CN103710340B - A kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene - Google Patents
A kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene Download PDFInfo
- Publication number
- CN103710340B CN103710340B CN201310472734.5A CN201310472734A CN103710340B CN 103710340 B CN103710340 B CN 103710340B CN 201310472734 A CN201310472734 A CN 201310472734A CN 103710340 B CN103710340 B CN 103710340B
- Authority
- CN
- China
- Prior art keywords
- dna
- usher syndrome
- pcr amplification
- gene
- diagnostic reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The present invention relates to a kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene.Described diagnostic reagent comprises, and 1) DNA extraction system reagent box: tested individual peripheric venous blood extracting genome DNA; 2) PCR amplification system test kit and 3) DNA sequencing system, it is characterized in that: described PCR amplification system: the genomic dna extracted with peripheric venous blood is for template, carry out pcr amplification with (a) and (b) two groups of primers simultaneously, described DNA sequencing system: pcr amplification product is directly carried out DNA sequencing, and contrast with former MYO7A genes encoding DNA sequence dna; When in amplified production c.73G > A and c.462C > A sudden change all exist time, for I type USHER syndrome patient, when existence suddenlys change for the moment, be I type USHER syndrome carrier, when two sudden changes all do not exist, it is healthy individuals.Present invention achieves clinically to the convenient and swift gene screening accurately of USHER syndrome patient and diagnosis.
Description
Technical field
The present invention relates to a kind of transgenation and apply the diagnostic reagent of this mutator gene, be specifically related to a kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene.
Background technology
USHER syndrome is also known as hereditary retinitis pigme ntosa-phonosensitive nerve deafness syndrome.According to statistics, 10% is about had in congenital severe-pole profound sensorineural hearing loss patient for USHER syndrome.Clinically USHER syndrome is divided into 3 types, I type is congenital severe-pole severe deafness, and companion's vestibular reflexes disappear, and within about 10 years old, occurring retinitis pigmentosa, is a type the heaviest in three types.Due to such patient be born after only show as deaf and dumb, just there is visual disorder after 10 years old, therefore rely on merely clinical audition inspection very easily to fail to pinpoint a disease in diagnosis.If early screening goes out USHER syndrome patient, and there is advance row artificial cave at visual disorder, then effectively can avoid the generation that severe visual-hearing-speech associating is disabled.
In the past because people lack the deep understanding of USHER syndrome genetic aetiology and diagnostic techniques, most of case all cannot specify molecular disease because of, it more cannot be prevented to occur.Over nearly 30 years, the fast development of adjoint deaf inheritance nosetiology and Protocols in Molecular Biology, existing 5 I type USHER syndrome genes are cloned so far, have enriched USHER syndrome gene profile.But in China, although there is numerous USHER syndrome patients, its molecular disease, because of how unclear, is difficult to clarify a diagnosis, USHER syndrome is prevented and treated extremely difficult.
Research confirms that MYO7A transgenation can cause I type USHER syndrome and recessive hereditary deafness [1,2], be modal I type USHER syndrome Disease-causing gene, the I type USHER syndrome patient of about 50% causes by this transgenation clinically.MYO7A gene is positioned at No. 11 chromosome long arm, comprises 49 exons, 2215 amino acid of encoding, and gene is comparatively large, and traditional PCR, order-checking detection method are consuming time, effort, are therefore difficult to routine inspection clinically.If the pathogenic mutation site of clear and definite MYO7A gene, design the detection chip for pathogenic mutation site, be then expected to solve a difficult problem for I type USHER syndrome patient gene screening, diagnosis clinically.
Existing bibliographical information MYO7A genes encoding DNA the 73rd bit base---guanine replaces with VITAMIN B4 and causes the 25th of coded amino acid the glycine mutation to be arginine (c.73G > A, p.G25R), for a kind of I type USHER syndrome associated gene mutation, but only have 2 allelotrope to carry this sudden change just to cause a disease simultaneously, if 1 to carry this sudden change not pathogenic for gene, this finds the difficult problem being not enough to solve I type USHER syndrome patient gene screening, diagnosis clinically.Find new pathogenic mutation, enrich I type USHER syndrome gene profile and mutation spectrum by for clinically conveniently examination and diagnosis I type USHER syndrome patient important target spot and theoretical foundation are provided, being that this area research worker is tireless probes into field.
Goal of the invention
In view of this, in order to solve a difficult problem of the prior art, the present inventor is through the research of hardships, and found another kind of I type USHER syndrome associated gene mutation, this sudden change and 73 known bit base associated gene mutations, in conjunction with examination, can effectively solve an above-mentioned difficult problem.
The present invention also provide application above-mentioned newfound I type USHER syndrome related mutation be combined with known related mutation clinically can examination effectively quickly, diagnose the syndromic Molecular Etiology diagnostic reagent of I type USHER.
A kind of I type USHER syndrome associated gene mutation provided by the invention, the 462nd bit base cytosine(Cyt) of the described MYO7A of sporting genes encoding DNA replaces with VITAMIN B4 and causes the 154th of coded amino acid the cysteine mutation to be stop code (c.462C > A, p.C154X).
A kind of deaf Molecular Etiology diagnostic reagent containing above-mentioned I type USHER syndrome related mutation gene provided by the invention, described diagnostic reagent comprises, and 1) DNA extraction system reagent box: tested individual peripheric venous blood extracting genome DNA; 2) PCR amplification system test kit and 3) DNA sequencing system, described PCR amplification system: the genomic dna extracted with peripheric venous blood, for template, carries out pcr amplification with (a) and (b) two groups of primers simultaneously,
In tool: (a) organizes primer is upstream primer (5 ' → 3 '): TTGTAGCAGAGGGATATAGGGC, downstream primer (5 ' → 3 '): GGGGACTACTCACATTGTCTTCA,
B () group primer is upstream primer (5 ' → 3 '): CTGGTGGCTGTGAACCCCTA, downstream primer (5 ' → 3 '): GCTTGATGGCATTTCCGAC;
Described DNA sequencing system: pcr amplification product is directly carried out DNA sequencing, and contrast with former MYO7A genes encoding DNA sequence dna:
When in amplified production c.73G > A and c.462C > A sudden change all exist time, for I type USHER syndrome patient, when existence suddenlys change for the moment, be I type USHER syndrome carrier, when two sudden changes all do not exist, it is healthy individuals.
MYO7A albumen is unconventional myosin, has played vital role in the formation of cochlear hair cell stereocilium.
462nd bit base of MYO7A genes encoding DNA---cytosine(Cyt) replaces with VITAMIN B4 and causes the 154th of coded amino acid the cysteine mutation to be stop code (c.462C > A, p.C154X) be the sudden change causing recessive hereditary deafness of present inventor's Late Cambrian, and confirm first its be the syndromic molecular disease of I type USHER because of one of, in 219 routine Chinese normal-hearing people, carry out the examination in this site, be feminine gender.USHER syndrome gene profile and mutation spectrum have been enriched in this research, provide genetics foundation for carrying out USHER syndrome molecular diagnosis.The research carrying out I type USHER syndrome genes involved and mutation spectrum thereof in China is research and develop the screening instruments being applicable to Chinese population to provide theoretical foundation and examination target spot.
Beneficial effect of the present invention is:
1. the invention discloses a kind of new mutant of known I type USHER syndrome (MYO7A), confirm that itself and the 73rd bit base suddenly change (c.73G > A first, p.G25R) cooperatively determine the syndromic molecular disease of I type USHER because of, USHER syndrome gene mutation spectrum has been enriched in this research, provides genetics foundation and important target spot for carrying out USHER syndrome molecular diagnosis.
2. the compound heterozygous mutations of MYO7A gene in the inventive method: c.73G > A (p.G25R) missense mutation and c.462C > A (p.C154X) nonsense mutation is verified causes I type USHER syndrome, the possibility that the crowd that do not fall ill in this family is ill can be judged by gene diagnosis, the diagnosis of disease and intervention are advanced to when not falling ill, reduce the handicapped incidence of this family.
3. the invention provides the effective pcr amplification primer and diagnostic reagent based on this that increase in two mutational sites simultaneously, be easy to screening procedure and diagnosis, as c.73G > A and c.462C > A sudden change all exists time, for I type USHER syndrome patient, when existence suddenlys change it for the moment, for I type USHER syndrome carrier, when two sudden changes all do not exist for healthy, thus solve a difficult problem for USHER syndrome patient gene screening, diagnosis clinically.
Accompanying drawing illustrates:
Fig. 1 pedigree chart and the common separating resulting of MYO7A sudden change in family.(genotype of 9 lineal relatives all marks.)
Fig. 2 family few members MYO7A abrupt climatic change result
Sequencing result shows all patient (II:1, II:2, II:4, II:5) MYO7A gene c.73G > A is all carried, c.462C > A sudden change .II3 does not carry pathogenic mutation, father and mother are Normal carriers, and namely I: 1 only has c.462C > A to suddenly change; I:2 only has c.73G > A to suddenly change.
Embodiment:
Embodiment 1 I type USHER of the present invention syndrome associated gene mutation
Contriver uses 131 known deaf gene capture platforms, and in conjunction with the high throughput sequencing technologies of IlluminaHiseq2000, carried out 131 full exon trapping order-checkings of deaf gene to 4 patients and the normal father and mother of phenotype thereof, detailed step is as follows:
(1) genomic dna is broken at random the fragment of about 250-300bp, connects top connection respectively at fragment two ends subsequently and prepare Hybrid Library.
(2) exon of 131 known deaf genes and flank 50bp sequence are caught, adopt parallel sequencing technology of future generation to check order.Order-checking platform is IlluminaHiseq2000, and hybridization probe length is 0.5-1.6kbps.The average order-checking degree of depth of each sample is minimum is 50 ×.
(3) raw data obtained after order-checking is by IlluminabasecallingSoftware1.7 process, reads comparison after filtration to reference to genome, is obtained comparison to the Uniquemappedreads on genome by use SOAPaligner2.20.Software SOAPsnp is utilized to determine the genotype of target region.
(http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/snp132. txt.gz), HapMap database (ftp: //ftp.ncbi.nlm.nih.gov/hapmap), thousand human genome databases (ftp: //ftp.1000genomes.ebi.ac.uk/vol1/ftp), compare Deng public database, filter out all known variations.
USHER syndrome is autosomal recessive inheritance, and this research, in conjunction with family practical situation, uses recessive inheritance analysis of strategies.Result of increasing the interest after analyzing is got common factor with the current list of genes relevant with I type USHER reported, obtains the sudden change of 17 knowns, the sudden change that wherein 4 patients have has 2.The screening that comprehensive sequencing quality and information analysis provide is with reference to (as the harm of SIFT predicted protein), contriver is in conjunction with recessive analysis of strategies, namely father and mother's heterozygous mutant, child's homozygous mutation or father and mother's same gene respectively have two sudden changes (compound heterozygosis) with a sudden change, child simultaneously, find that the sudden change on MYO7A gene is eligible.According to analysis, have 2 to sport patient in MYO7A to have: missense mutation c.73G > A (p.G25R) is present in mother, nonsense mutation c.462C > A (p.C154X) is present in father.Determine analytical results, contriver carries out sanger sequence verification to result, found that 4 patients carry c.73G > A (p.G25R) missense mutation on MYO7A and c.462C > A (p.C154X) nonsense mutation, father carries missense mutation, mother carries splice mutation (concrete outcome is shown in Fig. 2), without these two kinds sudden changes in normal people.Thus, tentatively can infer that above-mentioned missense mutation and nonsense mutation are this family pathogenic mutation.
Embodiment 2 applies the deaf Molecular Etiology diagnostic reagent of said mutation gene
Comprise 1) DNA extraction system reagent box: tested individual peripheric venous blood extracting genome DNA, 2) PCR amplification system test kit and 3) DNA sequencing system.
Concrete operations gather as follows pedigree chart 1 mark the peripheral blood of 9 directly-related members, utilize DNA extraction system reagent box QIAmpBloodkit (Qiagen, Hilden, Germany) genomic dna in extracting peripheral blood leucocyte, QubitFluorometer and agarose gel electrophoresis is utilized to measure concentration and the purity of DNA, each sample genomic dna OD260/OD280 of gained is all between 1.7-2.0, and concentration is no less than 50ng/ul, and total amount is no less than 3 μ g.
Respectively to 4 patient (II1 namely in Fig. 1, II2, II4, II5), normal people (the father and mother I1 of patient, I2, the normal children III:1 of the fraternal II3 do not fallen ill and patient in 5 familys, III:3) and the outer normal peoples of 219 familys adopt PCR amplification system test kit of the present invention, for this place, MYO7A gene compound heterozygous mutations site primers, by PCR reaction amplification, 2) design of primers and PCR reaction
Design of primers reference men and women genoid data unit sequence storehouse GRCh37/hg19, under being specifically shown in.
A) primer sequence:
B) PCR reaction system:
C) PCR reaction conditions:
Purifying is carried out to amplified production.
DNA sequencing system is adopted to carry out DNA sequencing the pcr amplification product available from normal people and 219 routine hearing normal controls in 4 routine patients, 5 familys.
In patient family member, sudden change investigation is carried out to MYO7A gene mutation site place encoding sequence and flanking sequence, follow autosomal recessive inheritance pattern, only have and carry 2 sudden changes just morbidity, if only carry one to sport Normal carriers simultaneously.Patient II1, II2, II4, II5 all have c.73G > A and c.462C > A suddenly change, II3 does not carry pathogenic mutation, and father and mother are Normal carriers, and namely I1 only has c.462C > A to suddenly change; I2 only has c.73G > A; Patient II2, II4 offspring III:1, III:3 only have c.462C > A to suddenly change, and do not fall ill (Fig. 1).A family, 4 children are ill, and 1 child is normal, and father and mother are normal, meet autosomal recessive inheritance pattern.(see Fig. 2)
Embodiment 3
219 routine hearing normal control examinations do not find carrying of above two sudden changes, show this sudden change rare in normal population.In 219 routine Chinese normal-hearing people, carry out the examination in this site, be feminine gender.
Reference
1.Weil，D.，etal.，Theautosomalrecessiveisolateddeafness，DFNB2，andtheUsher1Bsyndromeareallelicdefectsofthemyosin-VIIAgene.NatGenet，1997.16(2)：p.191-3.
2.Maubaret，C.，etal.，NovelmutationsinMYO7AandUSH2AinUshersyndrome.OphthalmicGenet，2005.26(1)：p.25-9.
Claims (1)
1. the deaf Molecular Etiology diagnostic reagent containing I type USHER syndrome associated gene mutation, described diagnostic reagent comprises, and 1) DNA extraction system reagent box: tested individual peripheric venous blood extracting genome DNA; 2) PCR amplification system test kit and 3) DNA sequencing system, it is characterized in that: described PCR amplification system: the genomic dna extracted with peripheric venous blood is for template, carry out pcr amplification with (a) and (b) two groups of primers simultaneously, wherein:
(a) group primer upstream primer (5 ' → 3 '): TTGTAGCAGAGGGATATAGGGC, downstream primer
(5’→3’)：GGGGACTACTCACATTGTCTTCA，
(b) group primer upstream primer (5 ' → 3 '): CTGGTGGCTGTGAACCCCTA, downstream primer
(5’→3’)：GCTTGATGGCATTTCCGAC；
Described DNA sequencing system: pcr amplification product is directly carried out DNA sequencing, and contrast with former MYO7A genes encoding DNA sequence dna; When in amplified production c.73G > A and c.462C > A sudden change all exist time, for I type USHER syndrome patient, when existence suddenlys change for the moment, be I type USHER syndrome carrier, when two sudden changes all do not exist, it is healthy individuals.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310472734.5A CN103710340B (en) | 2013-10-12 | 2013-10-12 | A kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310472734.5A CN103710340B (en) | 2013-10-12 | 2013-10-12 | A kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103710340A CN103710340A (en) | 2014-04-09 |
| CN103710340B true CN103710340B (en) | 2016-01-27 |
Family
ID=50403698
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310472734.5A Expired - Fee Related CN103710340B (en) | 2013-10-12 | 2013-10-12 | A kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710340B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148528B (en) * | 2016-07-11 | 2019-10-01 | 赵晨 | A kind of pathogenic mutation and its detection reagent of heredity Usher syndrome |
| GB201616202D0 (en) * | 2016-09-23 | 2016-11-09 | Proqr Therapeutics Ii Bv | Antisense oligonucleotides for the treatment of eye deisease |
| CN110878306B (en) * | 2018-09-06 | 2021-10-19 | 中国人民解放军总医院 | Gene mutant and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732616A (en) * | 2012-05-29 | 2012-10-17 | 王秋菊 | Detection kit for c.403>T mutation of CDH23 gene |
-
2013
- 2013-10-12 CN CN201310472734.5A patent/CN103710340B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732616A (en) * | 2012-05-29 | 2012-10-17 | 王秋菊 | Detection kit for c.403>T mutation of CDH23 gene |
Non-Patent Citations (2)
| Title |
|---|
| Novel compound heterozygous mutations in MY07A associated with Usher syndrome 1 in a chinese family;Xue Gao et al.;《PLOS ONE》;20140731;第9卷(第7期);e103415 * |
| Novel Mutations in MYO7A and USH2A in Usher syndrome;C´ecilia Maubaret and Jean-Michel Griffoin;《Ophthalmic Genetics》;20051231;第26卷(第1期);摘要，表1.第26页左栏第2-3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103710340A (en) | 2014-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103667438B (en) | Method for screening HRDs disease-causing mutation and gene chip hybridization probe designing method involved in same | |
| CN103981273B (en) | Mutant gene group for mammary cancer risk assessment and detection kit thereof | |
| CN105779572A (en) | Chip and method for capturing target sequences of tumor susceptibility genes, and mutation detection method | |
| CN104232777A (en) | Method and device for simultaneously determining fetal nucleic acid content and aneuploidy of chromosome | |
| CN104561016B (en) | New mutation of congenital cataract PITX3 gene | |
| CN113257346B (en) | Method for evaluating HRD score based on low-depth WGS | |
| CN103710340B (en) | A kind of I type USHER syndrome associated gene mutation and apply the deaf Molecular Etiology diagnostic reagent of this mutator gene | |
| CN106906220B (en) | A kind of COL4A5 gene of mutation and its application | |
| CN106282195A (en) | Gene mutation body and application thereof | |
| CN103571847A (en) | FOXC1 gene mutant and its application | |
| Wei et al. | Next-generation sequencing identifies a novel compound heterozygous mutation in MYO7A in a Chinese patient with Usher Syndrome 1B | |
| CN104073499B (en) | TMC1 gene mutation body and its application | |
| CN103757028A (en) | OSBPL2 mutant gene as well as identification method and detection kit thereof | |
| CN105838720B (en) | PTPRQ gene mutation body and its application | |
| CN106967808A (en) | A kind of primer sets and its application for being used to detect RhD negative blood groups | |
| CN104099338B (en) | MYO15A gene mutation body and its application | |
| Li et al. | Cordblood-based high-throughput screening for deafness gene of 646 newborns in Jinan area of China | |
| CN104673928B (en) | Pathopoiesia mutation of hereditary cone cell malnutrition disease and detection reagent thereof | |
| CN108866067B (en) | Pathogenic mutation of Leber congenital amaurosis and detection reagent thereof | |
| CN106148528B (en) | A kind of pathogenic mutation and its detection reagent of heredity Usher syndrome | |
| CN111334513A (en) | Non-syndromic cleft lip related low-frequency/rare mutation and detection method thereof | |
| CN103509799B (en) | Hypertrophic osteoarthropathy,primary Disease-causing gene | |
| Lai et al. | The utility of next-generation sequencing in the evaluation of the posterior polymorphous corneal dystrophy 1 locus | |
| CN116218862B (en) | SELENOO gene mutant and application thereof | |
| CN103509801A (en) | Skeletal muscle chloride ion channel gene mutant and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160127 Termination date: 20161012 |