Embodiment
Describe embodiments of the invention below in detail, the example of described embodiment is shown in the drawings, and wherein same or similar label represents same or similar element or has the element of identical or similar functions from start to finish.Be exemplary below by the embodiment being described with reference to the drawings, be intended to for explaining the present invention, and can not be interpreted as limitation of the present invention.
TMC1 gene mutation body
According to a first aspect of the invention, the present invention proposes a kind of nucleic acid of coding TMC1 gene mutation body of separation.According to embodiments of the invention, described nucleic acid, compared with SEQ ID NO:1, has and is selected from least one following sudden change: c.589G>A, c.1171C>T.With respect to wild-type TMC1 gene, TMC1 gene of the present invention has c.589G>A c.1171C>T at least one of (p.Q391X) of (p.G197R) or nonsense mutation of a missense mutation.According to embodiments of the invention, contriver has determined the new mutant body of TMC1 gene, the morbidity of this mutant and phonosensitive nerve deafness disease is closely related, whether thereby exist in biological sample by detecting this new mutant body, whether detection of biological sample easily suffers from phonosensitive nerve deafness disease effectively.
The phraseology " nucleic acid of coding TMC1 mutant " that used in this article, refer to the nucleic acid substances corresponding with the gene of the TMC1 mutant of encoding, the type that is nucleic acid is not particularly limited, can be any deoxyribonucleotide corresponding with the encoding gene of TMC1 mutant and/or polymkeric substance of ribonucleotide of comprising, include but not limited to DNA, RNA or cDNA.According to a concrete example of the present invention, the nucleic acid of foregoing coding TMC1 mutant is DNA.According to embodiments of the invention, contriver has determined the new mutant body of TMC1 gene, the morbidity of these new mutant bodies and phonosensitive nerve deafness disease is closely related, thereby whether exist in biological sample by detecting this new mutant body, whether detection of biological sample easily suffers from phonosensitive nerve deafness disease effectively, also can in organism, whether exist by detecting these mutant, can effectively predict whether organism easily suffers from phonosensitive nerve deafness disease.
The nucleic acid of this coding TMC1 mutant is that present inventor passes through the new mutant on the Disease-causing gene of the definite phonosensitive nerve deafness disease of method that the sudden change of high-throughput exon group order-checking associating candidate gene verifies.This mutational site is not referred in the prior art.
Wherein, the cDNA of wild-type TMC1 gene has nucleotide sequence as follows:
ATGTCACCCAAAAAAGTACAAATCAAAGTGGAGGAAAAAGAAGACGAGACTGAGGAAAGCTCAAGTGAAGAGGAAGAGGAGGTGGAAGATAAGCTACCTCGAAGAGAGAGCTTGAGACCAAAGAGGAAACGGACCAGAGATGTTATCAATGAGGATGACCCAGAACCTGAACCAGAGGATGAAGAAACAAGGAAGGCAAGAGAAAAAGAGAGGAGGAGGAGGCTAAAGAGAGGAGCAGAAGAAGAAGAAATTGATGAAGAGGAATTGGAAAGATTGAAGGCAGAGTTAGATGAGAAAAGACAAATAATTGCTACTGTCAAATGCAAACCATGGAAGATGGAGAAGAAAATTGAAGTTCTCAAGGAGGCAAAAAAATTTGTGAGTGAAAATGAAGGGGCTCTTGGGAAAGGAAAAGGAAAACGGTGGTTTGCATTTAAGATGATGATGGCCAAGAAATGGGCAAAATTCCTCCGTGATTTTGAGAACTTCAAAGCTGCGTGTGTCCCATGGGAAAATAAAATCAAGGCTATTGAAAGTCAGTTTGGCTCCTCAGTGGCCTCATACTTCCTCTTCTTGAGATGGATGTATGGAGTCAATATGGTTCTCTTTATCCTGACATTTAGCCTCATCATGTTGCCAGAGTACCTCTGGGGTTTGCCATATGGCAGTTTACCTAGGAAAACCGTTCCCAGAGCCGAAGAGGCATCGGCAGCAAACTTTGGTGTGTTGTACGACTTCAATGGTTTGGCACAATATTCCGTTCTCTTTTATGGCTATTATGACAATAAACGAACAATTGGATGGATGAATTTCAGGTTGCCGCTCTCCTATTTTCTAGTGGGGATTATGTGCATTGGATACAGCTTTCTGGTTGTCCTCAAAGCAATGACCAAAAACATTGGTGATGATGGAGGTGGAGATGACAACACTTTCAATTTCAGCTGGAAGGTCTTTACCAGCTGGGACTACCTGATCGGCAATCCTGAAACAGCAGACAACAAATTTAATTCTATCACAATGAACTTTAAGGAAGCTATCACAGAAGAAAAAGCAGCCCAAGTAGAAGAAAACGTCCACTTGATCAGATTCCTGAGGTTTCTGGCTAACTTCTTCGTGTTTCTAACACTTGGAGGGAGTGGATACCTCATCTTTTGGGCTGTGAAGCGATCCCAGGAATTTGCACAGCAAGATCCTGACACCCTTGGGTGGTGGGAAAAAAATGAAATGAACATGGTTATGTCCCTCCTAGGGATGTTCTGTCCAACATTGTTTGACTTATTTGCTGAATTAGAAGACTACCATCCTCTCATCGCTTTGAAATGGCTACTGGGACGCATTTTTGCTCTTCTTTTAGGCAATTTATACGTATTTATTCTTGCATTAATGGATGAGATTAACAACAAGATTGAAGAGGAGAAGCTAGTAAAGGCCAATATTACCCTTTGGGAAGCCAATATGATCAAGGCCTACAATGCATCATTCTCTGAAAATAGCACTGGACCACCCTTTTTTGTTCACCCTGCAGATGTACCTCGAGGACCTTGCTGGGAAACAATGGTGGGACAGGAGTTTGTGAGGCTGACAGTCTCTGATGTTCTGACCACCTACGTCACAATCCTCATTGGGGACTTTCTAAGGGCATGTTTTGTGAGGTTTTGCAATTATTGCTGGTGCTGGGACTTGGAGTATGGATATCCTTCATACACCGAATTCGACATCAGTGGCAACGTCCTCGCTCTGATCTTCAACCAAGGCATGATCTGGATGGGCTCCTTCTTTGCTCCCAGCCTCCCAGGCATCAATATCCTTCGACTCCATACATCCATGTACTTCCAGTGCTGGGCCGTTATGTGCTGCAATGTTCCTGAGGCCAGGGTCTTCAAAGCTTCCAGATCAAATAACTTCTACCTGGGCATGCTACTGCTCATCCTCTTCCTGTCCACAATGCCTGTCTTGTACATGATCGTGTCCCTCCCACCATCTTTTGATTGTGGTCCATTCAGTGGCAAAAATAGAATGTTTGAAGTCATTGGAGAGACCCTGGAGCACGATTTCCCAAGCTGGATGGCGAAGATCTTGAGACAGCTTTCAAACCCTGGGCTGGTCATTGCTGTCATTTTGGTGATGGTTTTGGCCATCTATTATCTCAATGCTACTGCCAAGGGCCAGAAGGCAGCGAATCTGGATCTCAAAAAGAAGATGAAAATGCAAGCTTTGGAGAACAAAATGCGAAACAAGAAAATGGCAGCTGCACGAGCAGCTGCAGCTGCTGGTCGCCAGTAA(SEQ?ID?NO:1),
The protein of its coding has aminoacid sequence as follows:
MSPKKVQIKVEEKEDETEESSSEEEEEVEDKLPRRESLRPKRKRTRDVINEDDPEPEPEDEETRKAREKERRRRLKRGAEEEEIDEEELERLKAELDEKRQIIATVKCKPWKMEKKIEVLKEAKKFVSENEGALGKGKGKRWFAFKMMMAKKWAKFLRDFENFKAACVPWENKIKAIESQFGSSVASYFLFLRWMYGVNMVLFILTFSLIMLPEYLWGLPYGSLPRKTVPRAEEASAANFGVLYDFNGLAQYSVLFYGYYDNKRTIGWMNFRLPLSYFLVGIMCIGYSFLVVLKAMTKNIGDDGGGDDNTFNFSWKVFTSWDYLIGNPETADNKFNSITMNFKEAITEEKAAQVEENVHLIRFLRFLANFFVFLTLGGSGYLIFWAVKRSQEFAQQDPDTLGWWEKNEMNMVMSLLGMFCPTLFDLFAELEDYHPLIALKWLLGRIFALLLGNLYVFILALMDEINNKIEEEKLVKANITLWEANMIKAYNASFSENSTGPPFFVHPADVPRGPCWETMVGQEFVRLTVSDVLTTYVTILIGDFLRACFVRFCNYCWCWDLEYGYPSYTEFDISGNVLALIFNQGMIWMGSFFAPSLPGINILRLHTSMYFQCWAVMCCNVPEARVFKASRSNNFYLGMLLLILFLSTMPVLYMIVSLPPSFDCGPFSGKNRMFEVIGETLEHDFPSWMAKILRQLSNPGLVIAVILVMVLAIYYLNATAKGQKAANLDLKKKMKMQALENKMRNKKMAAARAAAAAGRQ(SEQ?ID?NO:2)。
C.589G>AcDNA, saltant type has nucleotide sequence as follows:
ATGTCACCCAAAAAAGTACAAATCAAAGTGGAGGAAAAAGAAGACGAGACTGAGGAAAGCTCAAGTGAAGAGGAAGAGGAGGTGGAAGATAAGCTACCTCGAAGAGAGAGCTTGAGACCAAAGAGGAAACGGACCAGAGATGTTATCAATGAGGATGACCCAGAACCTGAACCAGAGGATGAAGAAACAAGGAAGGCAAGAGAAAAAGAGAGGAGGAGGAGGCTAAAGAGAGGAGCAGAAGAAGAAGAAATTGATGAAGAGGAATTGGAAAGATTGAAGGCAGAGTTAGATGAGAAAAGACAAATAATTGCTACTGTCAAATGCAAACCATGGAAGATGGAGAAGAAAATTGAAGTTCTCAAGGAGGCAAAAAAATTTGTGAGTGAAAATGAAGGGGCTCTTGGGAAAGGAAAAGGAAAACGGTGGTTTGCATTTAAGATGATGATGGCCAAGAAATGGGCAAAATTCCTCCGTGATTTTGAGAACTTCAAAGCTGCGTGTGTCCCATGGGAAAATAAAATCAAGGCTATTGAAAGTCAGTTTGGCTCCTCAGTGGCCTCATACTTCCTCTTCTTGAGATGGATGTATAGAGTCAATATGGTTCTCTTTATCCTGACATTTAGCCTCATCATGTTGCCAGAGTACCTCTGGGGTTTGCCATATGGCAGTTTACCTAGGAAAACCGTTCCCAGAGCCGAAGAGGCATCGGCAGCAAACTTTGGTGTGTTGTACGACTTCAATGGTTTGGCACAATATTCCGTTCTCTTTTATGGCTATTATGACAATAAACGAACAATTGGATGGATGAATTTCAGGTTGCCGCTCTCCTATTTTCTAGTGGGGATTATGTGCATTGGATACAGCTTTCTGGTTGTCCTCAAAGCAATGACCAAAAACATTGGTGATGATGGAGGTGGAGATGACAACACTTTCAATTTCAGCTGGAAGGTCTTTACCAGCTGGGACTACCTGATCGGCAATCCTGAAACAGCAGACAACAAATTTAATTCTATCACAATGAACTTTAAGGAAGCTATCACAGAAGAAAAAGCAGCCCAAGTAGAAGAAAACGTCCACTTGATCAGATTCCTGAGGTTTCTGGCTAACTTCTTCGTGTTTCTAACACTTGGAGGGAGTGGATACCTCATCTTTTGGGCTGTGAAGCGATCCCAGGAATTTGCACAGCAAGATCCTGACACCCTTGGGTGGTGGGAAAAAAATGAAATGAACATGGTTATGTCCCTCCTAGGGATGTTCTGTCCAACATTGTTTGACTTATTTGCTGAATTAGAAGACTACCATCCTCTCATCGCTTTGAAATGGCTACTGGGACGCATTTTTGCTCTTCTTTTAGGCAATTTATACGTATTTATTCTTGCATTAATGGATGAGATTAACAACAAGATTGAAGAGGAGAAGCTAGTAAAGGCCAATATTACCCTTTGGGAAGCCAATATGATCAAGGCCTACAATGCATCATTCTCTGAAAATAGCACTGGACCACCCTTTTTTGTTCACCCTGCAGATGTACCTCGAGGACCTTGCTGGGAAACAATGGTGGGACAGGAGTTTGTGAGGCTGACAGTCTCTGATGTTCTGACCACCTACGTCACAATCCTCATTGGGGACTTTCTAAGGGCATGTTTTGTGAGGTTTTGCAATTATTGCTGGTGCTGGGACTTGGAGTATGGATATCCTTCATACACCGAATTCGACATCAGTGGCAACGTCCTCGCTCTGATCTTCAACCAAGGCATGATCTGGATGGGCTCCTTCTTTGCTCCCAGCCTCCCAGGCATCAATATCCTTCGACTCCATACATCCATGTACTTCCAGTGCTGGGCCGTTATGTGCTGCAATGTTCCTGAGGCCAGGGTCTTCAAAGCTTCCAGATCAAATAACTTCTACCTGGGCATGCTACTGCTCATCCTCTTCCTGTCCACAATGCCTGTCTTGTACATGATCGTGTCCCTCCCACCATCTTTTGATTGTGGTCCATTCAGTGGCAAAAATAGAATGTTTGAAGTCATTGGAGAGACCCTGGAGCACGATTTCCCAAGCTGGATGGCGAAGATCTTGAGACAGCTTTCAAACCCTGGGCTGGTCATTGCTGTCATTTTGGTGATGGTTTTGGCCATCTATTATCTCAATGCTACTGCCAAGGGCCAGAAGGCAGCGAATCTGGATCTCAAAAAGAAGATGAAAATGCAAGCTTTGGAGAACAAAATGCGAAACAAGAAAATGGCAGCTGCACGAGCAGCTGCAGCTGCTGGTCGCCAGTAA(SEQ?ID?NO:3),
The protein of its coding has aminoacid sequence as follows:
MSPKKVQIKVEEKEDETEESSSEEEEEVEDKLPRRESLRPKRKRTRDVINEDDPEPEPEDEETRKAREKERRRRLKRGAEEEEIDEEELERLKAELDEKRQIIATVKCKPWKMEKKIEVLKEAKKFVSENEGALGKGKGKRWFAFKMMMAKKWAKFLRDFENFKAACVPWENKIKAIESQFGSSVASYFLFLRWMYRVNMVLFILTFSLIMLPEYLWGLPYGSLPRKTVPRAEEASAANFGVLYDFNGLAQYSVLFYGYYDNKRTIGWMNFRLPLSYFLVGIMCIGYSFLVVLKAMTKNIGDDGGGDDNTFNFSWKVFTSWDYLIGNPETADNKFNSITMNFKEAITEEKAAQVEENVHLIRFLRFLANFFVFLTLGGSGYLIFWAVKRSQEFAQQDPDTLGWWEKNEMNMVMSLLGMFCPTLFDLFAELEDYHPLIALKWLLGRIFALLLGNLYVFILALMDEINNKIEEEKLVKANITLWEANMIKAYNASFSENSTGPPFFVHPADVPRGPCWETMVGQEFVRLTVSDVLTTYVTILIGDFLRACFVRFCNYCWCWDLEYGYPSYTEFDISGNVLALIFNQGMIWMGSFFAPSLPGINILRLHTSMYFQCWAVMCCNVPEARVFKASRSNNFYLGMLLLILFLSTMPVLYMIVSLPPSFDCGPFSGKNRMFEVIGETLEHDFPSWMAKILRQLSNPGLVIAVILVMVLAIYYLNATAKGQKAANLDLKKKMKMQALENKMRNKKMAAARAAAAAGRQ(SEQ?ID?NO:4)。
Saltant type c.1171C>T cDNA has nucleotide sequence as follows:
ATGTCACCCAAAAAAGTACAAATCAAAGTGGAGGAAAAAGAAGACGAGACTGAGGAAAGCTCAAGTGAAGAGGAAGAGGAGGTGGAAGATAAGCTACCTCGAAGAGAGAGCTTGAGACCAAAGAGGAAACGGACCAGAGATGTTATCAATGAGGATGACCCAGAACCTGAACCAGAGGATGAAGAAACAAGGAAGGCAAGAGAAAAAGAGAGGAGGAGGAGGCTAAAGAGAGGAGCAGAAGAAGAAGAAATTGATGAAGAGGAATTGGAAAGATTGAAGGCAGAGTTAGATGAGAAAAGACAAATAATTGCTACTGTCAAATGCAAACCATGGAAGATGGAGAAGAAAATTGAAGTTCTCAAGGAGGCAAAAAAATTTGTGAGTGAAAATGAAGGGGCTCTTGGGAAAGGAAAAGGAAAACGGTGGTTTGCATTTAAGATGATGATGGCCAAGAAATGGGCAAAATTCCTCCGTGATTTTGAGAACTTCAAAGCTGCGTGTGTCCCATGGGAAAATAAAATCAAGGCTATTGAAAGTCAGTTTGGCTCCTCAGTGGCCTCATACTTCCTCTTCTTGAGATGGATGTATGGAGTCAATATGGTTCTCTTTATCCTGACATTTAGCCTCATCATGTTGCCAGAGTACCTCTGGGGTTTGCCATATGGCAGTTTACCTAGGAAAACCGTTCCCAGAGCCGAAGAGGCATCGGCAGCAAACTTTGGTGTGTTGTACGACTTCAATGGTTTGGCACAATATTCCGTTCTCTTTTATGGCTATTATGACAATAAACGAACAATTGGATGGATGAATTTCAGGTTGCCGCTCTCCTATTTTCTAGTGGGGATTATGTGCATTGGATACAGCTTTCTGGTTGTCCTCAAAGCAATGACCAAAAACATTGGTGATGATGGAGGTGGAGATGACAACACTTTCAATTTCAGCTGGAAGGTCTTTACCAGCTGGGACTACCTGATCGGCAATCCTGAAACAGCAGACAACAAATTTAATTCTATCACAATGAACTTTAAGGAAGCTATCACAGAAGAAAAAGCAGCCCAAGTAGAAGAAAACGTCCACTTGATCAGATTCCTGAGGTTTCTGGCTAACTTCTTCGTGTTTCTAACACTTGGAGGGAGTGGATACCTCATCTTTTGGGCTGTGAAGCGATCCTAGGAATTTGCACAGCAAGATCCTGACACCCTTGGGTGGTGGGAAAAAAATGAAATGAACATGGTTATGTCCCTCCTAGGGATGTTCTGTCCAACATTGTTTGACTTATTTGCTGAATTAGAAGACTACCATCCTCTCATCGCTTTGAAATGGCTACTGGGACGCATTTTTGCTCTTCTTTTAGGCAATTTATACGTATTTATTCTTGCATTAATGGATGAGATTAACAACAAGATTGAAGAGGAGAAGCTAGTAAAGGCCAATATTACCCTTTGGGAAGCCAATATGATCAAGGCCTACAATGCATCATTCTCTGAAAATAGCACTGGACCACCCTTTTTTGTTCACCCTGCAGATGTACCTCGAGGACCTTGCTGGGAAACAATGGTGGGACAGGAGTTTGTGAGGCTGACAGTCTCTGATGTTCTGACCACCTACGTCACAATCCTCATTGGGGACTTTCTAAGGGCATGTTTTGTGAGGTTTTGCAATTATTGCTGGTGCTGGGACTTGGAGTATGGATATCCTTCATACACCGAATTCGACATCAGTGGCAACGTCCTCGCTCTGATCTTCAACCAAGGCATGATCTGGATGGGCTCCTTCTTTGCTCCCAGCCTCCCAGGCATCAATATCCTTCGACTCCATACATCCATGTACTTCCAGTGCTGGGCCGTTATGTGCTGCAATGTTCCTGAGGCCAGGGTCTTCAAAGCTTCCAGATCAAATAACTTCTACCTGGGCATGCTACTGCTCATCCTCTTCCTGTCCACAATGCCTGTCTTGTACATGATCGTGTCCCTCCCACCATCTTTTGATTGTGGTCCATTCAGTGGCAAAAATAGAATGTTTGAAGTCATTGGAGAGACCCTGGAGCACGATTTCCCAAGCTGGATGGCGAAGATCTTGAGACAGCTTTCAAACCCTGGGCTGGTCATTGCTGTCATTTTGGTGATGGTTTTGGCCATCTATTATCTCAATGCTACTGCCAAGGGCCAGAAGGCAGCGAATCTGGATCTCAAAAAGAAGATGAAAATGCAAGCTTTGGAGAACAAAATGCGAAACAAGAAAATGGCAGCTGCACGAGCAGCTGCAGCTGCTGGTCGCCAGTAA(SEQ?ID?NO:5),
The protein of its coding has aminoacid sequence as follows:
MSPKKVQIKVEEKEDETEESSSEEEEEVEDKLPRRESLRPKRKRTRDVINEDDPEPEPEDEETRKAREKERRRRLKRGAEEEEIDEEELERLKAELDEKRQIIATVKCKPWKMEKKIEVLKEAKKFVSENEGALGKGKGKRWFAFKMMMAKKWAKFLRDFENFKAACVPWENKIKAIESQFGSSVASYFLFLRWMYGVNMVLFILTFSLIMLPEYLWGLPYGSLPRKTVPRAEEASAANFGVLYDFNGLAQYSVLFYGYYDNKRTIGWMNFRLPLSYFLVGIMCIGYSFLVVLKAMTKNIGDDGGGDDNTFNFSWKVFTSWDYLIGNPETADNKFNSITMNFKEAITEEKAAQVEENVHLIRFLRFLANFFVFLTLGGSGYLIFWAVKRS(SEQ?ID?NO:6)。
The TMC1 gene mutation body that contriver finds is compared with SEQ ID NO:1, and TMC1 gene of the present invention has c.589G>A c.1171C>T at least one of (p.Q391X) of (p.G197R) or nonsense mutation of a missense mutation.Particularly, with respect to wild-type TMC1 gene, the 589th G of the cDNA of TMC1 gene mutation body of the present invention sports A, and/or the C of the 1171st sports G.Thus, the albumen of its coding: the one at least with p.G197R and p.Q391X.It should be noted that, in " p.Q391X ", X represents to stop translation, is by the sudden change c.1171C>T causing, and mutant protein is 390 amino acid.
Further, contriver's discovery, when there is p.G197R and p.Q391X sudden change in TMC1 gene mutation body time simultaneously, the autosomal recessive inheritance type phonosensitive nerve deafness that detection of biological sample all suffers from.Whether the TMC1 gene mutation body by detection with 2 mutational sites exists in biological sample, can predict accurately and effectively whether organism suffers from autosomal recessive inheritance type phonosensitive nerve deafness.
According to a second aspect of the invention, the present invention proposes a kind of isolated polypeptide.According to embodiments of the invention, compared with SEQ ID NO:2, this polypeptide has and is selected from least one following sudden change: p.G197R, p.Q391X.According to a particular embodiment of the invention, this polypeptide is by the nucleic acid encoding of the coding TMC1 gene mutation body of aforementioned separation.By whether expressing this polypeptide in detection of biological sample, whether susceptible phonosensitive nerve deafness disease of detection of biological sample effectively, also can in organism, whether exist by detecting these polypeptide, can effectively predict whether susceptible phonosensitive nerve deafness disease of organism.
The method of the biological sample of phonosensitive nerve deafness disease is easily suffered from screening
According to a third aspect of the present invention, the present invention proposes a kind of method of the biological sample that screens easy trouble phonosensitive nerve deafness disease.According to embodiments of the invention, the method that the biological sample of phonosensitive nerve deafness disease is easily suffered from this screening can comprise the following steps:
First, from described extraction from biological material sample of nucleic acid.According to embodiments of the invention, the type of biological sample is also not particularly limited, and reflects whether biological sample TMC1 exists the sample of nucleic acid of sudden change as long as can extract from this biological sample.According to embodiments of the invention, biological sample can for be selected from blood of human body, skin, hypodermic at least one.Thus, can sample easily and detect, thereby can further improve the efficiency that the biological sample of phonosensitive nerve deafness disease is easily suffered from screening.According to embodiments of the invention, here the term " sample of nucleic acid " that used should be interpreted broadly, it can be anyly can reflect whether TMC1 in biological sample exists the sample of sudden change, it can be for example the complete genome DNA directly extracting from biological sample, also can be a part that comprises TMC1 encoding sequence in this full genome, can be the total RNA extracting from biological sample, can be also the mRNA extracting from biological sample.According to one embodiment of present invention, described sample of nucleic acid is complete genome DNA.Thus, can expand the source range that comes of biological sample, and can determine the much information of biological sample simultaneously, thereby can improve the efficiency that the biological sample of phonosensitive nerve deafness disease is easily suffered from screening.In addition, according to embodiments of the invention, for adopting RNA as sample of nucleic acid, may further include from extraction from biological material sample of nucleic acid: from extraction from biological material RNA sample, preferably RNA sample is mRNA; And RNA sample based on obtained, by reverse transcription reaction, obtain cDNA sample, the cDNA composition of sample sample of nucleic acid obtaining.Thus, can further improve and utilize RNA easily to suffer from the efficiency of the biological sample of phonosensitive nerve deafness disease as sample of nucleic acid screening.
Next, after obtaining sample of nucleic acid, can analyze sample of nucleic acid, thereby can determine the nucleotide sequence of obtained sample of nucleic acid.According to embodiments of the invention, the method and apparatus of the nucleotide sequence of definite sample of nucleic acid that obtains is also not particularly limited.According to a particular embodiment of the invention, can pass through sequence measurement, the nucleotide sequence of definite kernel acid sample.According to embodiments of the invention, can and be not particularly limited for the method and apparatus that checks order.According to embodiments of the invention, can adopt s-generation sequencing technologies, also can adopt the third generation and the 4th generation or more advanced sequencing technologies.According to concrete example of the present invention, can utilize be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device nucleotide sequence is checked order.Thus, in conjunction with up-to-date sequencing technologies, can reach the higher order-checking degree of depth for Single locus, detection sensitivity and accuracy improve greatly, thereby can utilize the high-throughput of these sequencing devices, the feature of degree of depth order-checking, further improve sample of nucleic acid is detected to the efficiency of analyzing.Thereby, can improve follow-up accuracy and accuracy when sequencing data is analyzed.Thus, according to embodiments of the invention, the nucleotide sequence of definite kernel acid sample may further include: first, for obtained sample of nucleic acid, build nucleic acid sequencing library; And checked order in obtained nucleic acid sequencing library, to obtain the sequencing result being formed by multiple sequencing datas.According to some embodiments of the present invention, can adopt be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device checked order in obtained nucleic acid sequencing library.In addition, according to embodiments of the invention, can screen sample of nucleic acid, enrichment TMC1 exon, this screening enrichment can, before building sequencing library, build in sequencing library process, or carries out after building sequencing library.According to one embodiment of present invention, for sample of nucleic acid, build nucleic acid sequencing library and further comprise: utilize TMC1 gene extron Auele Specific Primer, sample of nucleic acid is carried out to pcr amplification; And for obtained amplified production, build nucleic acid sequencing library.Thus, can pass through pcr amplification, enrichment TMC1 gene extron, thus can further improve the efficiency of the biological sample of screening susceptible phonosensitive nerve deafness disease.According to embodiments of the invention, the sequence of TMC1 gene extron Auele Specific Primer is not particularly limited, according to a preferred embodiment of the invention, these TMC1 gene extron Auele Specific Primers have nucleotide sequence as shown in the table, i.e. nucleotide sequence shown in SEQ ID NO:7-10.Contriver is surprised to find, by adopting these primers, can in PCR reaction system, significantly effectively complete especially c.589G>A, c.1171C>T the suddenly change amplification of exon sequence at place of TMC1 exon.It should be noted that, the nucleotide sequence shown in these SEQ ID NO:7-10 is that the present inventor is paying after arduous labor, unexpected acquisition.
According to a particular embodiment of the invention, above-mentioned phonosensitive nerve deafness disease is autosomal recessive disease.
About for sample of nucleic acid; build method and the flow process of sequencing library; those skilled in the art can suitably select according to different sequencing technologies; about the details of flow process; can be referring to manufacturer's code that for example Illumina company provides of order-checking instrument, for example, referring to the Multiplexing Sample Preparation Guide(Part#1005361 of Illumina company; Or Paired-End SamplePrep Guide(Part#1005063 Feb2010); Feb2010), be incorporated to herein by reference.According to embodiments of the invention, from the method and apparatus of extraction from biological material sample of nucleic acid, be also not particularly limited, can adopt commercial nucleic acid extraction kit to carry out.
It should be noted that, broad understanding should be made in the term " nucleotide sequence " that here used, it can be after the sequencing data that obtains that sample of nucleic acid is checked order is assembled, the complete nucleic acid sequence information obtaining, also can be directly to adopt by obtained sequencing data (reads) that sample of nucleic acid is checked order as nucleotide sequence, as long as the encoding sequence that contains corresponding TMC1 gene in these nucleotide sequences.
Finally, after the nucleotide sequence of definite kernel acid sample, the sequence of the nucleotide sequence of obtained sample of nucleic acid and SEQ ID NO:1 is compared.If have c.589G>A in obtained nucleotide sequence, c.1171C>T suddenly change, indicator organism sample is easily suffered from phonosensitive nerve deafness disease.Thus, by easily suffer from the method for the biological sample of phonosensitive nerve deafness disease according to the screening of the embodiment of the present invention, can effectively screen the biological sample of easy trouble phonosensitive nerve deafness disease.According to embodiments of the invention, the method and apparatus that nucleotide sequence and SEQ ID NO:1 are compared is also not particularly limited, and can adopt the software of any conventional to operate, and according to specific examples of the present invention, can adopt SOAP software to compare.
It should be noted that, be not particularly limited according to the purposes of " method of the biological sample of phonosensitive nerve deafness disease is easily suffered from screening " of the embodiment of the present invention, for example can be as the screening method of non-diagnostic purpose.
System and the test kit of the biological sample of phonosensitive nerve deafness disease easily suffered from screening
According to a fourth aspect of the present invention, the present invention proposes a kind of system of the biological sample that screens easy trouble phonosensitive nerve deafness disease.
With reference to figure 1, according to embodiments of the invention, the system 1000 that the biological sample of phonosensitive nerve deafness disease is easily suffered from this screening comprises nucleic acid-extracting apparatus 100, nucleotide sequence determining device 200 and judgment means 300.
According to embodiments of the invention, nucleic acid-extracting apparatus 100 is for from extraction from biological material sample of nucleic acid.As previously mentioned, according to embodiments of the invention, the type of sample of nucleic acid is also not particularly limited, and for adopting RNA as sample of nucleic acid, nucleic acid-extracting apparatus further comprises RNA extraction unit 101 and reverse transcription unit 102, wherein, extraction unit 101 is for from extraction from biological material RNA sample, and reverse transcription unit 102 is connected with RNA extraction unit 101, for RNA sample is carried out to reverse transcription reaction, to obtain cDNA sample, the cDNA composition of sample sample of nucleic acid obtaining.
According to embodiments of the invention, nucleotide sequence determining device 200 is connected with nucleic acid-extracting apparatus 100, for sample of nucleic acid is analyzed, so that the nucleotide sequence of definite kernel acid sample.As previously shown, can adopt the nucleotide sequence of the method definite kernel acid sample of order-checking.Thus, according to one embodiment of present invention, described nucleotide sequence determining device 200 may further include: library construction unit 201 and order-checking unit 202.Library construction unit 201, for for sample of nucleic acid, builds nucleic acid sequencing library; Order-checking unit 202 is connected with library construction unit 201, for being checked order in nucleic acid sequencing library, to obtain the sequencing result being made up of multiple sequencing datas.As previously mentioned, can pass through pcr amplification, enrichment TMC1 exon, further improves the efficiency that the biological sample of phonosensitive nerve deafness disease is easily suffered from screening.Thus, library construction unit 201 may further include pcr amplification module (not shown), in this pcr amplification module, be provided with TMC1 exon Auele Specific Primer, to utilize TMC1 exon Auele Specific Primer, described sample of nucleic acid is carried out to pcr amplification, according to a particular embodiment of the invention, TMC1 gene extron Auele Specific Primer has the nucleotide sequence as shown in SEQ ID NO:7-10.According to embodiments of the invention, order-checking unit 202 can comprise and is selected from HISEQ2000, SOLiD, 454 and at least one of single-molecule sequencing device.Thus, in conjunction with up-to-date sequencing technologies, can reach the higher order-checking degree of depth for Single locus, detection sensitivity and accuracy improve greatly, thereby can utilize the high-throughput of these sequencing devices, the feature of degree of depth order-checking, further improve sample of nucleic acid is detected to the efficiency of analyzing.Thereby, improve follow-up accuracy and accuracy when sequencing data is analyzed.
According to embodiments of the invention, judgment means 300 is connected with nucleotide sequence determining device 200, be suitable for the nucleotide sequence of sample of nucleic acid to compare, so that the difference of the nucleotide sequence based on sample of nucleic acid and SEQ ID NO:1 judges whether biological sample easily suffers from phonosensitive nerve deafness disease.Particularly, whether the nucleotide sequence based on sample of nucleic acid, compared with SEQ ID NO:1, has at least one sudden change c.589G>A, c.1171C>T, judges whether biological sample easily suffers from phonosensitive nerve deafness disease.As previously mentioned, according to one embodiment of present invention, the nucleotide sequence of sample of nucleic acid, compared with SEQ ID NO:1, has at least one sudden change c.589G>A, c.1171C>T, is the instruction that biological sample is easily suffered from phonosensitive nerve deafness disease.As previously mentioned, according to embodiments of the invention, the equipment that nucleotide sequence and SEQ ID NO:1 are compared is also not particularly limited, and can adopt the software of any conventional to operate, and according to specific examples of the present invention, can adopt SOAP software to compare.
Thus, utilize this system, can effectively implement the method that the biological sample of phonosensitive nerve deafness disease is easily suffered from aforementioned screening, thereby can effectively screen the biological sample of easy trouble phonosensitive nerve deafness disease.
According to a fifth aspect of the invention, the present invention proposes a kind of for screening the test kit of biological sample of easy trouble phonosensitive nerve deafness disease.According to embodiments of the invention, this test kit that is used for the biological sample that screens easy trouble phonosensitive nerve deafness disease comprises: the reagent that is suitable for detecting TMC1 gene mutation body, wherein, compared with SEQ ID NO:1, this TMC1 gene mutation body has at least one sudden change c.589G>A, c.1171C>T.Utilize test kit according to an embodiment of the invention, can effectively screen the biological sample of easy trouble phonosensitive nerve deafness disease.In this article, the term using " is suitable for detecting the reagent of TMC1 gene mutation body " and should be interpreted broadly, can be the reagent that detects TMC1 encoding gene, can be also the reagent that detects TMC1 mutant polypeptide, for example, can adopt the antibody in identification specificity site.According to one embodiment of present invention, described reagent is nucleic acid probe, thus, can screen efficiently the biological sample of easy trouble phonosensitive nerve deafness disease.According to a particular embodiment of the invention, above-mentioned phonosensitive nerve deafness disease is autosomal recessive disease.
It should be noted that, feature and advantage before herein described in the method part of the easy biological sample of suffering from phonosensitive nerve deafness disease of screening, the system or the test kit that are equally applicable to the biological sample that screens easy trouble phonosensitive nerve deafness disease, do not repeat them here.
Below with reference to specific embodiment, the present invention will be described, it should be noted that, these embodiment are only illustrative, and can not be interpreted as limitation of the present invention.
If do not specialize, the conventional means that the technique means adopting in embodiment is well known to those skilled in the art, can carry out with reference to " molecular cloning experiment guide " third edition or related products, and the reagent adopting and product are also and can business obtain.Various processes and the method do not described in detail are ordinary methods as known in the art, source, the trade(brand)name of agents useful for same and be necessary to list its moiety person, all in the time occurring first, indicate, identical reagent used is if no special instructions, all identical with the content of indicating first thereafter.
Embodiment 1 determines the Disease-causing gene of phonosensitive nerve deafness disease
1, sample collection:
Contriver collects the Chinese phonosensitive nerve deafness patient family in 2 generations, and the gene of 208 normal peoples outside this family.Fig. 1 has shown the family collection of illustrative plates of phonosensitive nerve deafness patient family 1.As shown in Figure 2, wherein, represents normal male, and zero represents normal female, and ■ represents male patient, ● represent female patient.As shown in Figure 2, this family has 4 members, and wherein s-generation children are phonosensitive nerve deafness patient, and the father and mother of the first-generation are normal member.
In addition, it is normal that contriver has all carried out temporal bone CT examination to all patients in this family, and inner ear is without lopsided (see figure 2), but without concurrency systemic disease, above result prove disease that patient takes a disease in this family certain be phonosensitive nerve deafness.
Contriver uses the full exon trapping platform of NimbleGen SeqCap EZ Human Exome Library v2.0, in conjunction with the high throughput sequencing technologies of Illumina Hiseq2000, two patients and the normal father and mother of phenotype thereof have been carried out to full exon group and caught order-checking, detailed step is as follows:
1, genomic dna is broken at random to the fragment of 250-300bp left and right, connects respectively subsequently top connection preparation hybridization library at fragment two ends and (refer to
http:// www.illumina.com/the Illumina/Solexa standard providing is built storehouse specification sheets).
2, enrichment is hybridized through linear amplification and the capture agent of ligation-mediated PCR (LM-PCR) in the library after purifying, carries out carrying out upper machine order-checking after the linear amplification of LM-PCR.Order-checking platform is Illumina Hiseq2000, and reading length is 90bp, the average order-checking degree of depth of each sample is minimum is 50 ×.
3, the raw data obtaining after order-checking is processed by Illumina basecalling Software1.7, uses SOAPaligner2.20 that the reads after filtering is compared with reference to genome, obtains comparison to the Unique mapped reads on genome.Utilize software SOAPsnp
[3]determine the genotype of target region.
After information analysis, case 1 is found 86101 single nucleotide polymorphism (SNPs) and 6476 insertion/deletions (Indels), and case 2 is found 88376 SNP and 6601 Indel.By result and dbSNP database (
http:// hgdownload.cse.ucsc.edu/goldenPath/hg19/database/snp132. txt.gz), HapMap database (
ftp: //ftp.ncbi.nlm.nih.gov/hapmap), thousand human genome databases (
ftp: //ftp.1000genomes.ebi.ac.uk/vol1/ftp), Yan Di and Huang Di, two legendary rulers of remote antiquity's database (
http:// yh.genomics.org.cn/) etc. public database compare, filter out all known variations.
Phonosensitive nerve deafness belongs to normal hidden and normal aobvious two kinds of hereditary patterns, and this research, in conjunction with family practical situation, is used recessive inheritance analysis of strategies.Family result after analyzing is got to common factor with the current relevant list of genes with deafness of having reported, obtain the sudden change of 10 knowns.The comprehensive sequencing quality of contriver, the reference of information analysis data screening, in conjunction with recessive inheritance pattern: father and mother's heterozygous mutant, child's homozygous mutation or father and mother's same gene respectively have two sudden changes (compound heterozygosis) with a sudden change, child simultaneously, find that the sudden change on TMC1 is eligible.In TMC1, having 2, to sport patient total: c.589G>A (p.G197R) of missense mutation, c.1171C>T (p.Q391X) of nonsense mutation, according to information science analysis, in this family, as father and mother are respectively with a sudden change, the missense mutation in TMC1 and nonsense mutation can form compound heterozygous mutations.For determining analytical results, contriver carries out sanger sequence verification (in table 3) to two routine case and the normal father and mother of phenotype, found that two patients carry c.589G>A (p.G197R) and c.1171C>T (p.Q391X) of nonsense mutation of missense mutation on TMC1, mother only carries missense mutation, father only carries nonsense mutation, in normal people without these two kinds of sudden changes.Because TMC1 gene is deaf Disease-causing gene, deducibility: missense mutation c.589G>A (p.G197R) and the nonsense mutation compound heterozygous mutations that c.1171C>T (p.Q391X) forms is this family pathogenic mutation.
TMC1 is known deaf Disease-causing gene, and this gene comprises 24 exons, and proteins encoded size is 87.78KDa.TMC1 is transmembrane protein, participates in cochlear hair cell normal physiological function.Research shows, the sudden change of this gene can cause autosomal dominant and recessive inheritance induced deafness.
TMC1 gene is positive-sense strand coding.Wild-type cDNA sequence is as shown in SEQ ID NO:1.
The Disease-causing gene of embodiment 2Sanger method sequence verification phonosensitive nerve deafness disease
Gather the peripheral blood of four members in pedigree chart 2, utilize QIAmp Blood kit (Qiagen, Hilden, Germany) genomic dna in extracting peripheral blood leucocyte, utilize Qubit Fluorometer and agarose gel electrophoresis to measure concentration and the purity of DNA, each sample genomic dna OD260/OD280 of gained is all between 1.7-2.0, and concentration is no less than 50ng/ul, and total amount is no less than 3 μ g.
Respectively to 2 patients (II in Fig. 2: 1, II: 2), normal people in 2 familys (I in Fig. 2: 1, I: 2) and 208 outer normal people's genes of familys detect, for this place, TMC1 gene compound heterozygous mutations site primers, pass through pcr amplification, product purification, the method of order-checking obtains relevant sequence, belong to saltant type or wild-type according to sequencing result, and whether sudden change is in family and is divided into from verifying dependency with phenotype.Concrete grammar step is as follows:
1) DNA extraction:
Take respectively normal people and outer 208 the normal people's peripheric venous bloods of family in 2 family troubles persons, 2 familys to extract genomic dna, measure DNA content and purity according to the method for embodiment 1.
2) design of primers and PCR reaction
Design of primers reference men and women's genoid data unit sequence storehouse GRCh37/hg19, under specifically seeing.
A) primer sequence:
B) PCR reaction system:
Distilled water |
15.3μl |
10X damping fluid |
2μl |
Template |
1μl |
Upstream medicine |
0.5μl |
Downstream primer |
0.5μl |
Deoxy-ribonucleoside triphosphate |
0.5μl |
TransStart Taq polysaccharase |
0.2μl |
Cumulative volume |
20μl |
C) PCR reaction conditions:
95℃ |
5 minutes |
? |
95℃ |
45 seconds |
9 circulations;-0.2/ circulation |
58℃ |
45 seconds |
? |
72℃ |
30 seconds |
? |
95℃ |
45 seconds |
34 circulations;-0.1/ circulation |
55℃ |
45 seconds |
? |
72℃ |
30 seconds |
? |
72℃ |
5 minutes |
? |
10℃ |
∞ |
? |
3) pcr amplification product available from normal people in 2 routine patients, 2 familys obtaining in step 2 is directly carried out to DNA sequencing.
In patient family member to TMC1 gene mutation site place encoding sequence and the flanking sequence investigation of suddenling change, patient's II: 1, II: c.1171C>T 2 all have and compound heterozygous mutations c.589G>A, I: 1, I: 2 are carrier, i.e. I: 1 only has c.1171C>T sudden change; I: 2 only have c.589G>A(in table 1 and Fig. 4).
Table 1
New compound heterozygous mutations in TMC1 gene of the present invention: missense mutation is (p.G197R) and c.1171C>T (p.Q391X) of nonsense mutation c.589G>A, can judge the ill possibility of crowd of not falling ill in this family, can be used for the appraisement and diagnosis of the ill probability of the offspring of family simultaneously, avoid carrying deaf youngster's birth of this sudden change for patient and family provide genetic counseling and antenatal diagnosis.
Studies confirm that TMC1 transgenation can cause autosomal dominant and recessive deaf.Our research shows: TMC1c.589G>A and be c.1171C>T the sudden change that causes recessive hereditary deafness.
The invention discloses the new mutant of two kinds of known deaf genes (TMC1), confirmed first its molecular disease that is recessive hereditary deafness because of, in 208 routine Chinese normal good hearing crowds, carry out the examination in this site, all negative.Deaf gene mutation spectrum has been enriched in this research, provides genetics foundation for carrying out hereditary hearing impairment molecular diagnosis.
Embodiment 3 detection kit
Preparation detection kit, the primer pair c.589G>A and c.1171C>T that wherein contains detection sudden change sees the following form:
Extract person DNA to be measured according to the method described in embodiment 1, react as template and above-mentioned primer carry out PCR taking the DNA being extracted,, to PCR product purification the product of purifying is checked order according to this area ordinary method.C.589G>A whether the sequence that observing checks order obtains have and c.1171C>T sudden change.
In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " example ", " concrete example " or " some examples " etc. means to be contained at least one embodiment of the present invention or example in conjunction with specific features, structure, material or the feature of this embodiment or example description.In this manual, the schematic statement of above-mentioned term is not necessarily referred to identical embodiment or example.And specific features, structure, material or the feature of description can be with suitable mode combination in any one or more embodiment or example.
Although illustrated and described embodiments of the invention above, be understandable that, above-described embodiment is exemplary, can not be interpreted as limitation of the present invention, those of ordinary skill in the art can change above-described embodiment within the scope of the invention in the situation that not departing from principle of the present invention and aim, amendment, replacement and modification.