top10F'、XL1-Blue、XL1-Blue MRF'、XL2-Blue、XL2-Blue MRF'、XL10-Gold、
Prepared by XL10-Gold KanR and its derivative strain.
2. a kind of kit of the clone for plasmid vector
A kit is formed with the DNA fragmentation 1 of the cloning process of an above-mentioned plasmid vector, DNA fragmentation 2, -20 DEG C cold
Freeze and save, ice bath thaws when use.
The present invention has several technical characterstics:
1) plasmid fragments of PCR amplification digest template with Dpn I, eliminate the pollution of plasmid empty carrier.
2) two segment DNA segments of the plasmid vector of PCR amplification contain replicon or resistant gene selection markers respectively, individually
Even if segment recirculation in subsequent reaction can not be grown in screening flat board.
3) two segments of PCR amplification plasmid are the DNA fragmentation that flat end or 3 ' ends have " A " base, the two
DNA fragmentation and the target DNA fragment digestion with restriction enzyme that can be cut into viscous end；Connection reaction is using viscous end connection effect
Rate high T7 DNA ligase or E.coli DNA ligase.If two DNA fragmentation enzymes for obtaining PCR amplification plasmid vector
It cuts to be not thorough and is also difficult to connect, reduce the formation of empty carrier.
4) host strain uses recombination deficient mutant coli strain and its derivative strain.This kind of bacterium homologous recombination function lacks
It loses, even if keeping two segment DNA segments of the plasmid vector of PCR amplification thorough without digestion, it is also difficult to which homologous recombination forms cyclic annular matter
Grain.
5) kit made of this method is easy to use, alternative almost all of commercial plasmids.
Specific embodiment
Below with reference to specific embodiment, description is of the invention in further detail.It should be understood that these embodiments are intended merely to
It illustrates the present invention, rather than limits the scope of the invention in any way.
Embodiment 1
PCR expands ori (replicon) and AmpR (ampicillin resistance gene) the production examination of plasmid vector pUC19 respectively
The clone of agent box and bacillus subtilis saccharase gene, specific operating procedure are as follows:
1. the preparation of kit
Concrete operations are as follows:
Synthetic primer:
M13F:5'TGTAAAACGACGGCCAGT 3',
OR:5'TCCAGATCTCGTCAGACCCCGTAGAAA 3'(underscore is II restriction enzyme site of Bgl)
AMPR:5'AAGAGATCTTGAGTAAACTTGGTCTGA 3'(underscore is II restriction enzyme site of Bgl)
M13R:5'CAGGAAACAGCTATGAC 3'。
It is flat end with primer M13F/OR, AMPR/M13R and product using plasmid vector pUC19 as template
PrimeSTAR HS DNA Polymerase (TAKARA) expands the ori and MCS, AmpR and MCS of pUC19, reaction system respectively
And condition is as follows:
Reaction system is designed as 100uL total system, specifically 5 × PCR Buffer (buffer) 20uL, concentration 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration is each 2uL of upstream and downstream primer of 10mM, and concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), is mended with aqua sterilisa
Sufficient 100uL system.
Reaction condition are as follows: 94 DEG C of 3min initial denaturations, the interior 94 DEG C of 30s denaturation of circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；Continue to extend 10min for 72 DEG C after PCR reaction cycle, then 16 DEG C of preservations.
Amplified production carries out Ago-Gel recovery purifying, M13F/ with DNA purification and recovery kit (TIANGEN) respectively
The target fragment about 1.6kb of target fragment about 1.1kb, the AMPR/M13R recycling of OR recycling.QuickCut Dpn Ⅰ(TAKARA)
Digest template, after purification, then with QuickCut Bgl II (TAKARA) digestion, purifying.The segment warp of primer M13F/OR amplification
DNA fragmentation 1 is named as after above-mentioned processing, the segment of primer AMPR/M13R amplification is named as DNA fragmentation 2 after above-mentioned processing.
DNA fragmentation 1 contains ori functional gene and MCS, and DNA fragmentation 2 contains AmpR functional gene and MCS, the two segments are in Bgl II
It may make up complete ori and AmpR functional gene after the connection of site.The kit of the present embodiment is by DNA fragmentation 1,2 structure of DNA fragmentation
At can be reserved for ice bath when -20 DEG C of several months, use and thaw.
2. the clone of bacillus subtilis saccharase gene
A.PCR expands bacillus subtilis saccharase gene
The target DNA fragment of this experiment is the invertase base obtained from bacillus subtilis WB600 genomic DNA amplification
Cause.
Design primer:
SU980:5'GAGGGATCCATGACAGCACATGACCAGGA 3', (underscore is I restriction enzyme site of BamH)
SU981:5'GAACTGCAGAGATGGCTCAGATTTCACAT 3'(underscore is I restriction enzyme site of Pst)
Using bacillus subtilis WB600 genomic DNA as template, with primer SU980/SU981 PCR amplification.Reaction system
And condition is as follows:
Reaction system is designed as 100uL total system, specifically 5 × PCR Buffer (buffer) 20uL, concentration 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration is each 2uL of upstream and downstream primer of 10mM, and concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), is mended with aqua sterilisa
Sufficient 100uL system.
Reaction condition are as follows: 94 DEG C of 3min initial denaturations, the interior 94 DEG C of 30s denaturation of circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；Continue to extend 10min for 72 DEG C after PCR reaction cycle, then 16 DEG C of preservations.
Amplified production carries out Ago-Gel recovery purifying with DNA purification and recovery kit (TIANGEN) respectively, recycling
Target fragment about 1.5kb,
B. digestion, connection and conversion
Bacillus subtilis saccharase gene QuickCut I/QuickCut of Pst BamH I that PCR amplification obtains
(TAKARA) double digestion, purifying are named as SUC segment.
From the kit taken out in the present embodiment in -20 DEG C of refrigerators, ice bath thaws.The QuickCut Pst I of DNA fragmentation 1
(TAKARA) digestion, QuickCut BamH I (TAKARA) digestion of DNA fragmentation 2, purifies respectively.Wherein Pst I, BamH I
It is the restriction enzyme of MCS.
Through digestion, after purification DNA fragmentation 1, DNA fragmentation 2 and tri- segment E.coli DNA ligases of SUC
(TAKARA) it connects, linked system are as follows:
10 × E.coli DNA Ligase Buffer:1uL,
10 × BSA:1uL,
DNA fragmentation 1:2uL,
DNA fragmentation 2:2uL,
SUC:2uL,
E.coli DNA Ligase:1uL,
Reaction condition is 16 DEG C and stands overnight.
Using bacillus coli DH 5 alpha as host strain, competent cell is made.It is big that previous step connection product is transformed into competence
Enterobacteria DH5 α, is coated in screening flat board, and 37 DEG C are incubated overnight.Screening flat board is the LB plate of the Amp containing 100ug/mL,
Surface adds 40mL X-gal liquid storage and 4 μ l IPTG liquid storages, is smoothened solution with sterile glass rod, and it is small to be placed in placement 3-4 at 37 DEG C
When, it is absorbed the liquid of media surface completely.
3) screening and result
When single colonie in screening flat board grows to suitable size, plate is placed in 4 DEG C of a few hours, keeps colour developing complete.Statistics
The result is as follows:
Embodiment 2
PCR expand respectively two parts sequence that plasmid vector pUC19ori (replicon) can complementary be complete function gene and
AmpR (ampicillin resistance gene) repertoire gene order makes kit and bacillus subtilis saccharase gene
Clone, specific operating procedure are as follows:
1) preparation of kit
Concrete operations are as follows:
Design primer:
M13F:5'TGTAAAACGACGGCCAGT 3',
OR1:5'CACCGCCTACATACCTC 3',
OR21:5'TCAGTTCGGTGTAGGTC 3',
M13R:5'CAGGAAACAGCTATGAC 3'。
It is flat end with primer M13F/OR1, OR21/M13R and product using plasmid vector pUC19 as template
PrimeSTAR HS DNA Polymerase (TAKARA) expands the part ori sequence and MCS of pUC19, part ori sequence respectively
Column, whole AmpR and MCS, reaction system and condition are as follows:
Reaction system is designed as 100uL total system, specifically 5 × PCR Buffer (buffer) 20uL, concentration 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration is each 2uL of upstream and downstream primer of 10mM, and concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), is mended with aqua sterilisa
Sufficient 100uL system.
Reaction condition are as follows: 94 DEG C of 3min initial denaturations, the interior 94 DEG C of 30s denaturation of circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；Continue to extend 10min for 72 DEG C after PCR reaction cycle, then 16 DEG C of preservations.
Amplified production carries out Ago-Gel recovery purifying, M13F/ with DNA purification and recovery kit (TIANGEN) respectively
The target fragment about 1.9kb of target fragment about 0.9kb, the OR21/M13R recycling of OR1 recycling.QuickCut Dpn Ⅰ
(TAKARA) template, after purification is digested, then with QuickCut AlwN I (NEB) digestion, purifying.Primer M13F/OR1 amplification
Segment is named as DNA fragmentation 1 after above-mentioned processing, and the segment of primer OR21/M13R amplification is named as DNA piece after above-mentioned processing
Section 2, DNA fragmentation 1 contain part ori functional gene and MCS, and DNA fragmentation 2 contains part ori functional gene, whole AmpR function
Energy gene and MCS, two segments may make up complete ori and AmpR functional gene after I site AlwN connects.The present embodiment
Kit be made of DNA fragmentation 1, DNA fragmentation 2, can be reserved for ice bath when -20 DEG C of several months, use and thaw.
2) clone of bacillus subtilis saccharase gene
A.PCR expands bacillus subtilis saccharase gene
The target DNA fragment of this experiment is the invertase base obtained from bacillus subtilis WB600 genomic DNA amplification
Cause.
Design primer:
SU980:5'GAGGGATCCATGACAGCACATGACCAGGA 3', (underscore is I restriction enzyme site of BamH)
SU981:5'GAACTGCAGAGATGGCTCAGATTTCACAT 3'(underscore is I restriction enzyme site of Pst)
Using bacillus subtilis WB600 genomic DNA as template, expanded with primer SU980/SU981PCR.Reaction system
And condition is as follows:
Reaction system is designed as 100uL total system, specifically 5 × PCR Buffer (buffer) 20uL, concentration 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration is each 2uL of upstream and downstream primer of 10mM, and concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), is mended with aqua sterilisa
Sufficient 100uL system.
Reaction condition are as follows: 94 DEG C of 3min initial denaturations, the interior 94 DEG C of 30s denaturation of circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；Continue to extend 10min for 72 DEG C after PCR reaction cycle, then 16 DEG C of preservations.
Amplified production carries out Ago-Gel recovery purifying with DNA purification and recovery kit (TIANGEN) respectively, recycling
Target fragment about 1.5kb,
B. digestion, connection and conversion
Bacillus subtilis saccharase gene QuickCut I/QuickCut of Pst BamH I that PCR amplification obtains
(TAKARA) double digestion, purifying are named as SUC segment.
From the kit taken out in the present embodiment in -20 DEG C of refrigerators, ice bath thaws.The QuickCut Pst I of DNA fragmentation 1
(TAKARA) digestion, QuickCut BamH I (TAKARA) digestion of DNA fragmentation 2, purifies respectively.Wherein Pst I, BamH I
It is the restriction enzyme of MCS.
Through digestion, after purification DNA fragmentation 1, DNA fragmentation 2 and tri- segment E.coli DNA ligases of SUC
(TAKARA) it connects, linked system are as follows:
10 × E.coli DNA Ligase Buffer:1uL,
10 × BSA:1uL,
DNA fragmentation 1:2uL,
DNA fragmentation 2:2uL,
SUC:2uL,
E.coli DNA Ligase:1uL,
Reaction condition is 16 DEG C and stands overnight.
Using bacillus coli DH 5 alpha as host strain, competent cell is made.It is big that previous step connection product is transformed into competence
Enterobacteria DH5 α, is coated in screening flat board, and 37 DEG C are incubated overnight.Screening flat board is the LB plate of the Amp containing 100ug/mL,
Surface adds 40mL X-gal liquid storage and 4 μ l IPTG liquid storages, is smoothened solution with sterile glass rod, and it is small to be placed in placement 3-4 at 37 DEG C
When, it is absorbed the liquid of media surface completely.
3) screening and result
When single colonie in screening flat board grows to suitable size, plate is placed in 4 DEG C of a few hours, keeps colour developing complete.Statistics
The result is as follows:
Embodiment 3
It complementary to be complete function gene that PCR expands plasmid vector pUC19AmpR (ampicillin resistance gene) respectively
Partial sequence and ori (replicon) repertoire gene order production kit and bacillus subtilis saccharase gene gram
Grand, specific operating procedure is as follows:
1) preparation of kit
Concrete operations are as follows:
Design primer:
M13F:5'TGTAAAACGACGGCCAGT 3',
Cfr2:5'GCTGGCTGGTTTATTG 3'
Cfr1:5'CGGGAGGGCTTACCAT 3'
M13R:5'CAGGAAACAGCTATGAC 3'。
It is flat end with primer M13F/Cfr2, Cfr1/M13R and product using plasmid vector pUC19 as template
PrimeSTAR HS DNA Polymerase (TAKARA) expand respectively pUC19 part AmpR sequence and MCS, part AmpR,
Whole ori sequences and MCS, reaction system and condition are as follows:
Reaction system is designed as 100uL total system, specifically 5 × PCR Buffer (buffer) 20uL, concentration 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration is each 2uL of upstream and downstream primer of 10mM, and concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), is mended with aqua sterilisa
Sufficient 100uL system.
Reaction condition are as follows: 94 DEG C of 3min initial denaturations, the interior 94 DEG C of 30s denaturation of circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；Continue to extend 10min for 72 DEG C after PCR reaction cycle, then 16 DEG C of preservations.
Amplified production carries out Ago-Gel recovery purifying, M13F/ with DNA purification and recovery kit (TIANGEN) respectively
The target fragment about 1.4kb of Cfr2 and Cfr1/M13R recycling.QuickCut Dpn I (TAKARA) digests template, after purification,
Cfr10 I (TAKARA) digestion, purifying are used again.The segment of primer M13F/Cfr2 amplification is named as DNA fragmentation after above-mentioned processing
The segment of 1, primer Cfr1/M13R amplification is named as DNA fragmentation 2 after above-mentioned processing, and DNA fragmentation 1 contains part AmpR function
Gene and MCS, DNA fragmentation 2 is containing part AmpR functional gene, whole ori functional gene and MCS, and two segments are in Cfr10
It may make up complete ori and AmpR functional gene after the connection of I site.The kit of the present embodiment is by DNA fragmentation 1, DNA fragmentation 2
It constitutes, can be reserved for ice bath when -20 DEG C of several months, use and thaw.
2) clone of bacillus subtilis saccharase gene
A.PCR expands bacillus subtilis saccharase gene
The target DNA fragment of this experiment is the invertase base obtained from bacillus subtilis WB600 genomic DNA amplification
Cause.
Design primer:
SU980:5'GAGGGATCCATGACAGCACATGACCAGGA 3', (underscore is I restriction enzyme site of BamH)
SU981:5'GAACTGCAGAGATGGCTCAGATTTCACAT 3'(underscore is I restriction enzyme site of Pst)
Using bacillus subtilis WB600 genomic DNA as template, expanded with primer SU980/SU981PCR.Reaction system
And condition is as follows:
Reaction system is designed as 100uL total system, specifically 5 × PCR Buffer (buffer) 20uL, concentration 2.5mM
DNTPmix (deoxyribonucleoside triphosphate mixture) 5uL, concentration is each 2uL of upstream and downstream primer of 10mM, and concentration is
2.5U/uL PrimeSTAR HS DNA Polymerase (TAKARA) 2uL, DNA profiling 2uL (about 20ng), is mended with aqua sterilisa
Sufficient 100uL system.
Reaction condition are as follows: 94 DEG C of 3min initial denaturations, the interior 94 DEG C of 30s denaturation of circulation, 60 DEG C of annealing 30s, 72 DEG C of extensions
1.5min, 30 circulations；Continue to extend 10min for 72 DEG C after PCR reaction cycle, then 16 DEG C of preservations.
Amplified production carries out Ago-Gel recovery purifying with DNA purification and recovery kit (TIANGEN) respectively, recycling
Target fragment about 1.5kb,
B. digestion, connection and conversion
Bacillus subtilis saccharase gene QuickCut I/QuickCut of Pst BamH I that PCR amplification obtains
(TAKARA) double digestion, purifying are named as SUC segment.
From the kit taken out in the present embodiment in -20 DEG C of refrigerators, ice bath thaws.The QuickCut Pst I of DNA fragmentation 1
(TAKARA) digestion, QuickCut BamH I (TAKARA) digestion of DNA fragmentation 2, purifies respectively.Wherein Pst I, BamH I
It is the restriction enzyme of MCS.
Through digestion, after purification DNA fragmentation 1, DNA fragmentation 2 and tri- segment E.coli DNA ligases of SUC
(TAKARA) it connects, linked system are as follows:
10 × E.coli DNA Ligase Buffer:1uL,
10 × BSA:1uL,
DNA fragmentation 1:2uL,
DNA fragmentation 2:2uL,
SUC:2uL,
E.coli DNA Ligase:1uL,
Reaction condition is 16 DEG C and stands overnight.
Using bacillus coli DH 5 alpha as host strain, competent cell is made.It is big that previous step connection product is transformed into competence
Enterobacteria DH5 α, is coated in screening flat board, and 37 DEG C are incubated overnight.Screening flat board is the LB plate of the Amp containing 100ug/mL,
Surface adds 40mL X-gal liquid storage and 4 μ l IPTG liquid storages, is smoothened solution with sterile glass rod, and it is small to be placed in placement 3-4 at 37 DEG C
When, it is absorbed the liquid of media surface completely.
3) screening and result
When single colonie in screening flat board grows to suitable size, plate is placed in 4 DEG C of a few hours, keeps colour developing complete.Statistics
The result is as follows:
SEQUENCE LISTING
<110>Nanning Bangerke Biotechnology Co., Ltd
The cloning process and kit of<120>one plasmid vectors
<140>
<160> 10
<210> 1
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna of pUC19 MCS
<400> 1
TGTAAAACGA CGGCCAGT 18
<210> 2
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna of pUC19 MCS
<400> 2
CAGGAAACAG CTATGAC 17
<210> 3
<211> 29
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna of bacillus subtilis WB600 genome saccharase gene
<400> 3
GAGGGATCCA TGACAGCACA TGACCAGGA 29
<210> 4
<211> 29
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna of bacillus subtilis WB600 genome saccharase gene
<400> 4
GAACTGCAGA GATGGCTCAG ATTTCACAT 29
<210> 5
<211> 27
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna of pUC19 ori
<400> 5
TCCAGATCTC GTCAGACCCC GTAGAAA 27
<210> 6
<211> 27
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna of pUC19 AmpR
<400> 6
AAGAGATCTT GAGTAAACTT GGTCTGA 27
<210> 7
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna that pUC19 can complementary be complete ori functional gene
<400> 7
CACCGCCTAC ATACCTC 17
<210> 8
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna that pUC19 can complementary be complete ori functional gene
<400> 8
TCAGTTCGGT GTAGGTC 17
<210> 9
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna that pUC19 can complementary be complete AmpR functional gene
<400> 9
GCTGGCTGGT TTATTG 16
<210> 10
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>for expanding the DNA sequence dna that pUC19 can complementary be complete AmpR functional gene
<400> 10
CGGGAGGGCT TACCAT 16
Claims (3)
1. the cloning process of a plasmid vector, which is characterized in that be by plasmid amplification be two DNA fragmentations, make the two pieces
Section respectively containing replicon, resistant gene selection markers the two functional genes, use respectively with target DNA fragment by the two segments
The digestion with restriction enzyme of viscous end, then the T7 DNA ligase or E.coli high with viscous end joint efficiency can be cut into
DNA ligase is attached, and the Escherichia coli for being transformed into homologous recombination functional defect are screened, and specific operating procedure is such as
Under:
1) synthetic primer is expanded to obtain two replicon, resistant gene selection markers DNA fragmentations of plasmid vector with PCR method；
In the two DNA fragmentations, the segment of primer one end, which contains, can be cut into viscous terminal restriction restriction endonuclease A, and another primer, which contains, to be cut
At restriction enzyme B, C of viscous end；
2) Dpn I digests template, purifying；
3) the two DNA fragmentations restriction enzyme A digestion, the DNA fragmentation obtained after purification be respectively designated as DNA fragmentation 1,
DNA fragmentation 2, DNA fragmentation 1, DNA fragmentation 2 use restriction enzyme B, C digestion, purifying respectively；Target DNA fragment is with restricted
Restriction endonuclease B, C digestion, purifying；
4) three DNA fragmentations are attached with T7DNA ligase or E.coliDNA ligase；
5) competent escherichia coli cell for converting homologous recombination functional defect, is coated in screening flat board and cultivates；
6) it screens.
2. the cloning process of a plasmid vector according to claim 1, which is characterized in that the homologous recombination function
The competent escherichia coli cell of defect is made of following coli strain: AG1, BLR, DB3.1, DC10B, DH1, DH5 α,
DH5αpir、DH5αpir116variant、DH10B、DH12S、E.cloni(r)5alpha、E.cloni(r)10G、E.cloni
(r) 10GF ', EPI300, ER2267, HB101, HMS174 (DE3), High-Control (tm) 10G, IJ1126, IM01B,
IM08B、IM30B、IM93B、JM108、JM109、Mach1、MFDpir、OmniMAX2、SM10(λpir)、STBL2、STBL4、
SURE, SURE2, TOP10, Top10F ', XL1-Blue, XL1-BlueMRF ', XL2-Blue, XL2-Blue MRF ', XL10-
Gold, XL10-Gold KanR and its derivative strain.
3. a kind of kit of the clone for plasmid vector, which is characterized in that kit is by the DNA fragmentation in claim 1
1, DNA fragmentation 2 forms, the freezen protective under the conditions of -20 DEG C, and ice bath thaws when use.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710030080.9A CN106591341B (en) | 2017-01-16 | 2017-01-16 | The cloning process and kit of one plasmid vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710030080.9A CN106591341B (en) | 2017-01-16 | 2017-01-16 | The cloning process and kit of one plasmid vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106591341A CN106591341A (en) | 2017-04-26 |
| CN106591341B true CN106591341B (en) | 2019-06-25 |
Family
ID=58585886
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710030080.9A Active CN106591341B (en) | 2017-01-16 | 2017-01-16 | The cloning process and kit of one plasmid vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591341B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333537A (en) * | 2007-06-29 | 2008-12-31 | 浙江工业大学 | Expression type pre-T vector, preparation thereof and applications |
| CN102719471A (en) * | 2012-06-05 | 2012-10-10 | 中国科学院广州生物医药与健康研究院 | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium |
| CN102787114A (en) * | 2012-08-11 | 2012-11-21 | 复旦大学 | Efficient directional seamless DNA (deoxyribonucleic acid) segment connecting method |
| CN104109685A (en) * | 2013-12-19 | 2014-10-22 | 首都医科大学 | Biomedical molecule cloning method |
| CN104313044A (en) * | 2014-09-30 | 2015-01-28 | 天根生化科技（北京）有限公司 | Zero-background cloning vector as well as preparation method and application thereof |
| CN105400809A (en) * | 2015-12-21 | 2016-03-16 | 生工生物工程（上海）股份有限公司 | Cloning vector and preparation and application thereof |
-
2017
- 2017-01-16 CN CN201710030080.9A patent/CN106591341B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333537A (en) * | 2007-06-29 | 2008-12-31 | 浙江工业大学 | Expression type pre-T vector, preparation thereof and applications |
| CN102719471A (en) * | 2012-06-05 | 2012-10-10 | 中国科学院广州生物医药与健康研究院 | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium |
| CN102787114A (en) * | 2012-08-11 | 2012-11-21 | 复旦大学 | Efficient directional seamless DNA (deoxyribonucleic acid) segment connecting method |
| CN104109685A (en) * | 2013-12-19 | 2014-10-22 | 首都医科大学 | Biomedical molecule cloning method |
| CN104313044A (en) * | 2014-09-30 | 2015-01-28 | 天根生化科技（北京）有限公司 | Zero-background cloning vector as well as preparation method and application thereof |
| CN105400809A (en) * | 2015-12-21 | 2016-03-16 | 生工生物工程（上海）股份有限公司 | Cloning vector and preparation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106591341A (en) | 2017-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Stirling et al. | Rational design of evolutionarily stable microbial kill switches | |
| Sabri et al. | Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci | |
| CN106676119B (en) | The seamless genetic manipulation carrier of bacterium and its construction method and application | |
| CN104109687A (en) | Construction and application of Zymomonas mobilis CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-association proteins)9 system | |
| CN104212830B (en) | A kind of bacillus subtilis Self-controlled expression system and construction method thereof and application | |
| CN105505975A (en) | Bacillus gene traceless knockout/knockin plasmid and method, and kit | |
| JP2018500920A (en) | Suicidal vectors for gene knockout commonly used in Vibrio and their use | |
| CN111718885B (en) | High-efficient stable two plasmid system of bacillus subtilis | |
| CN112980891B (en) | Coli genome editing tool based on CRISPR-Cas | |
| WO2021232536A1 (en) | Construction method for system for large volume in vitro acquisition of ericerus pela dsrna | |
| CN102154188A (en) | nfi-gene-knocked-out mutant strain of escherichia coli DH5 alpha as well as preparation method and application thereof | |
| CN106591341B (en) | The cloning process and kit of one plasmid vector | |
| JP2009524406A (en) | Modular genomes for synthetic biology and metabolic engineering | |
| Tian et al. | A new method for multi-site-directed mutagenesis | |
| CN107130030B (en) | DNA Marker for detecting coal geology microorganism archaea species and preparation method and application thereof | |
| WO2024041031A1 (en) | Bacterial continuous evolution system, orthogonal error-prone dna polymerase, and continuous evolution method | |
| Su’etsugu et al. | Transcriptional control for initiation of chromosomal replication in Escherichia coli: fluctuation of the level of origin transcription ensures timely initiation | |
| CN104673819A (en) | Vector for knocking out L-lactic dehydrogenase 1 gene and construction method of vector | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| WO2006051127A1 (en) | Control of gene expression with the use of a transcription attenuator | |
| CN110079540B (en) | Method for constructing suicide plasmid and drug-resistant mutant strain based on mariner transposon | |
| CN103614408A (en) | prcK gene knocked-out suicide plasmid pYTKLKRT and construction method thereof | |
| Deng et al. | The ilvGMEDA operon is regulated by transcription attenuation in Vibrio alginolyticus ZJ-T | |
| CN101899431B (en) | Rapid and efficient DNA recombination method and kit | |
| CN106754606A (en) | The screening technique of the unmarked deletion mutant of citrus processing hfq genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |