CN104031895B

CN104031895B - A kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application

Info

Publication number: CN104031895B
Application number: CN201310067767.1A
Authority: CN
Inventors: 赵宗保; 朱志伟; 张素芳
Original assignee: Dalian Institute of Chemical Physics of CAS
Current assignee: Dalian Institute of Chemical Physics of CAS
Priority date: 2013-03-04
Filing date: 2013-03-04
Publication date: 2016-07-27
Anticipated expiration: 2033-03-04
Also published as: CN104031895A

Abstract

The invention discloses a kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application.This fatty acid synthase is made up of RgrFAS1 subunit and RgrFAS2 subunit, and described RgrFAS1 subunit is the protein of following (a) or (b): the protein that (a) aminoacid sequence shown in SEQ ID NO:1 forms；(b) by the aminoacid of SEQ ID NO:1 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQ ID NO:1 with fatty acid synthase subunit 1 function；Described RgrFAS2 subunit is the protein of following (c) or (d): the protein that (c) aminoacid sequence shown in SEQID NO:2 forms；(d) by the aminoacid of SEQ ID NO:2 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQ ID NO:2 with fatty acid synthase subunit 2 function.

Description

A kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application

Technical field

The invention belongs to biological technical field, relate to a kind of oleaginous yeast fatty acid synthase and gene thereof and application.Specifically, described oleaginous yeast fatty acid synthase and encode its nucleotide source in this Rhodothece glutinis of standing grain (Rhodotorulagraminis).The present invention also provides for a kind of method building grease production reconstitution cell.

Background technology

Oils and fats is the Renewable resource that a kind of oxygen content is low, energy density is high, carbon chain lengths is moderate, can substitute for fossil resource substantially processing raw material as chemical industry and regenerative resource industry, be the mankind from hydrocarbon economy to the important link of hydrocarbon oxygen transition, its market potential is huge.In nature, a part of microorganism can store, (as nitrogenous source lacks), the oils and fats exceeding its dry cell weight 20% under given conditions in born of the same parents, wherein with triglyceride (Triacylglycerol, TAG) it is main, the microorganism with this phenotype is called oleaginous microorganism, including antibacterial, yeast, mycete, algae etc., wherein oleaginous yeast includes Rhodotorula, Candida, Cryptococcus, Rhizopus, some bacterial strain [RatledgeC in Trichosporon and Yarrowia genus, WynnJP.AdvApplMicrobiol2002, 51, 1-51].Microbial transformation biomass resource is utilized to produce oils and fats, the new technique of be substantially independent of ploughing, can produce continuously, reduce agricultural pollution, comprehensive utilization of resources can be developed into, formed chemicals fossil resources succedaneum produce new way [Zhao Zongbao. Chinese biological engineering magazine 2005,25 (2), 8-11].

Since half a century, what domestic and international microbial grease was studied focuses on the fields such as bacterial strain screening, domestication and fermentation technology optimization, achieves major progress.Along with the fast development of biotechnology, simple bacterial screening and the optimization of culture process can not meet the needs of oleaginous microorganism character improvement.As the natural production bacterial strain of a certain chemicals, it specifically produces performance often and non-optimal.How optimizing or change metabolism network and the expression regulation network of industrial strain, the quality of accumulating rate or oriented control target product to improve biobased products, is focus and the difficult point of the research of current biological technical field.Oil fermentation research needs reconstruct and the strengthening of fat metabolic approach, gives the performance that recombinant bacterial strain produces Novel fatty acid derivative.Due to excellent original inhabitants, to produce the genetic background of bacterial strain at present still unclear, and oil and fat accumulation metabolic regulation Cloning of Genes Related is limited, finds more oil and fat accumulation metabolic regulation related gene, is one of the important directions of current microbial grease research.

Research worker finds, the encoding gene of the Isocitrate dehydrogenase (IDH) and malate dehydrogenase (ME) that derive from oleaginous microorganism (circle rhodosporidium toruloides and Si Shi saccharomyces oleaginosus) has differential expression in original inhabitants' bacterium oil and fat accumulation process, saccharomyces cerevisiae function reasonableness also demonstrates that these genes can increase the fat content of recombinant bacterial strain, but and a non-oil-producing bacterial strain successful modification could not be become an oil-producing bacterial strain [YangF, ZhangSF, ZhouYJ, ZhuZW, LinXP, ZhaoZK.Appl.Microbiol.Biotechnol.2012, 94 (4), 1095-1105].Experimental result implies, microbial grease accumulation metabolic regulation may relate to more gene and adjustment mutually therebetween and interacts.

From acetyl-CoA and malonyl CoA de novo synthesis short chain and middle chain saturated fatty acids, it is necessary to a series of Claisen condensation reaction decarboxylation, it it is the complex process of mediation catalysis of being lived by several enzymes.In most of antibacterials and plant, the enzyme system that these enzymatic activitys are made up of discrete single functional polypeptide completes (fatty acid synthase Type II)；And in mammal and fungus, the oligomerization enzyme that these enzymatic activitys are then made up of one or two multifunctional polypeptides exercises (fatty acid synthase type I).In fatty acid synthesis process, substrate and intermediate product molecule (may be located at same enzyme molecule at each functional domain, different enzyme molecule can also be arranged in) transmit until completing the whole building-up process [StoopsJK of fatty acid, ArslanianMJ, OhYH, AuneKC, VanamanTC, WakilSJ.ProcNatlAcadSciUSA.1975,72 (5), 1940-1944].

nullFatty acid synthase (FattyAcidSynthase in mammal，FAS) it is a homodimer，Containing two identical multi-functional subunits (molecular weight subunit is 272kDa)，The N end regions of each subunit contains three catalyst structure domains: ketone ester-acyl ACP synthase (ketoacylsynthase，KS)、Single acyl/Acetylase (acyltransferase，And dehydratase (dehydratase AT)，DH)，C end regions then contains four domains: enoyl-ACP reductase (enoylreductase，ER)、Ketoacyl reductase (ketoacylreductase，KR)、Acyl carrier protein (acylcarrierprotein，And thioesterase (thioesterase ACP)，TE)；The two region is separated by the nucleus of middle 600 amino acid residues composition.In Ascomycota yeast, 6 enzymatic activity domains of ACP and other are respectively positioned on two different subunits, one has ACP, KR, KS and Phosphopantetheinyl transferase (phosphopantetheinyltransferase, PPT) domain, another subunit then contains AT, ER, DH and malonyl/palmitoyl transferase (malonyl/palmitoyltransferase, MPT) domain.

Recently, we find the fatty acid synthase of a kind of novelty in this Rhodothece glutinis of standing grain (Rhodotorulagraminis), this enzyme is in that from the different of fatty acid synthase existed in other fungus, its beta subunit (FAS1) is containing only having AT (single acyl/Acetylase) domain and ER (enoyl-ACP reductase) domain, and remaining domain is all on alpha subunit (FAS2)；Meanwhile, this fatty acid synthase exists the ACP domain of two tandem.Cut-off patent submits day to, and NCBI does not retrieve any sequence information about this Rhodothece glutinis of standing grain (R.graminis) fatty acid synthase.

Summary of the invention

It is an object of the invention to provide a kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application.

Oleaginous yeast fatty acid synthase provided by the invention, title is abbreviated as RgrFAS (R.graminisFattyAcidSynthase), derive from this Rhodothece glutinis of standing grain (R.graminis) JCM8242, described oleaginous yeast fatty acid synthase is made up of RgrFAS1 subunit and RgrFAS2 subunit, and wherein said RgrFAS1 subunit is the protein of following (a) or (b):

A protein that () aminoacid sequence shown in SEQIDNO:1 forms；

(b) by the aminoacid of SEQIDNO:1 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQIDNO:1 with fatty acid synthase subunit 1 function；

Described RgrFAS2 subunit is the protein of following (c) or (d):

C protein that () aminoacid sequence shown in SEQIDNO:2 forms；

(d) by the aminoacid of SEQIDNO:2 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQIDNO:2 with fatty acid synthase subunit 2 function.

Wherein said " fatty acid synthase subunit 1 function " specifically refers to single acyl/Acetylase (AT) activity and the adduction of enoyl-ACP reductase (ER) activity；Wherein said " fatty acid synthase subunit 2 function " specifically refers to the adduction of dehydratase (DH) activity, malonyl/palmitoyl transferase (MPT) activity, the first acyl carrier protein (ACP) activity, the second acyl carrier protein (ACP) activity, ketoacyl reductase (KR) activity, ketone ester-acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) activity.

The invention still further relates to the biologically active polypeptide fragment of oleaginous yeast fatty acid synthase (RgrFAS) (in this article, also referred to as domain), its aminoacid sequence is the combination of any one or any two or the more fragment that are selected from fragment:

The position 191-600 (it has single acyl/Acetylase (AT) activity) of SEQIDNO:1,

The position 612-1143 (it has enoyl-ACP reductase (ER) activity) of SEQIDNO:1,

The position 58-488 (it has dehydratase (DH) activity) of SEQIDNO:2,

The position 491-883 (it has malonyl/palmitoyl transferase (MPT) activity) of SEQIDNO:2,

The position 1022-1187 (it has the first acyl carrier protein (ACP) activity) of SEQIDNO:2,

The position 1214-1380 (it has the second acyl carrier protein (ACP) activity) of SEQIDNO:2,

The position 1727-1985 (it has ketoacyl reductase (KR) activity) of SEQIDNO:2,

The position 2068-2714 (it has ketone ester-acyl ACP synthase (KS) activity) of SEQIDNO:2, and

The position 2815-2926 (it has Phosphopantetheinyl transferase (PPT) activity) of SEQIDNO:2.

The biologically active polypeptide fragment (domain) of described RgrFAS, its biological activity is selected from single acyl/Acetylase (AT) activity, enoyl-ACP reductase (ER) activity, dehydratase (DH) activity, malonyl/palmitoyl transferase (MPT) activity, first acyl carrier protein (ACP) activity, second acyl carrier protein (ACP) activity, ketoacyl reductase (KR) activity, any one or any two in ketone ester-acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) activity or more kinds of combinations.

Genetic engineering produce this fatty acid synthase for external synthetic fatty acid and derivant thereof in, in order to make described RgrFAS1 subunit and (/ or) RgrFAS2 subunit be secreted in periplasmic or culture medium or make its function-stable, upper signal peptide sequence can be connected at the aminoterminal of described RgrFAS1 subunit and (/ or) RgrFAS2 subunit；In order to make RgrFAS albumen or its subunit or its biologically active polypeptide fragment (domain) be easy to purification, upper label as shown in table 1 or GST label (glutathione S-transferase label) can be connected at the amino terminal of RgrFAS1 subunit or RgrFAS2 subunit or its biologically active polypeptide fragment (domain) or carboxyl terminal.

Table 1 label and sequence thereof

Label	Amino acid residue number	Sequence
			Poly-Arg	5-6 (is generally 5)	RRRRR
FLAG	8	DYKDDDDK

Poly-His	2-10 (is generally 6)	HHHHHH
			C-myc	10	EQKLISEEDL
Strep-tag II	8	WSHPQFEK
			Poly-Phe	11	FFFFFFFFFFF

Above-mentioned restructuring RgrFAS albumen or its biologically active polypeptide fragment (domain) of tagging can synthetic, it is possible to first synthesize its encoding gene, then carries out common protein and express and obtain.The encoding gene of above-mentioned tag restructuring RgrFAS albumen or its biologically active polypeptide fragment (domain) is possibly through the codon by lacking 1 or several coded amino acid in the DNA sequence shown in SEQIDNOs:3-13 any one, and/or carry out the missense mutation of 1 or several base pair, and/or connect the coded sequence of the label shown in table 1 at its 5 ' end and 3 ' ends and obtain.

The coding nucleotide sequence (such as, RgrFAS1 and RgrFAS2) of described two subunit RgrFAS1 and RgrFAS2 of oleaginous yeast fatty acid synthase falls within protection scope of the present invention.

Therefore, the present invention also provides for the nucleotide sequence of the oleaginous yeast fatty acid synthase of a kind of code book invention.

Preferably, the coding nucleotide sequence of described RgrFAS albumen is the DNA molecular shown in SEQIDNO:3 and SEQIDNO:4.

Additionally, the coding nucleotide sequence of the biologically active polypeptide fragment (domain) of described RgrFAS falls within protection scope of the present invention.

Preferably, the coding nucleotide sequence of the biologically active polypeptide fragment (domain) of described RgrFAS is the DNA molecular shown in SEQIDNOs:5-13.

Further, protection scope of the present invention is belonged to containing the recombinant expression carrier of nucleotide sequence of the present invention, expression cassette, transgenic cell line or recombinant bacterial strain.

Therefore, the present invention also provides for comprising expression cassette or the recombinant vector of the nucleotide sequence of the oleaginous yeast fatty acid synthase of code book invention, it will be preferred that recombinant expression carrier；The reconstitution cell having imported (such as, by converting or rotaring dyeing technology importing) described recombinant vector is provided.

Those skilled in the art should understand that, the recombinant vector of the coding nucleotide sequence of oleaginous yeast fatty acid synthase or the nucleotide sequence that comprises coding oleaginous yeast fatty acid synthase is imported host cell to carry out according to the ordinary skill in the art, such as, can pass through conversion, the transfection routine techniques such as (such as, agriculture bacillus mediated transfection) or electroporation carries out.

Available existing basidiomycetes expression vector and saccharomyces cerevisiae expression build containing described coding nucleotide sequence (such as, RgrFAS1 and/or RgrFAS2, RgrFAS biologically active polypeptide fragment (domain) coding nucleotide sequence) recombinant expression carrier.

Described basidiomycetes expression vector includes the gene recombined vector of agrobacterium tumefaciens mediation and can be used for the carrier etc. of basidiomycetes micropellet bombardment.Described basidiomycetes expression vector also can comprise 3 ' end untranslated regions of exogenous gene, namely comprises polyadenylation signals and the DNA fragmentation of any other participation mRNA processing or gene expression.Described polyadenylation signals can guide polyadenylic acid to join 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces the untranslated region that (Ti) plasmid gene (such as kermes synzyme Nos gene), standing grain this Rhodothece glutinis gene (the G3PDH gene such as R.graminis) 3 ' end is transcribed to be respectively provided with similar functions.Described saccharomyces cerevisiae expression includes saccharomyces cerevisiae sequestered expression vector (carrying 2 μm of replicons or autonomous replication sequence (ARS), such as the existing universal support that pYX212, pYES2C/T etc. can buy voluntarily) and integrated expression vector (carrying integration site gene recombinaton arm).

When using RgrFAS1 and/or RgrFAS2 or RgrFAS biologically active polypeptide fragment (domain) coding nucleotide sequence to build recombinant yeast expression vector, any inducible promoter or constitutive promoter can be added before its initiation nucleotide, such as glyceraldehyde 3-phosphate dehydrogenase promoter pG3PDH, galactose evoked promoter pGal10, promoter can be used alone or be combined use with other promoter.

It should be appreciated by those skilled in the art that the expression that the nucleotides sequence of the oleaginous yeast fatty acid synthase for the ease of code book invention is listed in host cell, depend on selected host cell strain, it is possible to suitably carry out codon optimized to described nucleotide sequence；For the ease of transgenic cell line or recombinant bacterial strain being identified and screening, used carrier can be modified, the enzyme (such as green fluorescent protein) of color change or the gene of luminophor is produced (such as gus gene as introduced the coding can expressed in yeast cells, luciferase gene etc.), there is the antibiotic marker genes of resistance (such as kanamycin marker gene, bleomycin marker gene, hpt marker gene) or anti-chemical reagent marker gene (such as anti-herbicide gene), and nutrition riddled basins is (such as LEU2, URA3) etc.；For the ease of purification, it is possible to the 5 ' ends and/or 3 ' at described nucleotide sequence hold the coded sequence connecting purification tags.

It is a further object to provide a kind of method building grease production reconstitution cell, described method includes in nucleotide sequence or its active fragment importing host cell of the oleaginous yeast fatty acid synthase by code book invention, obtain grease production reconstitution cell, or the nucleotide sequence of oleaginous yeast fatty acid synthase comprising code book invention or the expression cassette of its active fragment or recombinant expression carrier are imported in host cell, obtains grease production reconstitution cell.Wherein said host cell preferred yeast cell.

Utilize and any can start the carrier that exogenous gene is expressed in saccharomyces cerevisiae, RgrFAS1 and/or RgrFAS2 provided by the present invention or RgrFAS biologically active polypeptide fragment (domain) coding nucleotide sequence are imported in yeast cells, obtains grease production recombinant yeast cell.In a preferred embodiment, utilize and any can start the carrier that exogenous gene is expressed in this Rhodothece glutinis of standing grain, increase RgrFAS1 and/or RgrFAS2 provided by the present invention or the copy number of RgrFAS biologically active polypeptide fragment (domain) coding nucleotide sequence, obtain restructuring this Rhodothece glutinis of standing grain.

It is demonstrated experimentally that oleaginous yeast fatty acid synthase provided by the invention and encoding gene thereof are remarkably improved the fat content of reconstitution cell.

In sum, the present invention provides following:

1. an oleaginous yeast fatty acid synthase, it is made up of RgrFAS1 subunit and RgrFAS2 subunit, and wherein said RgrFAS1 subunit is the protein of following (a) or (b):

A protein that () aminoacid sequence shown in SEQIDNO:1 forms；

(b) by the aminoacid of SEQIDNO:1 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQIDNO:1 with fatty acid synthase subunit 1 (RgrFAS1) function；

Described RgrFAS2 subunit is the protein of following (c) or (d):

C protein that () aminoacid sequence shown in SEQIDNO:2 forms；

(d) by the aminoacid of SEQIDNO:2 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQIDNO:2 with fatty acid synthase subunit 2 (RgrFAS2) function.

2. according to the 1st described oleaginous yeast fatty acid synthase, the aminoacid sequence of wherein said RgrFAS1 subunit is SEQIDNO:1, and the aminoacid sequence of described RgrFAS2 subunit is SEQIDNO:2.

3. deriving from biologically active polypeptide fragment or the domain of the 1st described oleaginous yeast fatty acid synthase, the aminoacid sequence of described polypeptide fragment or domain is the combination of any one or any two or the more fragment that are selected from fragment:

The position 191-600 of SEQIDNO:1,

The position 612-1143 of SEQIDNO:1,

The position 58-488 of SEQIDNO:2,

The position 491-883 of SEQIDNO:2,

The position 1022-1187 of SEQIDNO:2,

The position 1214-1380 of SEQIDNO:2,

The position 1727-1985 of SEQIDNO:2,

The position 2068-2714 of SEQIDNO:2, and

The position 2815-2926 of SEQIDNO:2.

4. according to the biologically active polypeptide fragment of the 3rd described oleaginous yeast fatty acid synthase or domain, its biological activity is selected from single acyl/Acetylase (AT) activity, enoyl-ACP reductase (ER) activity, dehydratase (DH) activity, malonyl/palmitoyl transferase (MPT) activity, first acyl carrier protein (ACP) activity, second acyl carrier protein (ACP) activity, ketoacyl reductase (KR) activity, any one or any two in ketone ester-acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) activity or more kinds of combinations.

5. encode the nucleotide sequence of the 1st described oleaginous yeast fatty acid synthase.

6., according to the 5th described nucleotide sequence, the nucleotides sequence of the RgrFAS1 subunit wherein encoding described oleaginous yeast fatty acid synthase is classified as SEQIDNO:3；The nucleotides sequence of the RgrFAS2 subunit encoding described oleaginous yeast fatty acid synthase is classified as SEQIDNO:4.

7. encoding the biologically active polypeptide fragment of the 3rd described oleaginous yeast fatty acid synthase or the nucleotide sequence of domain, it is selected from any one in nucleotide sequence or any two or the combination of more sequence:

(a) nucleotide sequence as shown in SEQIDNO:5, the AT domain of its coding RgrFAS1 subunit；

(b) nucleotide sequence as shown in SEQIDNO:6, the ER domain of its coding RgrFAS1 subunit；

(c) nucleotide sequence as shown in SEQIDNO:7, the DH domain of its coding RgrFAS2 subunit；

(d) nucleotide sequence as shown in SEQIDNO:8, the MPT domain of its coding RgrFAS2 subunit；

(e) nucleotide sequence as shown in SEQIDNO:9, an ACP domain of its coding RgrFAS2 subunit；

(f) nucleotide sequence as shown in SEQIDNO:10, the 2nd ACP domain of its coding RgrFAS2 subunit；

(g) nucleotide sequence as shown in SEQIDNO:11, the KR domain of its coding RgrFAS2 subunit；

(h) nucleotide sequence as shown in SEQIDNO:12, the KS domain of its coding RgrFAS2 subunit；

(i) nucleotide sequence as shown in SEQIDNO:13, the PPT domain of its coding RgrFAS2 subunit.

8. contain expression cassette or the recombinant expression carrier of nucleotide sequence in any of the one of 5-7 item.

9. contain the cell of nucleotide sequence in any of the one of 5-7 item.

10. the method building grease production reconstitution cell, described method includes importing in host cell expression cassette or the recombinant expression carrier of the nucleotide sequence in any of the one of 3-7 item or the 8th, obtains grease production reconstitution cell.

Accompanying drawing explanation

Fig. 1 is the domain ratio of components relatively analysis chart of RgrFAS and other extraordinary source FAS.

Fig. 2 is RgrFAS1 and RgrFAS2 gene RT-PCR amplification, swimming lane 1, RgrFAS2；Swimming lane 2, RgrFAS1.Amplified band bases longs respectively 8.8kb and 3.8kb.

Fig. 3 is the collection of illustrative plates of the RgrFAS prokaryotic expression plasmid pACYC-RgrFAS1+2 built.

The SDS-PAGE that Fig. 4 is RgrFAS prokaryotic expression product analyzes.M: Protein Marker；C: the induction full cell of thalline；S: induction cellular lysate liquid supernatant；P: induction cellular lysate liquid precipitate.

Fig. 5 is that the SDS-PAGE after the PPT domain of RgrFAS and ACP domain prokaryotic expression product Ni post affinity purification analyzes.

Fig. 6 is that PPT domain catalyzing acyl carrier protein (ACP) Tricine-SDS-PAGE occurring 4 '-phosphopantetheine to modify analyzes.The GST-PPT of purification can occur 4 '-phosphopantetheine to modify by catalysis GST-ACP, increases 340Dalton owing to ACP is modified rear molecular weight, can separate Apo-ACP and Holo-ACP by Tricine-SDS-PAGE in 16% polyacrylamide gel.Fig. 6 A is GST-ACP1, Fig. 6 B is GST-ACP2.

Fig. 7 is the module assembled strategy schematic diagram of the Yeast expression carrier structure of RgrFAS.

Fig. 8 is RgrFAS expression plasmid of yeast collection of illustrative plates.

Detailed description of the invention

Following example are easy to be more fully understood that the present invention, but limit and originally bright.The scope of the present invention is limited by claim and equivalents thereof.

Experimental technique in following embodiment, if no special instructions, is conventional method.Experiment material used in following embodiment, if no special instructions, is and is commercially available from routine biochemistry Reagent Company.

This Rhodothece glutinis of standing grain (R.graminis) ATCCMYA-4893: Unite States Standard biology product collecting center (ATCC), it is isolatable from comospore poplar (Populustrichocarpa) stem of Washington, DC ThreeForksPark, it is committed to ATCC by FGSC, is equal to R.graminisWP1 or FGSC10291.

This Rhodothece glutinis of standing grain (R.graminis) ATCC28135: purchased from American standard biological product collecting center (ATCC), it is isolatable from the Folium Hordei Vulgaris of French six row Fructus Hordei Vulgaris (Hordeumhexastichon), it is committed to Holland Culture Collection (CentraalbureauvoorSchimmelcultures by H.G.Diem, CBS), rear unloading is in ATCC.This bacterial strain is equal to CBS6403 or ATCC96593 or CCY29-133-1 or IFO10412 or JCM3932 or MUCL30689 or NRRLY-17366 or VKMY-2420.

This Rhodothece glutinis of standing grain (R.graminis) ATCC32768: purchased from American standard biological product collecting center (ATCC), it is isolatable from the careless strain of New Zealand pasture, being committed to Holland's Culture Collection (CBS) by M.E.diMenna, rear unloading is in ATCC.This bacterial strain is equal to CBS2826 or IGC4842 or JCM3775 or MUCL30431 or NCYC502 or NRRLY-2474.

Culture medium prescription involved in following example and purposes are as follows:

(1) YEPD culture medium: yeast powder 10g/L, peptone 10g/L, glucose 20g/L, pH6.0, solid medium then adds agar powder 15g/L；For strain activation and culture, seed liquor preparation and strain short term storage.

(2) limit nitrogen culture medium: glucose 70g/L, yeast powder 0.75g/L, (NH₄)₂SO₄0.1g/L, KH₂PO₄1.0g/L, MgSO₄·7H₂O1.5g/L, pH5.6, and add the trace element liquid (4.0g/LCaCl of 1% (V/V)₂·2H₂O, 0.55g/LFeSO₄·7H₂O, 0.52g/Lcitricacid H₂O, 0.10g/LZnSO₄·7H₂O, 0.076g/LMnSO₄·H₂O and 100 μ l18MH₂SO₄), for bacterial strain oil and fat accumulation with rich in the cultivation of oils and fats thalline.

(3) non-limit nitrogen artificial synthetic medium (being abbreviated as MM): glucose 25g/L, (NH₄)₂SO₄5g/L, MgSO₄·7H₂O0.5g/L, KH₂PO₄3g/L), the preparation of thalline sample is analysed for the eutrophy chemostat cultivation of this Rhodothece glutinis of standing grain and differential transcription group credit.

(4) limit nitrogen manually closes culture medium (being called for short MM-N): glucose 25g/L, (NH₄)₂SO₄0.2g/L, MgSO₄·7H₂O0.5g/L, KH₂PO₄3g/L, K₂SO₄6.3g/l, the preparation of thalline sample is analysed in limit nitrogen chemostat cultivation and differential transcription group credit for this Rhodothece glutinis of standing grain.

Embodiment 1: the discovery of standing grain this Rhodothece glutinis fatty acid synthase

R.graminisATCCMYA-4893 recovers on YEPD solid medium, is inverted for 30 DEG C and cultivates 48h, chooses single colony inoculation in 50mlYEPD fluid medium (dress liquid is in the triangular flask of 250ml capacity), and 30 DEG C, 200rpm cultivates 28h.Culture fluid is transferred in the 2L continuous fermentation tank (working volume 1.7L) of automatic feeding with 1: 50 (V/V) ratio respectively, and culture medium is MM and MM-N respectively.Chemostat cultivation temperature is 30 DEG C, and pH is controlled automatically at 5.6 by dripping 10.0MNaOH or 2MHCl, and rotating speed remains 600rpm, and Ventilation Rate is 100L/h (about 0.98VVM), and dissolved oxygen remains 85% saturated, and dilution rate is 0.085.Sampling after about 10 working volumes, sample is through 4 DEG C, and the centrifugal 5min of 8000rpm collects, and every 45ml culture can collect about 0.7g wet thallus, the quick-freezing in liquid nitrogen all immediately of MM and MM-N thalline sample ,-70 DEG C of preservations.Dry ice cryopreservation transport to Hua Da gene (full name: Shenzhen, Beijing Liuhe Huada Genomics Technology Co., Ltd branch company) carries out the R.graminis order-checking of the transcript profile under limit nitrogen and non-limit nitrogen condition of culture.Leave and take and carry out Oil Content Analysis in born of the same parents with batch thalline sample, culture supernatant for residual nitrogen analysis [Hongwei Shen, Jin Guojie, Hu Cuimin, Gong Zhiwei, Bai Fengwu, Zhao Zongbao. biological engineering journal 2012,28 (1), 57-65].

Adopt liquid nitrogen grinding-RNAiso method to extract total serum IgE, carry out next step again after using Agilent2100Bioanalyzer detection sample integrity qualified and make.RNA-seq sample preparation uses mRNA-Seq8SamplePreparationKit (Illumina, SanDiego, CAUSA), concrete steps reference product operation instruction.nullIn simple terms，At least total serum IgE of 10ug，MRNA is obtained through oligo (dT) magnetic beads for purifying after DNaseI (RNasefree) digests，After mRNA uses bivalent cation Buffer to carry out random fragmentation process，Random hexamers reverse transcription synthesizes the first chain cDNA，RNaseH and DNApolymeraseI is used to synthesize the second chain cDNA，End reparation and add A process after connect joint sequence，The Agarosegel of 2% reclaims the fragment of 300bp，The PCR of 15 circulations amplifies connection product，Through Agilent2100Bioanalyzer, PCR primer verifies that concentration is more than 0.34nM，Total amount is more than 3.23pmol，And library inserts length range is in 200 ± 10% scopes.Sample obtains double; two end sequences of 90bp through IlluminaHiSeq2000 order-checking.The sequence information obtained, uses SOAPdenovo software to carry out assembly from the beginning and obtains Unigene sequence, then these Unigene carry out the annotation [LiR of function, ZhuH, RuanJ, QianW, FangX, ShiZ, LiY, LiS, ShanG, KristiansenK, LiS, YangH, WangJ, WangJ.GenomeRes.2010,20 (2), 265-272.].MM-N sample carries out the sequence information of RNA-seq acquisition, use SOAPdenovo software to carry out from the beginning assembly and there are 280 complete Unigene sequences, wherein the Unigene sequence more than 3000bp has 2, carry out Blastp analysis according to the amino acid sequence information deduced, it has been found that this protein coded by two Unigene respectively with LaccariabicolorS238N-H82 source fatty acid synthase Beta subunit and alpha subunit homology be 55% and 62%.Protein coded by these two Unigene is respectively designated as standing grain this Rhodothece glutinis fatty acid synthase subunit 1 (RgrFAS1) and standing grain this Rhodothece glutinis fatty acid synthase subunit 2 (RgrFAS2).

RgrFAS1 is made up of 1268 amino acid residues, molecular weight 137kDa, and theoretical isoelectric point, IP is 6.09；Signal peptide is not had to identify, for endocellular enzyme；Belong to yeast fatty acid synthase [EC2.3.1.86]；RgrFAS1 domain composition and ascus yeast fatty acid synthase difference are bigger, only containing single acyl/Acetylase (AT), two domains of enoyl-ACP reductase (ER), and ascus yeast fatty acid synthase also carries dehydratase (DH) and malonyl/palmitoyl transferase (MPT) domain (Fig. 1).

RgrFAS2 is made up of 2930 amino acid residues, molecular weight 317kDa；Theoretical isoelectric point, IP is 6.41；Signal peptide is not had to identify, for endocellular enzyme；Belong to yeast fatty acid synthase [EC2.3.1.86]；RgrFAS2 domain composition and ascus yeast fatty acid synthase difference are bigger, except containing ketoacyl reductase (KR), the apokoinou construction of the products of typical yeast fatty acid synthase alpha subunits such as ketone ester-acyl ACP synthase (KS) and Phosphopantetheinyl transferase (PPT) is overseas, also carry dehydratase (DH), malonyl/palmitoyl transferase (MPT), and first acyl carrier protein (ACP) of tandem and the second acyl carrier protein (ACP) domain, the first two domain is on the beta subunit of other yeast fatty acid synthase, double, two ACP domains (2 × ACP) of tandem are then RgrFAS2 specific (Fig. 1).

The encoding gene of RgrFAS1 and RgrFAS2 being respectively designated as the mRNA sequence of rgrfas1 and rgrfas2, rgrfas1 such as shown in SEQIDNO:3, the mRNA sequence of rgrfas2 is such as shown in SEQIDNO:4.

Embodiment 2: the clone of standing grain this Rhodothece glutinis rgrfas1 and rgrfas2 gene

Nucleotide sequence design gene-specific primer according to rgrfas1 and rgrfas2 is as follows:

Rgrfas1-Fw:atgaacggtcaccacacccgtgccggcacc

Rgrfas1-Rv:tcactggatcgccgagaagacgtcgagctt

Rgrfas2-Fw:atggcggccgaccttccgctcgcgctgagc

Rgrfas2-Rv:ctacgagcgagcgatgacgacggcgacggc

Utilize liquid nitrogen grinding to add RNaiso method [YangF, TanHD, ZhouYJ, LinXP, ZhangSF.Mol.Biotechnol.2010,47 (2): 144-151] and extract R.toruloidesCGMCC2.1389 total serum IgE.RNA carries out 1.5% agarose gel electrophoresis, uses fluorescence-uv analyzer to observe and identifies, it is seen that two band clearly.With ultraviolet/visible light spectrometer analysis total serum IgE sample, record OD260/OD280=1.9, it was shown that total serum IgE quality is fine.Total serum IgE sample is frozen standby in-80 DEG C.

HighFidelityPrimeScriptRT-PCRKit (purchased from Takara) is utilized to synthesize cDNA the first chain.20 μ l reaction systems, first, by 2 μ l total serum IgE (～1 μ g), Oligo (dT) and Random6mer) each 100nM, 2.0 μ lDEPC process water, and (pyrocarbonic acid diethyl ester processes water, purchased from Dalian TaKaRa company), join in PCR pipe and mix, being incubated 5min in 65 DEG C, be immediately placed on cooled on ice 2min, (HighFidelityPrimeScriptRT-PCRKit carries reverse transcription to add enzyme Mix, purchased from Takara), DEPC processes water polishing 20 μ l, and 42 DEG C of 30min carry out reverse transcription, 70 DEG C of 15min inactivators.

With cDNA first chain of reverse transcription synthesis for template, carry out the pcr amplification of rgrfas1 and rgrfas2 gene, 5 × PCR buffer (TakaRa) 10.0 μ l, dNTPs (10mM, TaKaRa) 1.0 μ l, primer rgrfas1-Fw (/rgrfas2-Fw) (50mM) and each 1.0 μ l of rgrfas1-Rv (/rgrfas2-Rv) (50mM), PrimeSTar (Dalian TakaRa) 0.5 μ l, cDNA the first chain template 1.0 μ l, the ddH of synthesis₂O polishing is to 50 μ l, it is incubated 3min in 94 DEG C, then in 98 DEG C of 10s, 68 DEG C of 5min (being used for expanding rgrfas1) or 9min (being used for expanding rgrfas2), 30 circulations, adding Taq DNA polymerase (TakaRa) 1.0 μ l afterwards to carry out 3 ' ends of amplified production and add A, 72 DEG C of 20min, 4 DEG C are terminated reaction.Amplified production carries out 0.8% (mass/volume concentration) agarose gel electrophoresis, the band (Fig. 2) of two expection sizes of 3.8kb (rgrfas1) and 8.8kb (rgrfas2) left and right be can be observed, DNA is utilized to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier's proposed steps (NEP013-2 description) purified pcr product.The method (D102A description) that PCR primer provides with reference to TaKaRa company is cloned into pMD19-T carrier, it is transformed into E.coliDH5 α competent cell, select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction (green skies plasmid Mini Kit, article No.: D0003).The order-checking of TaKaRa company delivered to by recombiant plasmid sample, and sequencing result shows, the nucleotide sequence expanded to respectively SEQIDNO:3 and SEQIDNO:4, is separately encoded the protein that aminoacid sequence is SEQIDNO:1 and SEQIDNO:2.Being RgrFAS1 by the protein designations shown in SEQIDNO:1, the Nucleotide designation shown in SEQIDNO:3 obtain clone is rgrfas1；Being RgrFAS2 by the protein designations shown in SEQIDNO:2, the Nucleotide designation shown in SEQIDNO:4 obtain clone is rgrfas2.Positive recombiant plasmid is respectively designated as pMD19T-RgrFAS1 and pMD19T-RgrFAS2.

RgrFAS1 domain composition and ascus yeast fatty acid synthase beta subunit difference are relatively big, and only containing two domains of AT and ER, and ascus yeast fatty acid synthase also carries DH and MPT domain (Fig. 1).The domain composition of RgrFAS2 and ascus yeast fatty acid synthase alpha subunit difference are bigger; except containing KR), the apokoinou construction of the products of typical yeast fatty acid synthase alpha subunit such as KS and PPT overseas; also carry the first acyl carrier protein (ACP) and the second acyl carrier protein (ACP) domain of DH, MPT and tandem, double; two ACP domains (2 × ACP) specific to RgrFAS2 (Fig. 1) of this tandem.

Embodiment 3: the prokaryotic expression of standing grain this Rhodothece glutinis fatty acid synthase, protein purification and recombinant bacterial strain oil-producing performance evaluation

(the underscore part of primer rgrfas1-NcoI-F is NcoI restriction enzyme site to add the primer of corresponding restriction enzyme site according to the design of rgrfas1 nucleotide sequence, the underscore part of primer rgrfas1-HindIII-R is HindIII restriction enzyme site), sequence is as follows:

Rgrfas1-NcoI-F:ctctccatggatgaacggtcaccacacccgtgccggcacc

Rgrfas1-HindIII-R:tctaagctttcactggatcgccgagaagacgtcgagctt

Add the primer (the underscore part of primer rgrfas2-NdeI-F is NdeI restriction enzyme site, and the underscore part of primer rgrfas2-AvrII-R is AvrII restriction enzyme site) of corresponding restriction enzyme site according to the design of rgrfas2 nucleotide sequence, sequence is as follows:

Rgrfas2-NdeI-F:ctctcatatggcggccgaccttccgctcgcgctgagc

Rgrfas2-AvrII-R:tctcctaggctacgagcgagcgatgacgacggcgacggc

With cloning vehicle pMD19T-RgrFAS1 and the pMD19T-RgrFAS2 that previously built for template, utilize two primer rgrfas1-NcoI-F/rgrfas1-HindIII-R and rgrfas2-NdeI-F/rgrfas2-AvrII-R is expanded rgrfas1 and rgrfas2 coding region sequence respectively.The pcr amplification product of rgrfas1 is through NcoI/HindIII double digestion, it is connected into the pACYCDuet-1 (dual-expression vector of same double digestion, purchased from Novagen) carrier (reclaiming enzyme action large fragment to be used for connecting), Transformed E .coliDH5a Competent cell, through the recombiant plasmid called after pACYC-RgrFAS1 that NcoI/HindIII double digestion and sequence verification are correct.The pcr amplification product of rgrfas2 is through NdeI/AvrII double digestion, it is connected into the pACYC-RgrFAS1 carrier (reclaiming enzyme action large fragment to be used for connecting) built of same NdeI/AvrII double digestion, Transformed E .coliDH5a Competent cell, through the recombiant plasmid called after pACYC-RgrFAS1+2 that NcoI/HindIII and NdeI/AvrII enzyme action and order-checking double verification are correct.(Fig. 3).

By pACYC-RgrFAS1+2 Plastid transformation E.coliB121 (DE3) host, obtain expression strain BL21/pACYC-RgrFAS1+2.Choose single colony inoculation in 10mlChl-LB culture medium (tryptone 10g/l, yeast powder 5g/l, NaCl10g/l, and containing chloromycetin 30 μ g/ml), cultivate 4-6h to OD for 37 DEG C_600nmFor 0.6-0.8, add final concentration of 0.1mMIPTG and induce, 30 DEG C of overnight incubation.After abduction delivering terminates, taking 10ml bacterium solution, in 4 DEG C, the centrifugal 5min of 8000rpm collects thalline, and bacterial sediment is with 200 μ lNBP buffer (50mMNa₂HPO₄/NaH₂PO₄, pH=8.0,0.5MNaCl, 20mM imidazoles, 1mMbeta-mercaptoethanol, 1mMPMSF) in, utilize sonioation method to extract soluble protein (power is 60W, pulse 2s for ice bath, ultra-fine probe, interval 2s, total time 1min), become clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, taking supernatant is soluble protein fraction, utilizes the resuspended precipitation of isopyknic lysis buffer；Utilize the expression (10% acrylamide gel) of SDS-PAGE analyzing proteins.Result is as shown in Figure 4, under 0.1mMIPTG inductive condition, two subunit RgrFAS1 and RgrFAS2 of restructuring RgrFAS are complete soluble-expression almost, the molecular weight of restructuring RgrFAS1 is approximately 138kDa (RgrFAS1 theoretical molecular is 137kDa, and (Strep-tagII) the rear fusion protein molecular weight that tags is 138kDa)；The molecular weight of restructuring RgrFAS2 is approximately 319kDa (RgrFAS2 theoretical molecular is 318kDa, and (6 × His) the rear fusion protein molecular weight that tags is 319kDa).

Restructuring RgrFAS2 subunit carries 6 × HisTag, due to the protein-interacting between RgrFAS2 and RgrFAS1 subunit, may utilize nickel affinity chromatography single step purification restructuring RgrFAS2 and restructuring two subunits of RgrFAS1.Protein purification procedures carries out according to InvitrogenNi-NTApurificationsystem teachings, with nickel ion as affine ion, relies on imidazole concentration gradient (30-100mM imidazoles) eluting destination protein.BL21/pACYC-RgrFAS1+2 carries out 1000ml volume abduction delivering (1000mlChl-LB culture medium (tryptone 10g/l, yeast powder 5g/l, NaCl10g/l, and containing chloromycetin 30 μ g/ml), 37 DEG C are cultivated 4-6h to OD is 0.5-0.8, adds final concentration of 1mMIPTG and induces, 30 DEG C of overnight incubation), centrifugal thalline of collecting, addition 50mlNBP buffer (50mMNa₂HPO₄/NaH₂PO₄, pH=8.0,0.5MNaCl, 20mM imidazoles, 1mMbeta-mercaptoethanol, 1mMPMSF) in, sonioation method extracts soluble protein (ice bath, power is 60W, pulse 2s, interval 3s, total time 30min), becomes clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, take supernatant soluble protein, after utilizing 0.22 μm low protein bound membrane filtration, loading is to nickel affinity chromatography post (volume 10ml), standing is in conjunction with 15min, then successively with the lavation buffer solution (50mMNa containing 20mM, 40mM, 60mM and 80mM imidazoles of 20 times of column volumes₂HPO₄/NaH₂PO₄, pH=8.0,0.5MNaCl, 1mMbeta-mercaptoethanol, the imidazoles of respective concentration) wash successively, finally with the elution buffer (50mMNa containing 250mM imidazoles₂HPO₄/NaH₂PO₄, pH=8.0,0.5MNaCl, 1mMbeta-mercaptoethanol, 250mM imidazoles) eluting destination protein.All purification process all carry out at 4 DEG C, and ensure all of relevant buffers of pre-cooling.The albumen that purification obtains is stored in 20% glycerol ,-70 DEG C of preservations after subpackage.Purity of protein is analyzed by SDS-PAGE (10% acrylamide gel), and result shows, in elution fraction, restructuring RgrFAS1 subunit and RgrFAS2 subunit purity are all higher than 90%.

Recombination bacillus coli BL21/pACYC-RgrFAS1+2 is inoculated M9-N culture medium, and (M9 limits nitrogen culture medium: 2% glucose, 0.6%Na₂HPO₄, 0.3%KH₂PO₄, 0.05%NaCl, 1mMMgSO₄, 0.1mMCaCl₂, 0.1% (v/v) 1000 × trace element mixed liquor；1000 × trace element mixed liquor composition: 2.7%FeCl₃·6H₂O, 0.2%ZnCl₂·4H₂O, 0.2%CaCl₂·2H₂O, 0.2%Na₂MoO₄·2H₂O, 1.9%CuSO₄·5H₂O, 0.5%H₃BO₃), 37 DEG C, 200rpm shaken cultivation 24h, sample every 6h, stay and do Oil Content Analysis [RudeMA, SchirmerA.Curr.Opin.Microbiol.2009,12,274-281].It was found that during fermentation termination, compared with control strain BL21/pACYCDuet-1, in BL21/pACYC-RgrFAS1+2 born of the same parents, fat content is increased to 19.8% by 10%, it is seen then that in born of the same parents, fat content improves 98%.Prove that rgrfas1 and rgrfas2 gene co-expressing can promote recombination bacillus coli oil and fat accumulation, increase fat content in its born of the same parents.

The prokaryotic expression of embodiment 4:RgrFAS domain PPT, ACP and protein purification

The prokaryotic expression of step one RgrFAS domain PPT, ACP and protein purification

RF is utilized to clone [VandenEntF, LoweJ.J.Biochem.Biophys.Methods2006,67,67-74；YangF, ZhangS, TangW, ZhaoZ.Yeast2008.25 (9): 623-630] method build RgrFAS domain PPT, ACP prokaryotic expression carrier.The encoding gene nucleotide sequence of PPT domain according to RgrFAS, ACPI domain and ACPII domain designs following RF cloning primer:

41-GST-ACPI-F:

TGGTGGCTCCGGTGATGACGACGACAAGgtcgccgacgagccgctcaaggcc

41-GST-ACPI-R:

ATTAGTGGTGGTGGTGGTGGTGGTGGTGgagagcgagatgccggcgaacgag

41-GST-ACPII-F:

TGGTGGCTCCGGTGATGACGACGACAAGgtccccgacgagccgctcaaggc

41-GST-ACPII-R:

ATTAGTGGTGGTGGTGGTGGTGGTGGTGgagcgacacgccggcctgcgagg

41-GST-PPT-F:

GGTGGCTCCGGTGATGACGACGACAAGacggacgtcgagctgatcagcgcc

41-GST-PPT-R:

ATTAGTGGTGGTGGTGGTGGTGGTGGTGgacgacggcgacggccgtgtcgtc

null1、RFI reacts: 5 × PrimeSTARBuffer (TakaRa) 10.0 μ l，dNTPs(10mM，TaKaRa)1.0μl，The each 1.0 μ l of ACPI primer 41-GST-ACPI-F and 41-GST-ACPI-R (or ACPII primer 41-GST-ACPII-F and 41-GST-ACPII-R，Or PPT primer 41-GST-PPT-F and 41-GST-PPT-R，Each 1.0 μ l，Equal 10mM)，PrimeSTAR(TakaRa)0.5μl，The pMD19T-RgrFAS2 carrier built in embodiment 3 is as template (50ng/ μ l) 2.0 μ l，ddH₂O polishing, to 50 μ l, is incubated 3min in 94 DEG C, and then in 98 DEG C of 10s, 62 DEG C of 10s, 72 DEG C of 1min, 30 circulations, then 72 DEG C of 10min, 4 DEG C are terminated reaction.Amplified production carries out 1.2% (mass/volume concentration) agarose gel electrophoresis, observe expection size purpose band (ACPI and ACPII order band expection size be about 0.5kb, band expection about the size 0.33kb of PPT order), DNA is utilized to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier's proposed steps (NEP013-2 description) purified pcr product.

2, RFII reaction: template pET41a plasmid DNA is (purchased from Novagen, 100ng/ μ l) 1 μ l, above-mentioned steps 1 (RFI reaction) product 8 μ l (about 600ng), 5 × PrimeSTARBuffer (TaKaRa) 10.0 μ l, dNTPs (10mM, TaKaRa) 1.0 μ l, PrimeSTAR (TakaRa) 0.5 μ l, ddH₂O polishing is to 50 μ l, and in 95 DEG C of denaturation 3min, 95 DEG C of 1min, 55 DEG C of 1min, 68 DEG C of 7min, 25 circulations, 4 DEG C are terminated reaction, obtain the RFII product (that is, the recombiant plasmid of notched insertion genes of interest fragment) of about about 6.6kb.

3, the PCR primer of above-mentioned steps 2 (RFII reaction) DpnI (purchased from NewEnglandBiolabs) 1 μ l digests 1h in 37 DEG C, remove methylated template plasmid DNA, take 5 electroporated E.coliDH5 α competent cell [the Molecular Cloning: A Laboratory guide third editions of μ l, Pehanorm Brooker work, Huang Peitang etc. translate, and Science Press publishes], electroporated parameter: 2200-2500V, 400 Ω, 25 μ F.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction and sequencing analysis [VandenEntF, LoweJ.J.Biochem.Biophys.Methods2006,67,67-74].The correct recombiant plasmid built is respectively designated as pET41a-ACP1, pET41a-ACP2 and pET41a-PPT.

4, pET41a-ACP1, pET41a-ACP2 and pET41a-PPT recombinant vector Transformed E .coliBl21 (DE3) competent cell respectively that will build in above-mentioned steps 3, obtains expression strain BL21/pET41a-ACP1, BL21/pET41a-ACP2 and BL21/pET41a-PPT.Choose single colony inoculation respectively in 10mlKan-LB culture medium (tryptone 10g/l, yeast powder 5g/l, NaCl10g/l, and containing kanamycin 50 μ g/ml), cultivate 4-6h to OD for 37 DEG C_600nmFor 0.6-0.8, add final concentration of 0.1mMIPTG and induce, 30 DEG C of overnight incubation.After abduction delivering terminates, take 1ml bacterium solution, in 4 DEG C, the centrifugal 5min of 8000rpm collects thalline, and bacterial sediment is with 200 μ l bacteria lysis buffer (100mMTris-HCl, 20% glycerol, 2mMEDTA, 1.5mMDTT, pH7.5) resuspended, (power is 60W for ice bath, ultra-fine probe to utilize sonioation method to extract soluble protein, pulse 2s, interval 2s, total time 1min), become clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, taking supernatant is soluble protein fraction, utilizes the resuspended precipitation of isopyknic lysis buffer；Utilize the expression (12% (M/V) acrylamide gel) of SDS-PAGE analyzing proteins.Result shows, under 0.1mMIPTG inductive condition, carry RgrFAS-ACP1, RgrFAS-ACP2 and RgrFAS-PPT three recombiant proteins (being abbreviated as GST-wACP1, GST-wACP2 and GST-wPPT respectively) the almost complete soluble-expression of GSTTag, molecular weight respectively 50kDa, 50kDa and 45kDa (RgrFAS-ACP1, RgrFAS-ACP2 and RgrFAS-PPT theoretical molecular respectively 20kDa, 20kDa and 15kDa, GST label protein molecular weight is 30kDa).

5, protein purification procedures carries out according to InvitrogenNi-NTApurificationsystem teachings, with nickel ion as affine ion, relies on imidazole concentration gradient (30-100mM imidazoles) eluting destination protein.BL21/pET41a-ACP1, BL21/pET41a-ACP2 and BL21/pET41a-PPT carry out 1000ml volume abduction delivering (1000mlKan-LB culture medium (containing kanamycin 50 μ g/ml) respectively, 37 DEG C are cultivated 4-6h to OD is 0.6-0.8, add final concentration of 0.1mMIPTG to induce, 30 DEG C of overnight incubation), centrifugal thalline of collecting, addition 50mlNBP buffer (50mMNa₂HPO₄/NaH₂PO₄, pH=8.0,0.5MNaCl, 20mM imidazoles, 1mMbeta-mercaptoethanol, 1mMPMSF) in, sonioation method extracts soluble protein (ice bath, power is 60W, pulse 2s, interval 3s, total time 10min), becomes clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, take supernatant soluble protein, after utilizing 0.22 μm low protein bound membrane filtration, loading is to nickel affinity chromatography post (volume 5ml), standing is in conjunction with 15min, then successively with the lavation buffer solution (50mMNa containing 20mM, 40mM, 60mM and 80mM imidazoles of 20 times of column volumes₂HPO₄/NaH₂PO₄, pH=8.0,0.5MNaCl, 1mMbeta-mercaptoethanol, the imidazoles of respective concentration) wash successively, finally with the elution buffer (50mMNa containing 250mM imidazoles₂HPO₄/NaH₂PO₄, pH=8.0,0.5MNaCl, 1mMbeta-mercaptoethanol, 250mM imidazoles) eluting destination protein.All purification process all carry out at 4 DEG C, and ensure all of relevant buffers of pre-cooling.The albumen that purification obtains is stored in 20% glycerol ,-70 DEG C of preservations after subpackage.All purification process all carry out at 4 DEG C, and ensure all of relevant buffers of pre-cooling.The albumen that purification obtains is stored in 20% glycerol ,-70 DEG C of preservations after subpackage.Purity of protein is analyzed by SDS-PAGE (12% (M/V) acrylamide gel), and result is as it is shown in figure 5, GST-wACP1, GST-wACP2 and GST-wPPT purity of protein of recombinating in elution fraction is all higher than 90%.

6, recombiant protein GST-wACP1, GST-wACP2 and the GST-wPPT after nickel affinity purification uses MilliporeAmiconUltra-15 super filter tube (purchased from Millipore, molecular cut off is 10kD, article No.: UFC201024PL) protein concentrate, and former elution buffer is replaced into enzyme reaction buffer solution (20mMTris-HCl, 100mMNaCl, 100mMKCl, 5mMMgCl₂, 10mMCaCl₂, 1mMbeta-mercaptoethanol, 0.5mMDTT, 15% (w/v) glycerol, pH7.5).Operation is undertaken by UFC201024PL description, first the protein concentration of above purification is about 1ml to volume, add 1ml enzyme reaction buffer solution, it is 1ml that recentrifuge is concentrated into volume, so repeat 3 times, finally by albumen constant volume in 2-3ml enzyme reaction buffer solution, the imidazoles in elution buffer time now by nickel affinity purification is reduced to below 10mM.Measuring protein concentration, protein-20 DEG C preserves.

The 4-phosphopantetheine of ACP domain is modified by step 2 PPT domain

Standing grain this Rhodothece glutinis fatty acid synthase PPT domain has Phosphopantetheinyl transferase activity; can the newborn ACP (apo-ACP of catalysis; inactive form) react with coenzyme A; generate 3 '; 5 '-adenosine diphosphate (ADP) (3 '; 5 '-ADP) and activation ACP (holo-ACP, on the hydroxyl of 36 serine residues by phospholipid key connect 4 ' phosphopan tetheine base mercaptoethylmaines from coenzyme A).

20 μ gGST-ACP, 2 μ gGST-PPT and 0.3mMCoA (coenzyme A, biological purchased from the raw work in Shanghai) are mixed in 20 μ l enzyme reaction buffer solution (20mMTris-HCl, pH=7.5,100mMNaCl, 100mMKCl, 5mMMgCl₂, 10mMCaCl₂, 1mMbeta-mercaptoethanol, 0.5mMDTT, 15% (w/v) glycerol) in, 30 DEG C of incubations 3 hours.10-20 DEG C of preservations of μ l sample, for Mass Spectrometric Identification.Remaining and add 1 μ l (1U/ μ l) enterokinase (enterokinase, biological purchased from raw work) in 10 μ l samples, dilution volume is to 12.5 μ l, and 25 DEG C are reacted 16 hours, add 48.5 μ lddH₂O and 20 μ l4 × SDS-PAGE sample buffer (12%SDS (W/V), 6% mercaptoethanol (V/V), 30% glycerol (W/V), 0.05% Coomassie brilliant blue G-250 (Serva), 150mMTris/HCl (pH7.0)), 50 DEG C of incubation 15min.Take 8 μ l samples and carry out Trcine-SDS-PAGE, gel strength be 16% [H.NatProtoc.2006,1 (1), 16-22.].Result shows, the GST-PPT of purification can occur 4 '-phosphopantetheine to modify by catalysis GST-ACP, increase 340Dalton owing to ACP is modified rear molecular weight, Apo-ACP and Holo-ACP (Fig. 6) can be separated in 16% polyacrylamide gel by Tricine-SDS-PAGE

Embodiment 5: the eukaryotic expression of standing grain this Rhodothece glutinis fatty acid synthase and recombinant bacterial strain build

Step one, standing grain this Rhodothece glutinis fatty acid synthase expression vector pYX212-RgrFAS1+2 build

Utilize efficient homologous recombination advantage in saccharomyces cerevisiae body, based on module assembled strategy [ZhouYJ, GaoW, RongQX, JinGJ, ChuHY, LiuWJ, YangW, ZhuZW, LiGH, ZhuGF, HuangLQ, ZhaoZK.J.Am.Chem.Soc.2012,134,3234-3241], what carry out RgrFAS recombinant Saccharomyces cerevisiae bacterial strain builds the function reasonableness with RgrFAS.

DNA sequence according to rgrfas1 and rgrfas2 coding gene sequence and saccharomyces cerevisiae constitutive expression carrier pYX212 [purchased from Biovector China plasmid vector strain cell pnca gene preservation center], the following primer for module assembled of design.Module assembled process is as it is shown in fig. 7, primer sequence information is as shown in table 2.

Primer needed for table 2.pYX212-RgrFAS1+2 vector construction

Primer	Another name	Sequence
			TPIp-F	a-F	GAATTGGGGATCTACGTATGGTC
FAS1-TPIp	a-R	CGCGTCGCTCGGCCGTTCATTTTTAGTTTATGTATGTG
			TPIp-FAS1	b-F	CACATACATAAACTAAAAatgaacggtcaccacacccgtgcc
TDH2t-FAS1	b-R	AGTAACTTAAGGAGTTAAATtcactggatcgccgagaagacgtc
			FAS1-TDH2t	c-F	ACGTCTTCGGCGGGCTCTGAATTTAACTCCTTAAGTTACT
FAS2-ADH1t	c-R	CGCCGTCGTCATCGCCCAGAAGTAAGCGAATTTCTTATGATTTATG

ADH1t-FAS2	c-F’	CATAAATCATAAGAAATTCGCctacgagcgagcgatgacgacggcgac
			FAS2-4386	e-R	CACGGCGAGGCGTACGTCCAGGGCATC
FAS2-4515	f-F	CGTGATGTCGCGGTCGACGGTCGTGAG
			FAS2-2580	f-R	CCCGTACGAGGTCTCCAAGGAGTACGCC
FAS2-3096	g-F	GTCGACGGCCTTGAGCGGCTCGTC 13 -->
			TEF1p-FAS2	g-R	CTAAGTTTTAATTACAAAatggcggccgaccttccgctcgcg
FAS2-TEF1p	h-F	GGCAAGTCCTGCGCCGCGACCATTTTGTAATTAAAACTTAG
			Plasmid-TEF1p	h-R	GGATGTGCTGCAAGGCGATTAATAGCTTCAAAATGTTTCTA
TEF1p-Plasmid	i-F	GTAGAAACATTTTGAAGCTATTAATCGCCTTGCAGCACATCC
			Plasmid	i-R	TGCCGTAAACCACTAAATCGGAACC

1, element obtains.Utilize TPIp-F and FAS1-TPIp primer, with pYX212 carrier for template, pcr amplification phosphotriose isomerase promoter TPI1p genetic fragment (a fragment, Fig. 7, lower same)；Utilizing TPIp-FAS1 and TDH2t-FAS1 primer, in embodiment 3, the pMD19T-RgrFAS1 plasmid of structure is for template, pcr amplification RgrFAS1 subunit gene fragment (b fragment)；Utilize FAS1-TDH2t and FAS2-ADH1t primer, with pYJ35 plasmid [referring to ZhouYJ, GaoW, RongQX, JinGJ, ChuHY, LiuWJ, YangW, ZhuZW, LiGH, ZhuGF, HuangLQ, ZhaoZK.J.Am.Chem.Soc.2012,134,3234-3241] for template, the double; two terminator genetic fragment (c fragment) of pcr amplification ADH1t+THD2t；To utilize FAS1-TDH2t ' and FAS2-ADH1t ' primer, with pYJ35 plasmid [referring to ZhouYJ, GaoW, RongQX, JinGJ, ChuHY, LiuWJ, YangW, ZhuZW, LiGH, ZhuGF, HuangLQ, ZhaoZK.J.Am.Chem.Soc.2012,134,3234-3241] for template, the double; two terminator genetic fragment of pcr amplification ADH1t+THD2t (c ' fragment)；Utilizing ADH1t-FAS2 and FAS2-4304 primer, in embodiment 2, the pMD19T-RgrFAS2 of structure is for template, the C-terminal sequence (e fragment, RgrFAS24386-8793) of pcr amplification RgrFAS2；Utilizing FAS2-4529 and FAS2-2660 primer, in embodiment 3, the pMD19T-RgrFAS2 of structure is for template, the pcr amplification RgrFAS2 intermediate sequence (f fragment, RgrFAS2 (2580-4515)) containing ACP domain；Utilizing FAS2-3021 and TEF1p-FAS2 primer, in embodiment 3, the pMD19T-RgrFAS2 of structure is for template, the N-terminal sequence (g fragment, RgrFAS21-3096) of pcr amplification RgrFAS2；Utilize FAS2-TEF1p and Plasmid-TEF1p primer, with pYJ35 plasmid for template, pcr amplification transcriptional elongation factor 1 promoter TEF1p genetic fragment (h fragment)；Utilize TEF1p-Plasmid (i-F) and Plasmid (i-R) primer, with pYX212 carrier for template, pcr amplification carrier homologous recombination arm pieces section (i fragment).

Pcr amplification condition is as follows: 5 × PrimeSTARBuffer (TakaRa) 100.0 μ l, dNTPs (10mM, TaKaRa) 10.0 μ l, forward primer and downstream primer (equal 10mM) 10.0 μ l, PrimeSTAR (TakaRa) 2.5 μ l, template DNA (equal 100ng/ μ l) 5.0 μ l, ddH₂O polishing is to 500 μ l, and 5 PCR pipe of subpackage after mix homogeneously, 100 μ l/ manage；Being incubated 3min in 94 DEG C, then in 98 DEG C of 10s, 58 DEG C of 10s, 72 DEG C of 3min, 30 circulations, then 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer carries out 1% (mass/volume concentration) agarose gel electrophoresis, DNA band is sufficiently separated rear cutout and cuts off the gel containing target DNA, DNA is utilized to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier's proposed steps (NEP013-2 description) the above-mentioned PCR primer of purification.

2, module construction.A, b and c fragment after purification obtains d module by OverlapextensionPCR [BryksinAV, MatsumuraI.Biotechniques.2010,48 (6), 463-465.]；C ' and e fragment obtain k module by OverlapextensionPCR；F fragment also inherently f module；G, h and i obtain j module by OverlapextensionPCR.OverlapextensionPCR condition is as follows: 5 × PrimeSTARBuffer (TakaRa) 50.0 μ l, dNTPs (10mM, TaKaRa) 5.0 μ l, each module two ends primer (equal 10mM) 5.0 μ l, PrimeSTAR (TakaRa) 2.0 μ l, each genetic fragment (equal 100nmol/ μ l) 2.0 μ l, ddH₂O polishing is to 250 μ l, and 5 PCR pipe of subpackage after mix homogeneously, 50 μ l/ manage；Being incubated 3min, 72 DEG C of 5min in 94 DEG C, then in 98 DEG C of 10s, 58 DEG C of 10s, 72 DEG C of 5min, 30 circulations, then 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer carries out 1% (mass/volume concentration) agarose gel electrophoresis, DNA band is sufficiently separated rear cutout and cuts off the gel containing target DNA, DNA is utilized to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to the above-mentioned OverlapextensionPCR product of supplier's proposed steps (NEP013-2 description) purification.

3, module assembled.Use the 500ng pYX212 carrier large fragment reclaimed after twice double digestion linearisation of EcoRI/XhoI and BamHI/HindIII, and equimolar modular segments, cotransformation S.cerevisiaeBY4741 (purchased from EUROSCARF, genotype: MATahis3 Δ 1leu2 Δ 0met15 Δ 0ura3 Δ 0).Method for transformation is as follows: single yeast colony is inoculated in 5mlYPD culture medium (20g/L peptone, 10g/L yeast extract and 20g/L glucose, pH6.0), incubated overnight；Being inoculated in YPD culture medium fresh for 100ml with 1: 50, cultivate about 8h, now OD value is about 1.0-1.2, ice bath 15min；4 DEG C, the centrifugal 10min of 2000 × g collects thalline, is suspended in the ice-cold ddH of 50ml₂The centrifugal 10min of O, 2000 × g is centrifugal collects thalline, is then suspended in 1M sorbitol ice-cold for 20ml, and the centrifugal 10min of 2000 × g is centrifugal collects thalline, uses up solution, and thalline is suspended in the sorbitol that 0.5-1.0ml is ice-cold, and now OD value is about 100-200.null50 μ l electricity turn and add equimolar d in competent cell、k、f、J module DNA and pYX212 carrier large fragment (altogether 3 μ g)，Place 10min on ice，It is transferred in ice-cold electric revolving cup，1500V photovoltaic conversion，Under this condition, the electric shock time is about 5ms，Shock by electricity and added the ice-cold sorbitol of 1ml，2h is bathed in 30 DEG C of shaking table temperature，(0.67%YNBW/Oaminoacidsbutwithammoniumsulfate is (without aminoacid yeast basic nitrogen source to be applied to SC-Ura flat board，Liquid containing ammonium sulfate，Purchased from BDDific，Article No.: 291920)，2% glucose，0.005% histidine，0.005% methionine，0.01% leucine，2% agar powder)，It is inverted for 30 DEG C and cultivates 2 days，Flat board occurs transformant.Picking transformant is inoculated in 10mlSC-Ura culture medium, and (0.67%YNBW/Oaminoacidsbutwithammoniumsulfate is (without aminoacid yeast basic nitrogen source, liquid containing ammonium sulfate, purchased from BDDific, article No.: 291920), 2% glucose, 0.005% histidine, 0.005% methionine, 0.01% leucine), 30 DEG C of 200rpm shaken cultivation 2d, utilize the plasmid in bead breaking cellular wall method rapid extraction yeast, Transformed E .coliDH5a according to a conventional method, the AMP resistant transformants obtained extracts plasmid [the Molecular Cloning: A Laboratory guide third edition (Pehanorm Brooker work after cultivating, Huang Peitang etc. translate, Science Press publishes]；Plasmid is after digestion verification and sequencing analysis, it was demonstrated that be the correct RgrFAS Yeast expression carrier built, called after pYX212-RgrFAS1+2.

Step 2, single subunit expression carrier pYX212-RgrFAS1 and pYX212-RgrFAS2 structure

(the underscore part of primer RgrFAS1-EcoRI-F is EcoRI restriction enzyme site to add the primer of corresponding restriction enzyme site according to the design of RgrFAS1 nucleotide sequence, the underscore part of primer RgrFAS1-HindIII-R is HindIII restriction enzyme site), sequence is as follows:

RgrFAS1-EcoRI-F:ctctgaattcatgaacggtcaccacacccgtgccggcacc

RgrFAS1-HindIII-R:tctaagctttcactggatcgccgagaagacgtcgagctt

(the underscore part of primer RgrFAS2-EcoRI-F is EcoRI restriction enzyme site to add the primer of corresponding restriction enzyme site according to the design of RgrFAS2 nucleotide sequence, the underscore part of primer RgrFAS2-HindIII-R is HindIII restriction enzyme site), sequence is as follows:

RgrFAS2-EcoRI-F:ctctgaattcatggcggccgaccttccgctcgcgctgagc

RgrFAS2-HindIII-R:tctaagcttctacgagcgagcgatgacgacggcgacggc

With cloning vehicle pMD19T-RgrFAS1 and the pMD19T-RgrFAS2 that previously built for template, utilize thing RgrFAS1-EcoRI-F/RgrFAS2-HindIII-R and RgrFAS2-EcoRI-F/RgrFAS1-HindIII-R two to drawing amplification RgrFAS1 and RgrFAS2 coding region sequence respectively.The pcr amplification product of RgrFAS1 and RgrFAS2 is through EcoRI/HindIII double digestion, it is connected into pYX212 (purchased from the Biovector China plasmid vector strain cell pnca gene preservation center) carrier (reclaiming enzyme action large fragment to be used for connecting) of same double digestion, Transformed E .coliDH5a Competent cell, through the recombiant plasmid that EcoRI/HindIII double digestion and sequence verification are correct, it is respectively designated as pYX212-RgrFAS1 and pYX212-RgrFAS2.

Step 3, RgrFAS expression of recombinant yeast bacterial strain structure

Recombiant plasmid pYX212-RgrFAS1 is converted to S.cerevisiaeIKY2 (by Greifswald, Germany university (Ernst-Moritz-Arndt-Greifswald) Hans-JoachimSch ü professor ller bestows, genotype: MAT α, ura3, leu2, trp1, his3, can1, Δ fas1::LEU2) [referring to WenzP, SchwankS, HojaU, Sch ü llerHJ.NucleicAcidsRes.2001,29 (22), 4625-4632.], pYX212-RgrFAS2 is converted to S.cerevisiaeIKY4 (by Greifswald, Germany university (Ernst-Moritz-Arndt-Greifswald) Hans-JoachimSch ü professor ller bestows, genotype: MAT α, ura3, leu2, trp1, his3, can1, Δ fas2::LEU2) [referring to WenzP, SchwankS, HojaU, Sch ü llerHJ.NucleicAcidsRes.2001,29 (22), 4625-4632.], pYX212-RgrFAS1+2 is converted to S.cerevisiaePWY12 (by Greifswald, Germany university (Ernst-Moritz-Arndt-Greifswald) Hans-JoachimSch ü professor ller bestows, genotype: MAT α, ura3, leu2, trp1, his3, can1, Δ fas2::LEU2, Δ fas1::HIS3) in [referring to WenzP, SchwankS, HojaU, Sch ü llerHJ.NucleicAcidsRes.2001,29 (22), 4625-4632.].

Method for transformation is as follows: S.cerevisiaeIKY2, S.cerevisiaeIKY4 and S.cerevisiaePWY12 choose single yeast colony respectively and be inoculated in YPD culture medium (the 20g/L peptone of 5ml fatty acids, 10g/L yeast extract and 20g/L glucose, pH6.0, and containing 0.5mM Palmic acid, 0.5mM stearic acid, 1%Tween20), incubated overnight；It is inoculated in YPD culture medium (20g/L peptone, 10g/L yeast extract and 20g/L glucose, pH6.0) fresh for 100ml with 1: 50, is cultured to OD value and is about 0.8-1.0, ice bath 15min；4 DEG C, the centrifugal 10min of 2000 × g collects thalline, is suspended in the ice-cold ddH of 50ml₂The centrifugal 10min of O, 2000 × g is centrifugal collects thalline, is then suspended in 1M sorbitol ice-cold for 20ml, and the centrifugal 10min of 2000 × g is centrifugal collects thalline, uses up solution, and thalline is suspended in the sorbitol that 0.5-1.0ml is ice-cold, and now OD value is about 100-200.50 μ l electricity turn addition 0.5-1 μ g plasmid DNA (volume is less than 5 μ l) in competent cell, place 10min on ice, it is transferred in ice-cold electric revolving cup, 1500V photovoltaic conversion, under this condition, the electric shock time is about 5ms, shock by electricity and added the ice-cold sorbitol of 1ml, 2h is bathed in 30 DEG C of shaking table temperature, it is applied to the SC-Ura flat board of corresponding Lacking of nutrition composition [with reference to WenzP, SchwankS, HojaU, Sch ü llerHJ.NucleicAcidsRes.2001,29 (22), 4625-4632.], cultivate 3-4 days to growing transformant for 30 DEG C.nullTransformant is inoculated in the SC-Ura fluid medium of corresponding Lacking of nutrition composition [with reference to WenzP，SchwankS，HojaU，SchüllerHJ.NucleicAcidsRes.2001，29(22)，4625-4632.] overnight，3-4ml bacterium solution is centrifugal collects thalline，Bead smudge cells，Extract plasmid DNA transformation E.coliDH5a，Transformant extracts plasmid，The plasmid origin recombinant bacterium that EcoRI/NotI digestion verification is correct is then respectively designated as S.cerevisiaeIKY2/pYX212-RgrFAS1、S.cerevisiaeIKY4/pYX212-RgrFAS2 and S.cerevisiaePWY12/pYX212-RgrFAS1+2.

Step 4, RgrFAS expression of recombinant yeast bacterial strain grease production are analyzed

nullS.cerevisiaeIKY2/pYX212-RgrFAS1、S.cerevisiaeIKY4/pYX212-RgrFAS2 and S.cerevisiaePWY12/pYX212-RgrFAS1+2 inoculates 5mlSC-Ura fluid medium respectively, and (0.67%yeastnitrogenbaseW/Oaminoacidsbutwithammoniumsulfat e is (without aminoacid yeast basic nitrogen source，Liquid containing ammonium sulfate，Purchased from BDDific，Article No.: 291920)，2% glucose，0.01% leucine，0.01% tryptophan，0.005% histidine) 30 DEG C，200rpm cultivates 24h.Transferring respectively in 1: 30 ratio, (20% glucose, 0.1% yeast soaks powder, 0.4%KH to SC-Ura-NL limit nitrogen culture medium₂PO₄, 0.15%MgSO₄·7H₂O, trace element solution 500 μ L/50mL culture medium, NH₄Cl0.025%, pH6.0, C/N ratio (mol/mol)=300, trace element solution formula: 0.4%CaCl₂·H₂O, 0.055%FeSO₄·7H₂O, 0.052% citric acid monohydrate, 0.01%ZnSO₄·7H₂O, 0.0076%MnSO₄·H₂O, 180mM sulphuric acid), 30 DEG C, 200rpm cultivates 3d, samples every 24h, stays and do Oil Content Analysis [LiYH, ZhaoZK, BaiFW.EnzymeMicrob.Technol.2007,41 (3), 312-317].3 recombinant bacterial strain fat contents in the born of the same parents of fermentation termination (3d) are as shown in table 3.

nullPYX212 empty carrier converts bacterial strain S.cerevisiaeIKY2/pYX212、S.cerevisiaeIKY4/pYX212、S.cerevisiaePWY12/pYX212 is then as control strain，First respectively inoculate 5ml fatty acids SC-Ura fluid medium (0.67%yeastnitrogenbaseW/Oaminoacidsbutwithammoniumsulfat e is (without aminoacid yeast basic nitrogen source，Liquid containing ammonium sulfate，Purchased from BDDific，Article No.: 291920)，2% glucose，0.01% leucine，0.01% tryptophan，0.005% histidine，And 0.5mM Palmic acid、0.5mM stearic acid，1%Tween20) 30 DEG C，200rpm cultivates 24h.Transferring respectively in 1: 30 ratio, (20% glucose, 0.1% yeast soaks powder, 0.4%KH to SC-Ura-NL limit nitrogen culture medium₂PO₄, 0.15%MgSO₄·7H₂O, trace element solution 500 μ L/50mL culture medium, NH₄Cl0.025%, pH6.0, C/N ratio (mol/mol)=300, trace element solution formula: 0.4%CaCl₂·H₂O, 0.055%FeSO₄·7H₂O, 0.052% citric acid monohydrate, 0.01%ZnSO₄·7H₂O, 0.0076%MnSO₄·H₂O, 180mM sulphuric acid), 30 DEG C, 200rpm cultivates 3d, samples every 24h, stays and do Oil Content Analysis [LiYH, ZhaoZK, BaiFW.EnzymeMicrob.Technol.2007,41 (3), 312-317].

Result shows, fat content can more than 30% in fermentation termination (3d) born of the same parents for the recombinant bacterial strain S.cerevisiaePWY12/pYX212-RgrFAS1+2 of the double; two subunit coexpression of RgrFAS, and in the born of the same parents of single subunit RgrFAS1, RgrFAS2 recombinant bacterial strain, fat content does not substantially increase.Prove that RgrFAS can dramatically increase fat content in non-Lipid-producing extracellular microbial, give recombinant bacterial strain grease production character；Further, this function needs two subunits of RgrFAS1, RgrFAS2 jointly to perform.

Table 3. restructuring yeast strains fat content in the born of the same parents of fermentation termination (3d)

Note :/represent owing to biomass is few, fail to obtain fat content in effective born of the same parents

Should be appreciated that, although with reference to the embodiment that it is exemplary, the present invention carried out particularly shown and described, but it will be apparent to an ordinarily skilled person in the art that, without departing substantially from when by the spirit and scope of the present invention as defined in the claims, the change of various forms and details can be carried out wherein, it is possible to carry out the combination in any of various embodiment.

Claims

1. an oleaginous yeast fatty acid synthase, it is made up of RgrFAS1 subunit and RgrFAS2 subunit, and the aminoacid sequence of wherein said RgrFAS1 subunit is such as shown in SEQIDNO:1, and the aminoacid sequence of described RgrFAS2 subunit is such as shown in SEQIDNO:2.

2. deriving from biologically active polypeptide fragment or the domain of oleaginous yeast fatty acid synthase described in claim 1, the aminoacid sequence of described polypeptide fragment or domain is the combination of any one or any two or the more fragment that are selected from fragment:

The position 191-600 of SEQIDNO:1,

The position 612-1143 of SEQIDNO:1,

The position 58-488 of SEQIDNO:2,

The position 491-883 of SEQIDNO:2,

The position 1022-1187 of SEQIDNO:2,

The position 1214-1380 of SEQIDNO:2,

The position 1727-1985 of SEQIDNO:2,

The position 2068-2714 of SEQIDNO:2, and

The position 2815-2926 of SEQIDNO:2.

3. the biologically active polypeptide fragment of the oleaginous yeast fatty acid synthase described in claim 2 or domain, its biological activity is selected from single acyl/Acetylase (AT) activity, enoyl-ACP reductase (ER) activity, dehydratase (DH) activity, malonyl/palmitoyl transferase (MPT) activity, first acyl carrier protein (ACP) activity, second acyl carrier protein (ACP) activity, ketoacyl reductase (KR) activity, any one or any two in ketone ester-acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) activity or more kinds of combinations.

4. the nucleotide sequence of coding oleaginous yeast fatty acid synthase described in claim 1.

5. nucleotide sequence according to claim 4, wherein encodes the nucleotide sequence of RgrFAS1 subunit of described oleaginous yeast fatty acid synthase such as shown in SEQIDNO:3；Encode the nucleotide sequence of RgrFAS2 subunit of described oleaginous yeast fatty acid synthase such as shown in SEQIDNO:4.

6. the nucleotide sequence of the biologically active polypeptide fragment of coding oleaginous yeast fatty acid synthase described in claim 2 or domain, it is selected from any one in nucleotide sequence or any two or the combination of more sequence:

7. contain expression cassette or the recombinant expression carrier of nucleotide sequence in any of the one of claim 4-6.

8. contain the reconstitution cell of nucleotide sequence in any of the one of claim 4-6.

9. the method building grease production reconstitution cell, described method includes importing in host cell the nucleotide sequence described in claim 5, obtains grease production reconstitution cell.