CN104031894B

CN104031894B - A kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application

Info

Publication number: CN104031894B
Application number: CN201310067735.1A
Authority: CN
Inventors: 赵宗保; 张素芳; 朱志伟
Original assignee: Dalian Institute of Chemical Physics of CAS
Current assignee: Dalian Institute of Chemical Physics of CAS
Priority date: 2013-03-04
Filing date: 2013-03-04
Publication date: 2016-09-14
Anticipated expiration: 2033-03-04
Also published as: CN104031894A

Abstract

The invention discloses a kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application.This fatty acid synthase is made up of RgFAS1 subunit and RgFAS2 subunit, and described RgFAS1 subunit is the protein of following (a) or (b): the protein that (a) is made up of the aminoacid sequence shown in SEQ ID NO:1；(b) by the aminoacid of SEQ ID NO:1 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQ ID NO:1 with fatty acid synthase subunit 1 function；Described RgFAS2 subunit is the protein of following (c) or (d): the protein that (c) is made up of the aminoacid sequence shown in SEQ ID NO:2；(d) by the aminoacid of SEQ ID NO:2 through one or several amino acid whose replacement and/or disappearance and/or interpolation and with the protein derived by SEQ ID NO:2 with fatty acid synthase subunit 2 function.

Description

A kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application

Technical field

The invention belongs to biological technical field, relate to a kind of oleaginous yeast fatty acid synthase and gene thereof and application.Specifically Ground, described oleaginous yeast fatty acid synthase and encode its nucleotide source in rhodotorula glutinis (Rhodotorula glutinis).The present invention also provides for a kind of method building grease production reconstitution cell.

Background technology

Oils and fats is the Renewable resource that a kind of oxygen content is low, energy density is high, carbon chain lengths is moderate, can substitute for fossil money Source processes raw material substantially as chemical industry and regenerative resource industry, be the mankind from hydrocarbon economy to hydrocarbon oxygen transition Important link, its market potential is huge.In nature, a part of microorganism under given conditions can be born of the same parents (as nitrogen source lacks) Interior storage exceedes the oils and fats of its dry cell weight 20%, is wherein main with triglyceride (Triacylglycerol, TAG), has this The microorganism planting phenotype is referred to as oleaginous microorganism, and including antibacterial, yeast, mycete, algae etc., wherein oleaginous yeast includes Some bacterium in Rhodotorula, Candida, Cryptococcus, Rhizopus, Trichosporon and Yarrowia genus Strain [Ratledge C, Wynn J P.Adv Appl Microbiol2002,51,1-51].Microorganism conversion of biomass is utilized to provide Source produces oils and fats, can develop into the new skill of be substantially independent of ploughing, can produce continuously, reduce agricultural pollution, comprehensive utilization of resources Art, formed chemicals fossil resources succedaneum produce new way [Zhao Zongbao. Chinese biological engineering magazine 2005,25 (2), 8- 11]。

Since half a century, what domestic and international microbial grease was studied focuses on bacterial strain screening, domestication and fermentation technology The fields such as optimization, achieve major progress.Excellent along with the fast development of biotechnology, simple bacterial screening and culture process Change the needs that can not meet oleaginous microorganism character improvement.As the natural production bacterial strain of a certain chemicals, it is specifically given birth to Produce performance often and non-optimal.How to optimize or change metabolism network and the expression regulation network of industrial strain, to improve biology The accumulating rate of base product or the quality of oriented control target product, be focus and the difficult point of the research of current biological technical field.Oil Fat fermentation research needs reconstruct and the strengthening of fat metabolic approach, gives the property that recombinant bacterial strain produces Novel fatty acid derivative Energy.Owing to the genetic background of excellent original inhabitants' production bacterial strain is the most unclear, oil and fat accumulation metabolic regulation Cloning of Genes Related has Limit, finds more oil and fat accumulation metabolic regulation related gene, is one of the important directions of current microbial grease research.

It was discovered by researchers that the 1-Hydroxy-1,2,3-propanetricarboxylic acid. deriving from oleaginous microorganism (circle rhodosporidium toruloides and Si Shi saccharomyces oleaginosus) takes off The encoding gene of hydrogen enzyme (IDH) and malate dehydrogenase (ME) has differential expression, saccharomyces cerevisiae merit during original inhabitants' bacterium oil and fat accumulation Can also demonstrate that these genes can increase the fat content of recombinant bacterial strain by complementation analysis, but and could not be by a non-oil-producing bacterial strain success It is transformed into an oil-producing bacterial strain [Yang F, Zhang SF, Zhou YJ, Zhu ZW, Lin XP, Zhao ZK.Appl.Microbiol.Biotechnol.2012,94 (4), 1095-1105].Experimental result implies, microbial grease amasss Tired metabolic regulation may relate to more gene and mutually regulation therebetween and interacts.

From acetyl-CoA and malonyl CoA de novo synthesis short chain and middle chain saturated fatty acids, need a series of gram The gloomy condensation reaction of Lay decarboxylation, be to be lived by several enzymes in mediating the complex process of catalysis.In most of antibacterials and plant, these enzymes The enzyme system that activity is made up of discrete single functional polypeptide completes (fatty acid synthase Type II)；And mammal and fungus In, the oligomerization enzyme that these enzymatic activitys are then made up of one or two multifunctional polypeptides exercises (fatty acid synthase type I).At fat In fat acid building-up process, substrate and intermediate product molecule (may be located at same enzyme molecule, it is also possible to position at each functional domain In different enzyme molecules) in transmission until complete fatty acid whole building-up process [Stoops JK, Arslanian MJ, Oh YH, Aune KC, Vanaman TC, Wakil SJ.Proc Natl Acad Sci USA.1975,72 (5), 1940-1944].

Fatty acid synthase (Fatty Acid Synthase, FAS) in mammal is a homodimer, contains Two identical multi-functional subunits (molecular weight subunit is 272kDa), the N end regions of each subunit contains three catalytic structures Territory: ketone ester-acyl ACP synthase (ketoacyl synthase, KS), single acyl/Acetylase (acyltransferase, AT) With dehydratase (dehydratase, DH), C end regions then contains four domains: enoyl-ACP reductase (enoyl Reductase, ER), ketoacyl reductase (ketoacyl reductase, KR), acyl carrier protein (acyl carrier Protein, ACP) and thioesterase (thioesterase, TE)；The two region is by the core of middle 600 amino acid residues composition Heart region is separated.In Ascomycota yeast, 6 enzymatic activity domains of ACP and other are respectively positioned in two different subunits On, one has ACP, KR, KS and Phosphopantetheinyl transferase (phosphopantetheinyl Transferase, PPT) domain, another subunit then contains AT, ER, DH and malonyl/palmitoyl transferase (malonyl/ Palmitoyl transferase, MPT) domain.

Recently, we find the fatty acid synthase of a kind of novelty in rhodotorula glutinis (Rhodotorula glutinis), Present in this enzyme and other fungus, the different of fatty acid synthase are, its beta subunit (FAS1) comprises only AT (single acyl/acetyl Transferring enzyme) domain and ER (enoyl-ACP reductase) domain, and remaining domain is all on alpha subunit (FAS2)；With Time, this fatty acid synthase exists the ACP domain of two tandem.Cut-off patent submits day to, and NCBI does not retrieves pass Any sequence information in rhodotorula glutinis (R.glutinis) fatty acid synthase.

Summary of the invention

It is an object of the invention to provide a kind of oleaginous yeast fatty acid synthase and encoding gene thereof and application.

The oleaginous yeast fatty acid synthase that the present invention provides, title is abbreviated as RgFAS (R.glutinis Fatty Acid Synthase), deriving from rhodotorula glutinis (R.glutinis) ATCC204091, described oleaginous yeast fatty acid synthase is by RgFAS1 Subunit and RgFAS2 subunit composition, wherein said RgFAS1 subunit is the protein of following (a) or (b):

A protein that () is made up of the aminoacid sequence shown in SEQ ID NO:1；

B the aminoacid of SEQ ID NO:1 is passed through one or several amino acid whose replacement and/or disappearance and/or interpolation by () And with there is the protein derived by SEQ ID NO:1 of fatty acid synthase subunit 1 function；

Described RgFAS2 subunit is the protein of following (c) or (d):

C protein that () is made up of the aminoacid sequence shown in SEQ ID NO:2；

D the aminoacid of SEQ ID NO:2 is passed through one or several amino acid whose replacement and/or disappearance and/or interpolation by () And with there is the protein derived by SEQ ID NO:2 of fatty acid synthase subunit 2 function.

Wherein said " fatty acid synthase subunit 1 function " specifically refers to single acyl/Acetylase (AT) activity and alkene acyl ACP The adduction of reductase (ER) activity；Wherein said " fatty acid synthase subunit 2 function " specifically refer to dehydratase (DH) activity, the third two Acyl/palmitoyl transferase (MPT) activity, the first acyl carrier protein (ACP) are active, the second acyl carrier protein (ACP) is active, Ketoacyl reductase (KR) activity, ketone ester-acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) The adduction of activity.

The invention still further relates to the biologically active polypeptide fragment of oleaginous yeast fatty acid synthase (RgFAS) (in this article, also referred to as For domain), its aminoacid sequence is any one in following fragment or any two or the group of more fragment Close:

The position 190-599 (it has single acyl/Acetylase (AT) activity) of SEQ ID NO:1,

The position 611-1142 (it has enoyl-ACP reductase (ER) activity) of SEQ ID NO:1,

The position 60-490 (it has dehydratase (DH) activity) of SEQ ID NO:2,

The position 493-885 (it has malonyl/palmitoyl transferase (MPT) activity) of SEQ ID NO:2,

The position 1021-1186 (it has the first acyl carrier protein (ACP) activity) of SEQ ID NO:2,

The position 1212-1378 (it has the second acyl carrier protein (ACP) activity) of SEQ ID NO:2,

The position 1725-1983 (it has ketoacyl reductase (KR) activity) of SEQ ID NO:2,

The position 2066-2716 (it has ketone ester-acyl ACP synthase (KS) activity) of SEQ ID NO:2, and

The position 2815-2926 (it has Phosphopantetheinyl transferase (PPT) activity) of SEQ ID NO:2.

The biologically active polypeptide fragment (domain) of described RgFAS, the white single acyl/Acetylase of its biological activity choosing (AT) activity, enoyl-ACP reductase (ER) activity, dehydratase (DH) activity, malonyl/palmitoyl transferase (MPT) activity, the One acyl carrier protein (ACP) activity, the second acyl carrier protein (ACP) activity, ketoacyl reductase (KR) activity, ketone ester- Any one or any two in acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) activity or More kinds of combinations.

This fatty acid synthase is produced in terms of external synthetic fatty acid and derivant thereof in genetic engineering, described in order to make RgFAS1 subunit and (/ or) RgFAS2 subunit be secreted in periplasmic or culture medium or make its function-stable, can be described The aminoterminal of RgFAS1 subunit and (/ or) RgFAS2 subunit connects upper signal peptide sequence；In order to make RgFAS albumen or its subunit or Its biologically active polypeptide fragment (domain) is easy to purification, can be at RgFAS1 subunit or RgFAS2 subunit or its biologically active polypeptide The amino terminal of fragment (domain) or carboxyl terminal connect upper label as shown in table 1 or the (glutathione S-transfer of GST label Enzyme label).

Table 1 label and sequence thereof

Label	Amino acid residue number	Sequence
			Poly-Arg	5-6 (usually 5)	RRRRR
FLAG	8	DYKDDDDK

Poly-His	2-10 (usually 6)	HHHHHH
			C-myc	10	EQKLISEEDL
Strep-tagII	8	WSHPQFEK
			Poly-Phe	11	FFFFFFFFFFF

Above-mentioned restructuring RgFAS albumen or its biologically active polypeptide fragment (domain) of tagging can synthetic, it is possible to first Synthesize its encoding gene, then carry out common protein and express and obtain.Above-mentioned tag restructuring RgFAS albumen or its biological activity many The encoding gene of fragments of peptides (domain) may be by lacking 1 in the DNA sequence shown in SEQ ID NOs:3-13 any one Individual or the codon of several coded amino acid, and/or carry out 1 or the missense mutation of several base pair, and/or at its 5 ' end and 3 ' ends connect the coded sequence of the label shown in table 1 and obtain.

The coding nucleotide sequence of described two subunit RgFAS1 and RgFAS2 of oleaginous yeast fatty acid synthase is (such as, Rgfas1 and rgfas2) fall within protection scope of the present invention.

Therefore, the present invention also provides for the nucleotide sequence of the oleaginous yeast fatty acid synthase that a kind of code book is invented.

Preferably, the coding nucleotide sequence of described RgFAS albumen is SEQ ID NO:3 and shown in SEQ ID NO:4 DNA molecular.

Additionally, the coding nucleotide sequence of the biologically active polypeptide fragment (domain) of described RgFAS falls within the present invention Protection domain.

Preferably, the coding nucleotide sequence of the biologically active polypeptide fragment (domain) of described RgFAS is SEQ ID DNA molecular shown in NOs:5-13.

Further, recombinant expression carrier, expression cassette, transgenic cell line or the weight containing nucleotide sequence of the present invention Group bacterial strain belongs to protection scope of the present invention.

Therefore, the present invention also provides for comprising the expression of the nucleotide sequence of the oleaginous yeast fatty acid synthase of code book invention Box or recombinant vector, preferably recombinant expression carrier；There is provided importing (such as, by converting or rotaring dyeing technology importing) described heavy The reconstitution cell of group carrier.

It should be appreciated by those skilled in the art that and will encode the nucleotide sequence of oleaginous yeast fatty acid synthase or comprise coding The recombinant vector of the nucleotide sequence of oleaginous yeast fatty acid synthase imports host cell can be according to the ordinary skill in the art Carry out, for example, it is possible to carry out by converting, transfect the routine techniques such as (such as, agriculture bacillus mediated transfection) or electroporation.

Available existing basidiomycetes expression vector and saccharomyces cerevisiae expression build containing described coding nucleotide sequence The restructuring table of (such as, rgfas1 and/or rgfas2, RgFAS biologically active polypeptide fragment (domain) coding nucleotide sequence) Reach carrier.

Described basidiomycetes expression vector includes gene recombined vector that agrobacterium tumefaciens mediates and to can be used for basidiomycetes micro- The carrier etc. of bullet bombardment.Described basidiomycetes expression vector also can comprise 3 ' end untranslated regions of exogenous gene, i.e. comprises poly- Adenylic acid signal and any other participate in mRNA processing or the DNA fragmentation of gene expression.Described polyadenylation signals can guide Polyadenylic acid joins 3 ' ends of mRNA precursor, if Agrobacterium crown gall nodule induction (Ti) plasmid gene is (such as kermes synzyme Nos base Cause), the untranslated region transcribed of rhodotorula glutinis gene (such as the G3PDH gene of R.glutinis) 3 ' end be respectively provided with similar functions.Institute The saccharomyces cerevisiae expression stated includes that saccharomyces cerevisiae sequestered expression vector (carries 2 μm replicon or autonomous replication sequences (ARS) the existing universal support, can bought voluntarily such as pYX212, pYES2C/T etc.) and integrated expression vector (carry integration position Point gene restructuring arm).

Use rgfas1 and/or rgfas2 or RgFAS biologically active polypeptide fragment (domain) coding nucleotide sequence structure When building recombinant yeast expression vector, can start plus any inducible promoter or composing type before its initiation nucleotide Son, such as glyceraldehyde 3-phosphate dehydrogenase promoter pG3PDH, galactose evoked promoter pGal10, promoter can be used alone or It is used in combination with other promoter.

It should be appreciated by those skilled in the art that the nucleotide of the oleaginous yeast fatty acid synthase invented for the ease of code book Sequence expression in host cell, depends on selected host cell strain, can be suitably to described nucleotide sequence Carry out codon optimized；For the ease of transgenic cell line or recombinant bacterial strain being identified and screening, used carrier can be entered Row is modified, and produces enzyme (such as green fluorescent protein) or the luminescence of color change as introduced the coding can expressed in yeast cells The gene (such as gus gene, luciferase gene etc.) of compound, there is the antibiotic marker genes of resistance (such as kanamycin mark Note gene, bleomycin marker gene, hpt marker gene) or anti-chemical reagent marker gene (such as anti-herbicide gene), And nutrition riddled basins (such as LEU2, URA3) etc.；For the ease of purification, can be at 5 ' ends of described nucleotide sequence And/or 3 ' end connect purification tag coded sequence.

It is a further object to provide a kind of method building grease production reconstitution cell, described method include by Nucleotide sequence or its active fragment of the oleaginous yeast fatty acid synthase of code book invention import in host cell, obtain oils and fats Produce reconstitution cell, or nucleotide sequence or its active fragment of the oleaginous yeast fatty acid synthase of code book invention will be comprised Expression cassette or recombinant expression carrier import in host cell, obtain grease production reconstitution cell.Wherein said host cell is excellent Select yeast cells.

Utilize any one can start the carrier that exogenous gene is expressed in saccharomyces cerevisiae, by provided by the present invention Rgfas1 and/or rgfas2 or RgFAS biologically active polypeptide fragment (domain) coding nucleotide sequence import in yeast cells, Obtain grease production recombinant yeast cell.In a preferred embodiment, any one is utilized can to start exogenous gene The carrier expressed in rhodotorula glutinis, increases rgfas1 and/or rgfas2 provided by the present invention or RgFAS biologically active polypeptide The copy number of fragment (domain) coding nucleotide sequence, obtains recombinant paramyxovirus Rhodothece glutinis.

It is demonstrated experimentally that the oleaginous yeast fatty acid synthase of present invention offer and encoding gene thereof are remarkably improved reconstitution cell Fat content.

In sum, the present invention provides following:

1. an oleaginous yeast fatty acid synthase, it is made up of RgFAS1 subunit and RgFAS2 subunit, wherein said RgFAS1 subunit is the protein of following (a) or (b):

A protein that () is made up of the aminoacid sequence shown in SEQ ID NO:1；

B the aminoacid of SEQ ID NO:1 is passed through one or several amino acid whose replacement and/or disappearance and/or interpolation by () And with there is the protein derived by SEQ ID NO:1 of fatty acid synthase subunit 1 (RgFAS1) function；

Described RgFAS2 subunit is the protein of following (c) or (d):

C protein that () is made up of the aminoacid sequence shown in SEQ ID NO:2；

D the aminoacid of SEQ ID NO:2 is passed through one or several amino acid whose replacement and/or disappearance and/or interpolation by () And with there is the protein derived by SEQ ID NO:2 of fatty acid synthase subunit 2 (RgFAS2) function.

2., according to the 1st described oleaginous yeast fatty acid synthase, the aminoacid sequence of wherein said RgFAS1 subunit is SEQ ID NO:1, the aminoacid sequence of described RgFAS2 subunit is SEQ ID NO:2.

3. derive from biologically active polypeptide fragment or the domain of the 1st described oleaginous yeast fatty acid synthase, The aminoacid sequence of described polypeptide fragment or domain is any one in following fragment or any two or more The combination of individual fragment:

The position 190-599 of SEQ ID NO:1,

The position 611-1142 of SEQ ID NO:1,

The position 60-490 of SEQ ID NO:2,

The position 493-885 of SEQ ID NO:2,

The position 1021-1186 of SEQ ID NO:2,

The position 1212-1378 of SEQ ID NO:2,

The position 1725-1983 of SEQ ID NO:2,

The position 2066-2716 of SEQ ID NO:2, and

The position 2815-2926 of SEQ ID NO:2.

4., according to biologically active polypeptide fragment or the domain of the 3rd described oleaginous yeast fatty acid synthase, it is biological Activity selected from single acyl/Acetylase (AT) activity, enoyl-ACP reductase (ER) activity, dehydratase (DH) activity, malonyl/ Palmitoyl transferase (MPT) activity, the first acyl carrier protein (ACP) activity, the second acyl carrier protein (ACP) activity, ketone Acyl reductase (KR) activity, ketone ester-acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) are lived Any one or any two in property or more kinds of combinations.

5. encode the nucleotide sequence of the 1st described oleaginous yeast fatty acid synthase.

6., according to the 5th described nucleotide sequence, the RgFAS1 wherein encoding described oleaginous yeast fatty acid synthase is sub- The nucleotides sequence of base is classified as SEQ ID NO:3；Encode the nucleotides sequence of the RgFAS2 subunit of described oleaginous yeast fatty acid synthase It is classified as SEQ ID NO:4.

7. encode biologically active polypeptide fragment or the nucleotide of domain of the 3rd described oleaginous yeast fatty acid synthase Sequence, its any one or any two in the following nucleotide sequence or the combination of more sequence:

(a) nucleotide sequence as shown in SEQ ID NO:5, the AT domain of its coding RgFAS1 subunit；

(b) nucleotide sequence as shown in SEQ ID NO:6, the ER domain of its coding RgFAS1 subunit；

(c) nucleotide sequence as shown in SEQ ID NO:7, the DH domain of its coding RgFAS2 subunit；

(d) nucleotide sequence as shown in SEQ ID NO:8, the MPT domain of its coding RgFAS2 subunit；

(e) nucleotide sequence as shown in SEQ ID NO:9, an ACP domain of its coding RgFAS2 subunit；

(f) nucleotide sequence as shown in SEQ ID NO:10, the 2nd ACP domain of its coding RgFAS2 subunit；

(g) nucleotide sequence as shown in SEQ ID NO:11, the KR domain of its coding RgFAS2 subunit；

(h) nucleotide sequence as shown in SEQ ID NO:12, the KS domain of its coding RgFAS2 subunit；

(i) nucleotide sequence as shown in SEQ ID NO:13, the PPT domain of its coding RgFAS2 subunit.

8. contain expression cassette or the recombinant expression carrier of nucleotide sequence in any of the one of 5-7 item.

9. contain the cell of nucleotide sequence in any of the one of 5-7 item.

10. the method building grease production reconstitution cell, described method includes in any of the one of 3-7 item Nucleotide sequence or the expression cassette of the 8th or recombinant expression carrier import in host cell, obtain grease production restructuring thin Born of the same parents.

Accompanying drawing explanation

Fig. 1 is the domain ratio of components relatively analysis chart of RgFAS and other extraordinary source FAS.

Fig. 2 is rgfas1 and rgfas2 gene RT-PCR amplification, swimming lane 1, rgfas2；Swimming lane 2, rgfas1.Amplification Band bases longs is respectively 8.8kb and 3.8kb.

Fig. 3 is the collection of illustrative plates of the RgFAS prokaryotic expression plasmid pACYC-RgFAS1+2 built.

Fig. 4 is that the SDS-PAGE of RgFAS prokaryotic expression product analyzes.M: Protein Marker；C: induction thalline is the thinnest Born of the same parents；S: induction cellular lysate liquid supernatant；P: induction cellular lysate liquid precipitate.

Fig. 5 is the SDS-PAGE after the PPT domain of RgFAS and ACP domain prokaryotic expression product Ni post affinity purification Analyze.

Fig. 6 is that PPT domain catalyzing acyl carrier protein (ACP) occurs 4 '-phosphopantetheine to modify Tricine-SDS-PAGE analyzes.The GST-PPT of purification can be catalyzed GST-ACP and occur 4 '-phosphopantetheine to modify, Increase 340Dalton owing to ACP is modified rear molecular weight, can be coagulated at 16% polyacrylamide by Tricine-SDS-PAGE Apo-ACP and Holo-ACP is separated on glue.Fig. 6 A be GST-ACP1, Fig. 6 B be GST-ACP2.

Fig. 7 is the module assembled strategy schematic diagram of the Yeast expression carrier structure of RgFAS.

Fig. 8 is RgFAS expression plasmid of yeast collection of illustrative plates.

Detailed description of the invention

Following example facilitate a better understanding of the present invention, but limit and the brightest.The scope of the present invention is wanted by right Ask and equivalents limits.

Experimental technique in following embodiment, if no special instructions, is conventional method.Reality used in following embodiment Test material, if no special instructions, be and be commercially available from routine biochemistry Reagent Company.

R.glutiniin CGMCC2.107: purchased from China General Microbiological preservation administrative center (CGMCC), by money river wine Essence factory separates, the separatrix Huanghai Sea 107, Huanghai Sea chemical industry study society and be committed to CGMCC.

R.glutinis ATCC204091: purchased from American type culture collection (ATCC), is isolatable from India's soil Earth, is committed to ATCC by NK Yadav.

Culture medium prescription involved in following example and purposes are as follows:

(1) YEPD culture medium: yeast powder 10g/L, peptone 10g/L, glucose 20g/L, pH6.0, solid medium is then Add agar powder 15g/L；For strain activation and culture, seed liquor preparation and strain short term storage.

(2) limit nitrogen culture medium: glucose 70g/L, yeast powder 0.75g/L, (NH₄)₂SO₄0.1g/L, KH₂PO₄1.0g/L, MgSO₄·7H₂O1.5g/L, pH5.6, and add trace element liquid (the 4.0g/L CaC1 of 1% (V/V)₂·2H₂O, 0.55g/ L FeSO₄·7H₂O, 0.52g/L citric acid H₂O, 0.10g/L ZnSO₄·7H₂O, 0.076g/L MnSO₄·H₂O With 100 μ l18M H₂SO₄), for bacterial strain oil and fat accumulation with rich in the cultivation of oils and fats thalline.

(3) non-limit nitrogen artificial synthetic medium (being abbreviated as MM): glucose 25g/L, (NH₄)₂SO₄5g/L, MgSO₄· 7H₂O0.5g/L, KH₂PO₄3g/L), for eutrophy chemostat cultivation and the differential transcription group credit analysis thalline sample of rhodotorula glutinis The preparation of product.

(4) limit nitrogen manually closes culture medium (be called for short MM-N): glucose 25g/L, (NH₄)₂SO₄0.2g/L, MgSO₄· 7H₂O0.5g/L, KH₂PO₄3g/L, K₂SO₄6.3g/l, for limit nitrogen chemostat cultivation and the differential transcription group credit of rhodotorula glutinis The preparation of analysis thalline sample.

Embodiment 1: the discovery of rhodotorula glutinis fatty acid synthase

R.glutinis ATCC204091 recovers on YEPD solid medium, is inverted for 30 DEG C and cultivates 48h, chooses single bacterium colony Being inoculated in 50ml YEPD fluid medium (dress liquid is in the triangular flask of 250ml capacity), 30 DEG C, 200rpm cultivates 28h.Culture fluid Transferring in the 2L continuous fermentation tank (working volume 1.7L) of automatic feeding with 1: 50 (V/V) ratio respectively, culture medium is respectively MM And MM-N.Chemostat cultivation temperature is 30 DEG C, and pH is controlled automatically at 5.6 by dropping 10.0M NaOH or 2M HCl, and rotating speed keeps For 600rpm, Ventilation Rate is 100L/h (about 0.98VVM), and dissolved oxygen remains 85% saturated, and dilution rate is 0.085.About 10 Sampling after working volume, sample is through 4 DEG C, and 8000rpm is centrifuged 5min and collects, and every 45ml culture can collect the wet bacterium of about 0.7g Body, MM and MM-N thalline sample quick-freezing in liquid nitrogen the most immediately ,-70 DEG C of preservations.The transport of dry ice cryopreservation is (complete to Hua Da gene Name: Shenzhen, Beijing Liuhe Huada Genomics Technology Co., Ltd branch company) carry out R.glutinis in limit nitrogen and the training of non-limit nitrogen Transcript profile order-checking under the conditions of Yanging.Leaving and taking and carry out intracellular Oil Content Analysis with batch thalline sample, culture supernatant is divided for residual nitrogen Analysis [Hongwei Shen, Jin Guojie, Hu Cuimin, Gong Zhiwei, Bai Fengwu, Zhao Zongbao. biological engineering journal 2012,28 (1), 57-65].

Use liquid nitrogen grinding-RNAiso method to extract total serum IgE, use Agilent2100Bioanalyzer detection sample complete Property qualified after carry out again next step make.The preparation of RNA-seq sample uses mRNA-Seq8Sample Preparation Kit (Illumina, San Diego, CA USA), concrete steps reference product operation instruction.In simple terms, at least 10ug's is total RNA, obtains mRNA, mRNA through oligo (dT) magnetic beads for purifying after DNase I (RNase free) digests and uses bivalent cation After Buffer carries out random fragmentation process, random hexamers reverse transcription synthesizes the first chain cDNA, use RNase H and DNA polymerase I synthesizes the second chain cDNA, end reparation and add after A processes and connect joint sequence, the Agarose of 2% Gel reclaims the fragment of 300bp, and the PCR of 15 circulations amplifies connection product, and PCR primer is through Agilent2100Bioanalyzer Checking concentration is more than 0.34nM, and total amount is more than 3.23pmol, and library inserts length range is in the range of 200 ± 10%. Sample obtains double end sequences of 90bp through Illumina HiSeq2000 order-checking.The sequence information obtained, uses SOAP Denovo software carries out assembly from the beginning and obtains Unigene sequence, then these Unigene are carried out function annotation [Li R, Zhu H, Ruan J, Qian W, Fang X, Shi Z, Li Y, Li S, Shan G, Kristiansen K, Li S, Yang H, Wang J, Wang J.Genome Res.2010,20 (2), 265-272.].MM-N sample carries out the sequence letter of RNA-seq acquisition Breath, uses SOAP denovo software to carry out from the beginning assembly and there are 350 complete Unigene sequences, wherein more than 3000bp Unigene sequence have two, carry out Blastp analysis according to the amino acid sequence information deduced, find these two The fatty acid synthase Beta subunit that protein coded by Unigene is originated with Laccaria bicolor S238N-H82 respectively It is 55% and 62% with alpha subunit homology.Protein coded by these two Unigene is respectively designated as rhodotorula glutinis Fatty acid synthase subunit 1 (RgFAS1) and rhodotorula glutinis fatty acid synthase subunit 2 (RgFAS2).Meanwhile, Blastp analyzes discovery, One protein sequence being assumed to fatty acid synthase in RgFAS1 Yu Rhodotorula glutinis ATCC204091 source (EGU11303.1) maximum comparability reaches 99%, but the N end that EGU11303.1 is than RgFAS1 has more 36AA (total length 1302AA), According to the present embodiment result, thus it is speculated that its EGU11303.1 prediction error.Have not seen EGU11303.1 corresponding encoded nucleotide sequence Report.

RgFAS1 is made up of 1266 amino acid residues, molecular weight 137kDa, and theoretical isoelectric point, IP is 6.2；There is no signal peptide Mark, for endocellular enzyme；Belong to yeast fatty acid synthase [EC2.3.1.86]；RgFAS1 domain composition and ascus yeast fat Acid synthase difference is relatively big, only containing single acyl/Acetylase (AT), two domains of enoyl-ACP reductase (ER), and ascus yeast Fatty acid synthase also carries dehydratase (DH) and malonyl/palmitoyl transferase (MPT) domain (Fig. 1).

RgFAS2 is made up of 2928 amino acid residues, molecular weight 318kDa；Theoretical isoelectric point, IP is 6.65；There is no signal peptide Mark, for endocellular enzyme；Belong to yeast fatty acid synthase [EC2.3.1.86]；RgFAS2 domain composition and ascus yeast fat Acid synthase difference is relatively big, except containing ketoacyl reductase (KR), ketone ester-acyl ACP synthase (KS) and phosphopantetheine The apokoinou construction of the products of typical yeast fatty acid synthase alpha subunits such as based transferase (PPT) is overseas, also carry dehydratase (DH), First acyl carrier protein (ACP) of malonyl/palmitoyl transferase (MPT) and tandem and the second acyl carrier egg (ACP) domain in vain, the first two domain is on the beta subunit of other yeast fatty acid synthase, and double ACP of tandem tie Structure territory (2 × ACP) is then that RgFAS2 is specific (Fig. 1).

The encoding gene of RgFAS1 and RgFAS2 is respectively designated as the mRNA sequence of rgfas1 and rgfas2, rgfas1 such as Shown in SEQ ID NO:3, the mRNA sequence of rgfas2 is as shown in SEQ ID NO:4.

Embodiment 2: rhodotorula glutinis rgfas1 and the clone of rgfas2 gene

Nucleotide sequence design gene-specific primer according to rgfas1 and rgfas2 is as follows:

Rgfas1-Fw:atgaacggccgagcgacgcggagcgtg

Rgfas1-Rv:tcagaggccgccgaaaacgtcgagcttgag

Rgfas2-Fw:atggttgcggcgcaggagttgccgcttgcg

Rgfas2-Rv:ctacttctgggcaatgacaacggcgcaagc

Liquid nitrogen grinding is utilized to add RNaiso method [Yang F, Tan HD, Zhou YJ, Lin XP, Zhang SF.Mol.Biotechnol.2010,47 (2): 144-151] extract R.toruloides CGMCC2.1389 total serum IgE.RNA enters Row 1.5% agarose gel electrophoresis, uses fluorescence-uv analyzer to observe and identifies, it is seen that two band clearly.By ultraviolet/can See that photothermal spectroscopic analyzer analyzes total serum IgE sample, record OD260/OD280=1.9, show that total serum IgE quality is fine.Total serum IgE sample is frozen Standby in-80 DEG C.

High Fidelity PrimeScript RT-PCR Kit (purchased from Takara) is utilized to synthesize cDNA the first chain.20 μ l reaction system, first, by 2 μ l total serum IgE (～1 μ g), Oligo (dT) and Random6mer) each 100nM, at 2.0 μ l DEPC Reason water (pyrocarbonic acid diethyl ester processes water, purchased from Dalian TaKaRa company), joins in PCR pipe and mixes, be incubated 5min in 65 DEG C, Being immediately placed on cooled on ice 2min, (High Fidelity PrimeScript RT-PCR Kit carries reverse transcription to add enzyme Mix Enzyme, purchased from Takara), DEPC processes water polishing 20 μ l, 42 DEG C of 30min and carries out reverse transcription, 70 DEG C of 15min inactivators.

With reverse transcription synthesis cDNA the first chain as template, carry out rgfas1 and rgfas2 gene PCR amplification, 5 × PCR Buffer (TakaRa) 10.0 μ l, dNTPs (10mM, TaKaRa) 1.0 μ l, primer rgfas1-Fw (/rgfas2-Fw) (50mM) 1.0 μ ls each with rgfas1-Rv (/rgfas2-Rv) (50mM), PrimeSTar (Dalian TakaRa) 0.5 μ l, the cDNA of synthesis One chain template 1.0 μ l, ddH₂O polishing, to 50 μ l, is incubated 3min in 94 DEG C, and then in 98 DEG C of 10s, 68 DEG C of 5min (are used for expanding Rgfas1) or 9min (being used for expanding rgfas2), 30 circulations, add Taq DNA polymerase (TakaRa) 1.0 μ l afterwards and enter 3 ' ends of row amplified production add A, 72 DEG C of 20min, and 4 DEG C are terminated reaction.Amplified production carries out 0.8% (mass/volume concentration) Agarose gel electrophoresis, can be observed the band of two expection sizes of 3.8kb (rgfas1) and 8.8kb (rgfas2) left and right (Fig. 2), DNA is utilized to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier's proposed steps (NEP013-2 description) purified pcr product.Method (D102A description) clone that PCR primer provides with reference to TaKaRa company To pMD19-T carrier, it is transformed into E.coli DH5 α competent cell, selects Amp resistant transformants and carry out Zengjing Granule, plasmid Extract (green skies plasmid Mini Kit, article No.: D0003).Recombiant plasmid sample delivers to the order-checking of TaKaRa company, order-checking Result shows, the nucleotide sequence expanded to is respectively SEQ ID NO:3 and SEQ ID NO:4, is separately encoded aminoacid sequence It is classified as SEQ ID NO:1 and the protein of SEQ ID NO:2.By the named RgFAS1 of albumen shown in SEQ ID NO:1, general gram The grand Nucleotide designation shown in SEQ ID NO:3 obtained is rgfas1；By named for the albumen shown in SEQ ID NO:2 RgFAS2, the Nucleotide designation shown in SEQ ID NO:4 obtained by clone is rgfas2.Positive recombiant plasmid is respectively designated as PMD19T-RgFAS1 and pMD19T-RgFAS2.

RgFAS1 domain composition and ascus yeast fatty acid synthase beta subunit difference are relatively big, the only knot Han AT and ER two Structure territory, and ascus yeast fatty acid synthase also carries DH and MPT domain (Fig. 1).The domain composition of RgFAS2 and ascus Yeast fatty acid synthase alpha subunit difference is relatively big, except containing KR), the products of typical yeast fatty acid synthase alpha subunit such as KS and PPT Apokoinou construction overseas, also carry first acyl carrier protein (ACP) of DH, MPT and tandem and the second acyl group carry Body protein (ACP) domain, double ACP domains (2 × ACP) of this tandem are that RgFAS2 is specific (Fig. 1).

Embodiment 3: the prokaryotic expression of rhodotorula glutinis fatty acid synthase, protein purification and recombinant bacterial strain oil-producing performance evaluation

Primer (lower stroke of primer rgfas1-NcoI-F of corresponding restriction enzyme site is added according to the design of rgfas1 nucleotide sequence Line part is NcoI restriction enzyme site, and the underscore part of primer rgfas1-HindIII-R is HindIII restriction enzyme site), sequence As follows:

Rgfas1-NcoI-F:ctctccatggatgaacggccgagcgacgcggagcgtg

Rgfas1-HindIII-R:tctaagctttcagaggccgccgaaaacgtcgagcttgag

Primer (lower stroke of primer rgfas2-NdeI-F of corresponding restriction enzyme site is added according to the design of rgfas2 nucleotide sequence Line part is NdeI restriction enzyme site, and the underscore part of primer rgfas2-AvrII-R is AvrII restriction enzyme site), sequence is as follows:

Rgfas2-NdeI-F:ctctcatatggttgcggcgcaggagttgccgcttgcg

Rgfas2-AvrII-R:tctcctaggctacttctgggcaatgacaacggcgcaagc

With previous cloning vehicle pMD19T-RgFAS1 and pMD19T-RgFAS2 built as template, utilize two to primer Rgfas1-NcoI-F/rgfas1-HindIII-R and rgfas2-NdeI-F/rgfas2-AvrII-R expand respectively rgfas1 and Rgfas2 coding region sequence.The pcr amplification product of rgfas1, through NcoI/HindIII double digestion, is connected into same double digestion PACYCDuet-1 (dual-expression vector, purchased from Novagen) carrier (reclaims enzyme action large fragment to be used for connecting), Transformed E .coli DH5a Competent cell, through the named pACYC-of recombiant plasmid that NcoI/HindIII double digestion and sequence verification are correct RgFAS1.The pcr amplification product of rgfas2, through NdeI/AvrII double digestion, is connected into the structure of same NdeI/AvrII double digestion PACYC-RgFAS1 carrier (reclaim enzyme action large fragment be used for connecting), Transformed E .coli DH5a Competent cell, warp The named pACYC-RgFAS1+2 of recombiant plasmid that NcoI/HindIII and NdeI/AvrII enzyme action is correct with order-checking double verification. (Fig. 3).

By pACYC-RgFAS1+2 Plastid transformation E.coli Bl21 (DE3) host, obtain expression strain BL21/pACYC- RgFAS1+2.Choose single colony inoculation in 10ml Chl-LB culture medium (tryptone 10g/l, yeast powder 5g/l, NaCl10g/l, And the μ g/ml in chloromycetin 30), cultivate 4-6h to OD for 37 DEG C_600nmFor 0.6-0.8, add final concentration of 0.1mM IPTG and lure Lead, 30 DEG C of overnight incubation.After abduction delivering terminates, taking 10ml bacterium solution, in 4 DEG C, 8000rpm is centrifuged 5min and collects thalline, thalline Precipitate with 200 μ l NBP buffer (50mM Na₂HPO₄/NaH₂PO₄, pH=8.0,0.5M NaCl, 20mM imidazoles, 1mM Beta-mercaptoethanol, 1mM PMSF) in, (power is for ice bath, ultra-fine probe to utilize sonioation method to extract soluble protein 60W, pulse 2s, intermittently 2s, total time 1min), become clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, it is solvable for taking supernatant Property protein part, utilizes the resuspended precipitation of isopyknic lysis buffer；Utilize the expression (10% of SDS-PAGE analyzing proteins Acrylamide gel).Result as shown in Figure 4, under 0.1mM IPTG inductive condition, restructuring RgFAS two subunit RgFAS1 and RgFAS2 almost complete soluble-expression, the molecular weight of restructuring RgFAS1 is about 138kDa, and (RgFAS1 theoretical molecular is 137kDa, (Strep-tagII) the rear fusion protein molecular weight that tags is 138kDa)；The molecular weight of restructuring RgFAS2 is about 319kDa (RgFAS2 theoretical molecular is 318kDa, and (6 × His) the rear fusion protein molecular weight that tags is 319kDa).

Restructuring RgFAS2 subunit carries 6 × His Tag, due to the protein-interacting between RgFAS2 and RgFAS1 subunit, Available nickel affinity chromatography one step purification of Recombinant RgFAS2 and restructuring two subunits of RgFAS1.Protein purification procedures according to Invitrogen Ni-NTA purification system teachings is carried out, and with nickel ion as affine ion, relies on miaow Azoles Concentraton gradient (30-100mM imidazoles) eluting destination protein.BL21/pACYC-RgFAS1+2 carries out 1000ml volume induction table Reach (1000ml Chl-LB culture medium (tryptone 10g/l, yeast powder 5g/l, NaCl10g/l, and the μ g/ml in chloromycetin 30), 37 DEG C are cultivated 4-6h to OD is 0.5-0.8, adds final concentration of 1mM IPTG and induces, 30 DEG C of overnight incubation), centrifugal collection Thalline, adds 50ml NBP buffer (50mM Na₂HPO₄/NaH₂PO₄, pH=8.0,0.5M NaCl, 20mM imidazoles, 1mM Beta-mercaptoethanol, 1mM PMSF) in, sonioation method extracts soluble protein, and (ice bath, power is 60W, pulse 2s, intermittently 3s, total time 30min), become clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, take supernatant soluble protein, utilize 0.22 μ After the low protein bound membrane filtration of m, loading to nickel affinity chromatography post (volume 10ml), stand and combine 15min, use the most successively Lavation buffer solution containing 20mM, 40mM, 60mM and 80mM imidazoles (the 50mM Na of 20 times of column volumes₂HPO₄/NaH₂PO₄, pH= 8.0,0.5M NaCl, 1mM beta-mercaptoethanol, the imidazoles of respective concentration) wash successively, finally with washing containing 250mM imidazoles De-buffer (50mM Na₂HPO₄/NaH₂PO₄, pH=8.0,0.5M NaCl, 1mM beta-mercaptoethanol, 250mM imidazoles) wash De-destination protein.All purification process are all carried out at 4 DEG C, and ensure all of relevant buffers of pre-cooling.The albumen that purification obtains It is stored in 20% glycerol ,-70 DEG C of preservations after subpackage.Purity of protein is analyzed by SDS-PAGE (10% acrylamide gel), Result shows, in elution fraction, restructuring RgFAS1 subunit and RgFAS2 subunit purity are all higher than 90%.

By recombination bacillus coli BL21/pACYC-RgFAS1+2 inoculation M9-N culture medium, (M9 limits nitrogen culture medium: 2% Fructus Vitis viniferae Sugar, 0.6%Na₂HPO₄, 0.3%KH₂PO₄, 0.05%NaCl, 1mM MgSO₄, 0.1mM CaCl₂, 0.1% (v/v) 1000 × micro- Secondary element mixed liquor；1000 × trace element mixed liquor composition: 2.7%FeCl₃·6H₂O, 0.2%ZnCl₂·4H₂O, 0.2% CaCl₂·2H₂O, 0.2%Na₂MoO₄·2H₂O, 1.9%CuSO₄·5H₂O, 0.5%H₃BO₃), 37 DEG C, 200rpm shaken cultivation 24h, every 6h sample, stay do Oil Content Analysis [Rude M A, Schirmer A.Curr.Opin.Microbiol.2009, 12,274-281].It was found that during fermentation termination, compared with control strain BL21/pACYC Duet-1, BL21/pACYC- RgFAS1+2 intracellular fat content is increased to 19.2% by 10%, it is seen then that intracellular fat content improves 92%.Prove RgFAS1 Recombination bacillus coli oil and fat accumulation can be promoted with RgFAS2 gene co-expressing, increase its intracellular fat content.

The prokaryotic expression of embodiment 4:RgFAS domain PPT, ACP and protein purification

The prokaryotic expression of step one RgFAS domain PPT, ACP and protein purification

RF is utilized to clone [Van den Ent F, Lowe J.J.Biochem.Biophys.Methods2006,67,67- 74] [Yang F, Zhang S, Tang W, Zhao Z.Yeast2008.25 (9): 623-630] method builds RgFAS domain The prokaryotic expression carrier of PPT, ACP.PPT domain, ACPI domain and the encoding gene of ACPII domain according to RgFAS The nucleotide sequence following RF cloning primer of design:

41-GST-ACPI-F:

TGGTGGCTCCGGTGATGACGACGACAAGgtcgccgacgagccgctcaagg

41-GST-ACPI-R:

ATTAGTGGTGGTGGTGGTGGTGGTGGTGgagcgagatgccagccatcgagg

41-GST-ACPII-F:

TGGTGGCTCCGGTGATGACGACGACAAGgtccccgacgagccgctcaagg

41-GST-ACPII-R:

ATTAGTGGTGGTGGTGGTGGTGGTGGTGgagggtaatgccagcctgcgag

41-GST-PPT-F:

GGTGGCTCCGGTGATGACGACGACAAGggtgctttcggcgtcggcacg

41-GST-PPT-R:

ATTAGTGGTGGTGGTGGTGGTGGTGGTGcttctgggcgatgacgacggcg

1, RFI reaction: 5 × PrimeSTAR Buffer (TakaRa) 10.0 μ l, dNTPs (10mM, TaKaRa) 1.0 μ l, The each 1.0 μ l of ACPI primer 41-GST-ACPI-F and 41-GST-ACPI-R (or ACPII primer 41-GST-ACPII-F and 41- GST-ACPII-R, or PPT primer 41-GST-PPT-F and 41-GST-PPT-R, each 1.0 μ l, equal 10mM), PrimeSTAR (TakaRa) 0.5 μ l, the pMD19T-RgFAS2 carrier built in embodiment 3 is as template (50ng/ μ l) 2.0 μ l, ddH₂O mends Together to 50 μ l, it is incubated 3min, then in 98 DEG C of 10s, 62 DEG C of 10s, 72 DEG C of 1min in 94 DEG C, 30 circulations, then 72 DEG C of 10min, 4 DEG C terminate reaction.Amplified production carries out 1.2% (mass/volume concentration) agarose gel electrophoresis, it was observed that the mesh of expection size Band (band expection size 0.33kb that the band expection size of ACPI and ACPII mesh is about 0.5kb, PPT mesh is left Right), utilize DNA to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier's proposed steps (NEP013-2 description) purified pcr product.

2, RFII reaction: template pET41a plasmid DNA (purchased from Novagen, 100ng/ μ l) 1 μ l, (RFI is anti-for above-mentioned steps 1 Should) product 8 μ l (about 600ng), 5 × PrimeSTAR Buffer (TaKaRa) 10.0 μ l, dNTPs (10mM, TaKaRa) 1.0 μ L, PrimeSTAR (TakaRa) 0.5 μ l, ddH₂O polishing is to 50 μ l, in 95 DEG C of denaturations 3min, and 95 DEG C of 1min, 55 DEG C of 1min, 68 DEG C of 7min, 25 circulations, 4 DEG C are terminated reaction, obtain RFII product (that is, the notched insertion purpose base of about about 6.6kb Recombiant plasmid because of fragment).

3, the PCR primer of above-mentioned steps 2 (RFII reaction) with DpnI (purchased from New England Biolabs) 1 μ l in 37 DEG C digestion 1h, remove methylated template plasmid DNA, take 5 μ l electroporated E.coli DH5 α competent cell [molecular cloning The experiment guide third edition, Pehanorm Brooker writes, and yellow training hall etc. is translated, and Science Press publishes], electroporated parameter: 2200- 2500V, 400 Ω, 25 μ F.Select Amp resistant transformants and carry out Zengjing Granule, plasmid extraction and sequencing analysis [Van den Ent F, Lowe J.J.Biochem.Biophys.Methods2006,67,67-74].The correct recombiant plasmid built is respectively designated as PET41a-ACP1, pET41a-ACP2 and pET41a-PPT.

4, pET41a-ACP1, pET41a-ACP2 and pET41a-PPT recombinant vector difference that will build in above-mentioned steps 3 Transformed E .coli Bl21 (DE3) competent cell, obtains expression strain BL21/pET41a-ACP1, BL21/pET41a-ACP2 And BL21/pET41a-PPT.Choose single colony inoculation respectively in 10ml Kan-LB culture medium (tryptone 10g/l, yeast powder 5g/ L, NaCl10g/l, and the μ g/m1 Han kanamycin 50), cultivate 4-6h to OD for 37 DEG C_600nmFor 0.6-0.8, add final concentration of 0.1mM IPTG induces, 30 DEG C of overnight incubation.After abduction delivering terminates, taking 1ml bacterium solution, in 4 DEG C, 8000rpm is centrifuged 5min collects thalline, bacterial sediment with 200 μ l bacteria lysis buffer (100mM Tris-HCl, 20% glycerol, 2mM EDTA, 1.5mM DTT, pH7.5) resuspended, (power is 60W, arteries and veins for ice bath, ultra-fine probe to utilize sonioation method to extract soluble protein Rush 2s, intermittently 2s, total time 1min), become clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, taking supernatant is soluble protein Part, utilizes the resuspended precipitation of isopyknic lysis buffer；Utilize expression (12% (M/V) of SDS-PAGE analyzing proteins Acrylamide gel).Result shows, under 0.1mM IPTG inductive condition, carries RgFAS-ACP1, RgFAS-of GST Tag Tri-recombiant proteins of ACP2 and RgFAS-PPT (being abbreviated as GST-wACP1, GST-wACP2 and GST-wPPT respectively) is the most complete Soluble-expression, molecular weight is respectively 50kDa, 50kDa and 45kDa (reason of RgFAS-ACP1, RgFAS-ACP2 and RgFAS-PPT Opinion molecular weight is respectively 20kDa, 20kDa and 15kDa, and GST label protein molecular weight is 30kDa).

5, protein purification procedures is carried out according to Invitrogen Ni-NTA purification system teachings, With nickel ion as affine ion, rely on imidazole concentration gradient (30-100mM imidazoles) eluting destination protein.BL21/pET41a- ACP1, BL21/pET41a-ACP2 and BL21/pET41a-PPT carry out 1000ml volume abduction delivering (1000ml Kan-respectively LB culture medium (containing kanamycin 50 μ g/ml), 37 DEG C are cultivated 4-6h to OD is 0.6-0.8, adds final concentration of 0.1mM IPTG Induce, 30 DEG C of overnight incubation), centrifugal thalline of collecting, addition 50ml NBP buffer (50mM Na₂HPO₄/NaH₂PO₄, pH =8.0,0.5M NaCl, 20mM imidazoles, 1mM beta-mercaptoethanol, 1mM PMSF) in, sonioation method extracts solubility egg In vain (ice bath, power is 60W, pulse 2s, intermittently 3s, total time 10min), to bacterium solution change clarification；16000 × g, 4 DEG C are centrifuged 10min, takes supernatant soluble protein, and after utilizing the 0.22 low protein bound membrane filtration of μm, loading is to nickel affinity chromatography post (body Long-pending 5ml), stand and combine 15min, delay with the washing containing 20mM, 40mM, 60mM and 80mM imidazoles of 20 times of column volumes the most successively Rush liquid (50mMNa₂HPO₄/NaH₂PO₄, pH=8.0,0.5M NaCl, 1mM beta-mercaptoethanol, the imidazoles of respective concentration) depend on Secondary washing, finally with elution buffer (the 50mM Na containing 250mM imidazoles₂HPO₄/NaH₂PO₄, pH=8.0,0.5M NaCl, 1mM beta-mercaptoethanol, 250mM imidazoles) eluting destination protein.All purification process are all carried out at 4 DEG C, and ensure pre-cooling institute Some relevant buffers.The albumen that purification obtains is stored in 20% glycerol ,-70 DEG C of preservations after subpackage.All purification process All carry out at 4 DEG C, and ensure all of relevant buffers of pre-cooling.The albumen that purification obtains is stored in 20% glycerol, after subpackage -70 DEG C of preservations.Purity of protein is analyzed by SDS-PAGE (12% (M/V) acrylamide gel), and result is as it is shown in figure 5, eluting GST-wACP1, GST-wACP2 and GST-wPPT purity of protein of recombinating in component is all higher than 90%.

6, recombiant protein GST-wACP1, GST-wACP2 and the GST-wPPT after nickel affinity purification uses Millipore Amicon Ultra-15 super filter tube (purchased from Millipore, molecular cut off is 10kD, article No.: UFC201024PL) concentrate egg In vain, and by former elution buffer enzyme reaction buffer solution (20mM Iris-HCl, 100mM NaCl, 100mM KCl, 5mM it are replaced into MgCl₂, 10mM CaCl₂, 1mM beta-mercaptoethanol, 0.5mM DTT, 15% (w/v) glycerol, pH7.5).Operation is pressed UFC201024PL description is carried out, and first protein concentration to the volume of above purification is about 1ml, adds 1ml enzyme reaction buffering Liquid, it is 1ml that recentrifuge is concentrated into volume, is so repeated 3 times, finally by albumen constant volume in 2-3ml enzyme reaction buffer solution, now The imidazoles in elution buffer during nickel affinity purification is reduced to below 10mM.Measuring protein concentration, protein-20 DEG C is protected Deposit.

The 4-phosphopantetheine of ACP domain is modified by step 2 PPT domain

Rhodotorula glutinis fatty acid synthase PPT domain has Phosphopantetheinyl transferase activity, can be catalyzed new Raw ACP (apo-ACP, inactive form) reacts with coenzyme A, generates 3 ', 5 '-adenosine diphosphate (ADP) (3 ', 5 '-ADP) and activation ACP (holo-ACP, by the bonded 4 ' phosphopan tetheines from coenzyme A of phospholipid on the hydroxyl of 36 serine residues Base mercaptoethylmaine).

20 μ g GST-ACP, 2 μ g GST-PPT and 0.3mM CoA (coenzyme A, biological purchased from the raw work in Shanghai) are mixed in 20 μ l Enzyme reaction buffer solution (20mM Tris-HCl, pH=7.5,100mM NaCl, 100mM KCl, 5mM MgCl₂, 10mM CaCl₂, 1mM beta-mercaptoethanol, 0.5mM DTT, 15% (w/v) glycerol) in, 30 DEG C of incubations 3 hours.10-20 DEG C of preservations of μ l sample, For Mass Spectrometric Identification.Remain and 10 μ l samples add 1 μ l (1U/ μ l) enterokinase (enterokinase, biological purchased from raw work), dilute Releasing volume to 12.5 μ l, 25 DEG C are reacted 16 hours, add 48.5 μ l ddH₂O and 20 μ l4 × SDS-PAGE sample buffer (12%SDS (W/V), 6% mercaptoethanol (V/V), 30% glycerol (W/V), 0.05% Coomassie brilliant blue G-250 (Serva), 150mM Tris/HCl (pH7.0)), 50 DEG C of incubation 15min.Take 8 μ l samples and carry out Trcine-SDS-PAGE, gel strength be 16% [H.Nat Protoc.2006,1 (1), 16-22.].Result shows, the GST-PPT of purification can be catalyzed GST-ACP Occur 4 '-phosphopantetheine to modify, increase 340Dalton owing to ACP is modified rear molecular weight, pass through Tricine- SDS-PAGE can separate Apo-ACP and Holo-ACP (Fig. 6) in 16% polyacrylamide gel

Embodiment 5: the eukaryotic expression of rhodotorula glutinis fatty acid synthase and recombinant bacterial strain build

Step one, rhodotorula glutinis fatty acid synthase expression vector pYX212-RgFAS1+2 build

Efficient homologous recombination advantage in utilizing saccharomyces cerevisiae body, based on module assembled strategy [Zhou YJ, Gao W, Rong QX, Jin GJ, Chu HY, Liu WJ, Yang W, Zhu ZW, Li GH, Zhu GF, Huang LQ, Zhao ZK.J.Am.Chem.Soc.2012,134,3234-3241], carry out building with RgFAS's of RgFAS recombinant Saccharomyces cerevisiae bacterial strain Function reasonableness.

[it is purchased from according to RgFAS1 and RgFAS2 coding gene sequence and saccharomyces cerevisiae constitutive expression carrier pYX212 Biovector China plasmid vector strain cell pnca gene preservation center] DNA sequence, design is following for module assembled Primer.Module assembled process is as it is shown in fig. 7, primer sequence information is as shown in table 2.

Primer needed for table 2.pYX212-RgFAS1+2 vector construction

Primer	Another name	Sequence
			TPIp-F	a-F	GAATTGGGGATCTACGTATGGTC
FAS1-TPIp	a-R	CGCGTCGCTCGGCCGTTCATTTTTAGTTTATGTATGTG
			TPIp-FAS1	b-F	CACATACATAAACTAAAAATGAACGGCCGAGCGACGCG
TDH2t-FAS1	b-R	AGTAACTTAAGGAGTTAAATTCAGAGCCCGCCGAAGACGT
			FAS1-TDH2t	c-F	ACGTCTTCGGCGGGCTCTGAATTTAACTCCTTAAGTTACT
FAS2-ADH1t	c-R	CGCCGTCGTCATCGCCCAGAAGTAAGCGAATTTCTTATGATTTATG
			ADH1t-FAS2	c-F’	CATAAATCATAAGAAATTCGCTTACTTCTGGGCGATGACGACGG
FAS2-4304	e-R	AGGACAACTTCGTCTCGCAGCAGGT
			FAS2-4529	f-F	CGGACCCAGTTCCACGACGAGTTG
FAS2-2660	f-R	TCTCGAAGGAGTACGCCGAACGCAT
			FAS2-3021	g-F	CTGGTAGTAGATCTCCTTCTGGTGCTTG
TEF1p-FAS2	g-R	CTAAGTTTTAATTACAAAATGGTCGCGGCGCAGGACTTG

FAS2-TEF1p	h-F	GGCAAGTCCTGCGCCGCGACCATTTTGTAATTAAAACTTAG
			Plasmid-TEF1p	h-R	GGATGTGCTGCAAGGCGATTAATAGCTTCAAAATGTTTCTA
TEF1p-Plasmid	i-F	GTAGAAACATTTTGAAGCTATTAATCGCCTTGCAGCACATCC
			Plasmid	i-R	TGCCGTAAACCACTAAATCGGAACC

1, element obtains.Utilizing TPIp-F and FAS1-TPIp primer, with pYX212 carrier as template, PCR expands phosphoric acid third Sugar isomerase promoter TPI1p genetic fragment (a fragment, Fig. 7, lower same)；Utilize TPIp-FAS1 and TDH2t-FAS1 primer, with The pMD19T-RgFAS1 plasmid built in embodiment 3 is template, PCR amplification RgFAS1 subunit gene fragment (b fragment)；Utilize FAS1-TDH2t and FAS2-ADH1t primer, [sees Zhou YJ, Gao W, Rong QX, Jin GJ, Chu with pYJ35 plasmid HY, Liu WJ, Yang W, Zhu ZW, Li GH, Zhu GF, Huang LQ, Zhao ZK.J.Am.Chem.Soc.2012,134, 3234-3241] it is template, the double terminator genetic fragment (c fragment) of PCR amplifying ADH 1t+THD2t；To utilize FAS1-TDH2t ' And FAS2-ADH1t ' primer, with pYJ35 plasmid [see Zhou YJ, Gao W, Rong QX, Jin GJ, Chu HY, Liu WJ, Yang W, Zhu ZW, Li GH, Zhu GF, Huang LQ, Zhao ZK.J.Am.Chem.Soc.2012,134,3234-3241] For template, the double terminator genetic fragment of PCR amplifying ADH 1t+THD2t (c ' fragment)；ADH1t-FAS2 and FAS2-4304 is utilized to draw Thing, in embodiment 3 build pMD19T-RgFAS2 as template, PCR amplification RgFAS2 C-terminal sequence (e fragment, RgFAS24304-8881)；Utilize FAS2-4529 and FAS2-2660 primer, with the pMD19T-RgFAS2 built in embodiment 3 For template, the PCR amplification RgFAS2 intermediate sequence (f fragment, RgFAS2 (2660-4529)) containing ACP domain；Utilize FAS2- 3021 and TEFlp-FAS2 primers, the pMD19T-RgFAS2 built in embodiment 3 is as template, and the N of PCR amplification RgFAS2 is last Terminal sequence (g fragment, RgFAS269-3201)；Utilize FAS2-TEF1p and Plasmid-TEF1p primer, with pYJ35 plasmid as mould Plate, PCR amplification transcriptional elongation factor 1 promoter TEF1p genetic fragment (h fragment)；Utilize TEF1p-Plasmid (i-F) and Plasmid (i-R) primer, with pYX212 carrier as template, PCR amplification vector homologous recombination arm pieces section (i fragment).

PCR amplification condition is as follows: 5 × PrimeSTAR Buffer (TakaRa) 100.0 μ l, dNTPs (10mM, TaKaRa) 10.0 μ l, forward primer and downstream primer (equal 10mM) 10.0 μ l, PrimeSTAR (TakaRa) 2.5 μ l, template DNA is (all 100ng/ μ l) 5.0 μ l, ddH₂O polishing is to 500 μ l, and 5 PCR pipe of subpackage after mix homogeneously, 100 μ l/ manage；In 94 DEG C of insulations 3min, then in 98 DEG C of 10s, 58 DEG C of 10s, 72 DEG C of 3min, 30 circulations, then 72 DEG C of 10min, 4 DEG C are terminated reaction.PCR primer Carrying out 1% (mass/volume concentration) agarose gel electrophoresis, DNA band is sufficiently separated rear cutout and cuts off coagulating containing target DNA Glue, utilize DNA to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier's proposed steps (NEP013-2 description) above-mentioned PCR primer of purification.

2, module construction.A, b and c fragment after purification by Overlap extension PCR [Bryksin AV, Matsumura I.Biotechniques.2010,48 (6), 463-465.] obtain d module；C ' and e fragment pass through Overlap Extension PCR obtains k module；F fragment the most inherently f module；G, h and i are obtained by Overlap extension PCR To j module.Overlap extension PCR condition is as follows: 5 × PrimeSTAR Buffer (TakaRa) 50.0 μ l, dNTPs (10mM, TaKaRa) 5.0 μ l, each module two ends primer (equal 10mM) 5.0 μ l, PrimeSTAR (TakaRa) 2.0 μ l, each base Because of fragment (equal 100nmol/ μ tl) 2.0 μ l, ddH₂O polishing is to 250 μ l, and 5 PCR pipe of subpackage after mix homogeneously, 50 μ l/ manage；In 94 DEG C of insulations 3min, 72 DEG C of 5min, then in 98 DEG C of 10s, 58 DEG C of 10s, 72 DEG C of 5min, 30 circulations, then 72 DEG C of 10min, 4 DEG C Terminate reaction.PCR primer carries out 1% (mass/volume concentration) agarose gel electrophoresis, and DNA band is sufficiently separated rear cutout and cuts off Containing the gel of target DNA, DNA is utilized to reclaim test kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier Proposed steps (NEP013-2 description) purification above-mentioned Overlap extension PCR primer.

3, module assembled.500ng is used to reclaim after twice double digestion linearisation of EcoRI/XhoI and BamHI/HindIII PYX212 carrier large fragment, and equimolar modular segments, cotransformation S.cerevisiae BY4741 (is purchased from EUROSCARF, genotype: MATa his3 Δ 1leu2 Δ 0met15 Δ 0ura3 Δ 0).Method for transformation is as follows: single yeast Fall to being inoculated in 5ml YPD culture medium (20g/L peptone, 10g/L yeast extract and 20g/L glucose, pH6.0), overnight train Support；Being inoculated in YPD culture medium fresh for 100ml with 1: 50, cultivate about 8h, now OD value is about 1.0-1.2, ice bath 15min； 4 DEG C, 2000 × g is centrifuged 10min and collects thalline, is suspended in the ice-cold ddH of 50ml₂O, 2000 × g are centrifuged 10min centrifugal collection bacterium Body, is then suspended in 1M sorbitol ice-cold for 20ml, and 2000 × g is centrifuged 10min centrifugal collection thalline, to the greatest extent solution, and thalline hangs Floating on the ice-cold sorbitol of 0.5-1.0ml, now OD value is about 100-200.50 μ l electricity turn addition equimolar in competent cell D, k, f, j module DNA and pYX212 carrier large fragment (3 μ g altogether), place 10min on ice, be transferred to ice-cold electric revolving cup In, 1500V photovoltaic conversion, under the conditions of this, the electric shock time is about 5ms, has shocked by electricity and has added the ice-cold sorbitol of 1ml, in 30 DEG C of shaking tables Temperature bath 2h, (0.67%YNB W/O aminoacids but with ammonium sulfate is (without ammonia to be applied to SC-Ura flat board Base acid leaven basic nitrogen source, liquid containing ammonium sulfate, purchased from BD Dific, article No.: 291920), 2% glucose, 0.005% histidine, 0.005% methionine, 0.01% leucine, 2% agar powder), it is inverted for 30 DEG C and cultivates 2 days, flat board occurs transformant.Picking turns Beggar is inoculated in 10ml SC-Ura culture medium (0.67%YNB W/O aminoacids but with ammonium Sulfate (without aminoacid yeast basic nitrogen source, liquid containing ammonium sulfate, purchased from BD Dific, article No.: 291920), 2% glucose, 0.005% histidine, 0.005% methionine, 0.01% leucine), 30 DEG C of 200rpm shaken cultivation 2d, utilize bead breaking cellular wall Plasmid in method rapid extraction yeast, Transformed E .coli DH5a according to a conventional method, it is thus achieved that AMP resistant transformants cultivate after carry Take plasmid [the Molecular Cloning: A Laboratory guide third edition (Pehanorm Brooker writes, and yellow training hall etc. is translated, and Science Press publishes]；Plasmid warp After digestion verification and sequencing analysis, it was demonstrated that be the correct RgFAS Yeast expression carrier built, named pYX212-RgFAS1+2.

Step 2, the structure of single subunit expression carrier pYX212-RgFAS1 and pYX212-RgFAS2

Primer (lower stroke of primer RgFAS1-EcoRI-F of corresponding restriction enzyme site is added according to the design of RgFAS1 nucleotide sequence Line part is EcoRI restriction enzyme site, and the underscore part of primer RgFAS1-HindIII-R is HindIII restriction enzyme site), sequence As follows:

RgFAS1-EcoRI-F:ctctgaattcatgaacggccgagcgacgcggagcgt

RgFAS1-HindIII-R:tctaagctttcagagcccgccgaagacgtcgagct

Primer (lower stroke of primer RgFAS2-EcoRI-F of corresponding restriction enzyme site is added according to the design of RgFAS2 nucleotide sequence Line part is EcoRI restriction enzyme site, and the underscore part of primer RgFAS2-HindIII-R is HindIII restriction enzyme site), sequence As follows:

RgFAS2-EcoRI-F:ctctgaattcatggtcgcggcgcaggacttgccgct

RgFAS2-HindIII-R:tctaagcttctacttctgggcgatgacgacggcgc

With previous cloning vehicle pMD19T-RgFAS1 and pMD19T-RgFAS2 built as template, utilize thing RgFAS1- EcoRI-F/RgFAS2-HindIII-R and RgFAS2-EcoRI-F/RgFAS1-HindIII-R two expands RgFAS1 respectively to drawing With RgFAS2 coding region sequence.The pcr amplification product of RgFAS1 and RgFAS2, through EcoRI/HindIII double digestion, is connected into same PYX212 (purchased from the Biovector China plasmid vector strain cell pnca gene preservation center) carrier of double digestion (reclaims enzyme action Large fragment is used for connecting), Transformed E .coli DH5a Competent cell, through EcoRI/HindIII double digestion and sequence verification Correct recombiant plasmid, is respectively designated as pYX212-RgFAS1 and pYX212-RgFAS2.

Step 3, the structure of RgFAS expression of recombinant yeast bacterial strain

Recombiant plasmid pYX212-RgFAS1 is converted (big by Greifswald, Germany to S.cerevisiae IKY2 Learn (Ernst-Moritz-Arndt-Greifswald) Hans-Joachim Sch ü professor ller bestows, Genotype: MAT α, ura3, leu2, trp1, his3, can1, Δ fas1::LEU2) [see Wenz P, Schwank S, Hoja U, Sch ü ller HJ.Nucleic Acids Res.2001,29 (22), 4625-4632.], pYX212-RgFAS2 is converted extremely S.cerevisiae IKY4 is (by Greifswald, Germany university (Ernst-Moritz-Arndt- Greifswald) Hans-Joachim Sch ü professor ller bestows, genotype: MAT α, ura3, leu2, trp1, his3, Can1, Δ fas2::LEU2) [see Wenz P, Schwank S, Hoja U, Sch ü ller HJ.Nucleic Acids Res.2001,29 (22), 4625-4632.], pYX212-RgFAS1+2 is converted to S.cerevisiae PWY12 (by Germany Ge Laifusi Grindelwald university (Ernst-Moritz-Arndt-Greifswald) Hans-Joachim Sch ü professor ller bestows, genotype: MAT α, ura3, leu2, trpl, his3, canl, Δ fas2::LEU2, Δ fasl:: In HIS3) [see Wenz P, Schwank S, Hoja U, Sch ü ller HJ.Nucleic Acids Res.2001,29 (22), 4625-4632.].

Method for transformation is as follows: S.cerevisiae IKY2, S.cerevisiae IKY4 and S.cerevisiae PWY12 Choose respectively single yeast colony be inoculated in 5ml fatty acids YPD culture medium (20g/L peptone, 10g/L yeast extract and 20g/L glucose, pH6.0, and containing 0.5mM Palmic acid, 0.5mM stearic acid, 1%Tween20), incubated overnight；With 1: 50 inoculation In YPD culture medium (20g/L peptone, 10g/L yeast extract and 20g/L glucose, pH6.0) fresh for 100ml, cultivate extremely OD value is about 0.8-1.0, ice bath 15min；4 DEG C, 2000 × g is centrifuged 10min and collects thalline, is suspended in the ice-cold ddH of 50ml₂O, 2000 × g is centrifuged that 10min is centrifugal collects thalline, is then suspended in 1M sorbitol ice-cold for 20ml, 2000 × g be centrifuged 10min from The heart collects thalline, to the greatest extent solution, and thalline is suspended in the sorbitol that 0.5-1.0ml is ice-cold, and now OD value is about 100-200.50μl Electricity turns addition 0.5-1 μ g plasmid DNA (volume is less than 5 μ l) in competent cell, places 10min on ice, is transferred to ice-cold In electricity revolving cup, 1500V photovoltaic conversion, under the conditions of this, the electric shock time is about 5ms, has shocked by electricity and has added the ice-cold sorbitol of 1ml, in 30 DEG C shaking table temperature bath 2h, is applied to the SC-Ura flat board of corresponding Lacking of nutrition composition [with reference to Wenz P, Schwank S, Hoja U, Sch ü ller HJ.Nucleic Acids Res.2001,29 (22), 4625-4632.], cultivate 3-4 days to growing transformant for 30 DEG C. Transformant be inoculated in corresponding Lacking of nutrition composition SC-Ura fluid medium [with reference to Wenz P, Schwank S, Hoja U, Sch ü ller HJ.Nucleic Acids Res.2001,29 (22), 4625-4632.] overnight, 3-4ml bacterium solution is centrifugal collects bacterium Body, bead smudge cells, extract plasmid DNA transformation E.coli DH5a, transformant extracts plasmid, and EcoRI/NotI enzyme action is tested Demonstrate,prove correct plasmid origin recombinant bacterium be then respectively designated as S.cerevisiae IKY2/pYX212-RgFAS1, S.cerevisiae IKY4/pYX212-RgFAS2 and S.cerevisiae PWY12/pYX212-RgFAS1+2.

Step 4, RgFAS expression of recombinant yeast bacterial strain grease production are analyzed

S.cerevisiae IKY2/pYX212-RgFAS1, S.cerevisiae IKY4/pYX212-RgFAS2 and S.cerevisiae PWY12/pYX212-RgFAS1+2 inoculates 5ml SC-Ura fluid medium (0.67%yeast respectively Nitrogen base W/O aminoacids but with ammonium sulfate (without aminoacid yeast basic nitrogen source, Liquid containing ammonium sulfate, purchased from BD Dific, article No.: 291920), 2% glucose, 0.01% leucine, 0.01% tryptophan, 0.005% histidine) 30 DEG C, 200rpm cultivates 24h.In 1: 30 ratio transfer respectively SC-Ura-NL limit nitrogen culture medium (20% Portugal Grape sugar, 0.1% yeast leaching powder, 0.4%KH₂PO₄, 0.15%MgSO₄·7H₂O, trace element solution 500 μ L/50mL culture medium, NH₄Cl0.025%, pH6.0, C/N ratio (mol/mol)=300, trace element solution formula: 0.4%CaCl₂·H₂O, 0.055%FeSO₄·7H₂O, 0.052% citric acid monohydrate, 0.01%ZnSO₄·7H₂O, 0.0076%MnSO₄·H₂O, 180mM Sulphuric acid), 30 DEG C, 200rpm cultivates 3d, samples every 24h, stays and be Oil Content Analysis [Li YH, Zhao ZK, Bai FWEnzyme Microb.Technol.2007,41 (3), 312-317].3 recombinant bacterial strains are oily in the intracellular of fermentation termination (3d) Fat content is as shown in table 3.

PYX212 empty carrier converts bacterial strain S.cerevisiae IKY2/pYX212, S.cerevisiae IKY4/ PYX212, S.cerevisiae PWY12/pYX212 then as control strain, inoculates the SC-Ura of 5ml fatty acids the most respectively Fluid medium (0.67%yeast nitrogen base W/O aminoacids but with ammonium sulfate (without aminoacid yeast basic nitrogen source, liquid containing ammonium sulfate, purchased from BD Dific, article No.: 291920), 2% glucose, 0.01% bright ammonia Acid, 0.01% tryptophan, 0.005% histidine, and 0.5mM Palmic acid, 0.5mM stearic acid, 1%Tween20) 30 DEG C, 200rpm cultivates 24h.In 1: 30 ratio transfer respectively SC-Ura-NL limit nitrogen culture medium (20% glucose, 0.1% yeast leaching powder, 0.4%KH₂PO₄, 0.15%MgSO₄·7H₂O, trace element solution 500 μ L/50mL culture medium, NH₄Cl0.025%, pH6.0, C/N ratio (mol/mol)=300, trace element solution formula: 0.4%CaCl₂·H₂O, 0.055%FeSO₄·7H₂O, 0.052% citric acid monohydrate, 0.01%ZnSO₄·7H₂O, 0.0076%MnSO₄·H₂O, 180mM sulphuric acid), 30 DEG C, 200rpm Cultivate 3d, sample every 24h, stay and be Oil Content Analysis [Li YH, Zhao ZK, Bai FW.Enzyme Microb.Technol.2007,41 (3), 312-317].

Result shows, the recombinant bacterial strain S.cerevisiae PWY12/pYX212-RgFAS1+ of the double subunit coexpression of RgFAS 2 can be more than 30% at fermentation termination (3d) intracellular fat content, and the intracellular of single subunit RgFAS1, RgFAS2 recombinant bacterial strain is oily Fat content the most substantially increases.Prove that RgFAS can dramatically increase fat content in non-Lipid-producing extracellular microbial, give recombinant bacterial strain oil The fat production traits；Further, this function needs two subunits of RgFAS1, RgFAS2 jointly to perform.

Table 3. restructuring yeast strains is at the intracellular fat content of fermentation termination (3d)

Note :/represent owing to biomass is few, fail to obtain effective intracellular fat content

Although it should be understood that with reference to its exemplary embodiment, the present invention carried out particularly shown and described, It should be understood by those skilled in the art that without departing substantially from by the spirit of the present invention as defined in the claims and model Under conditions of enclosing, the change of various forms and details can be carried out wherein, the combination in any of various embodiment can be carried out.

Claims

1. an oleaginous yeast fatty acid synthase, it is made up of RgFAS1 subunit and RgFAS2 subunit, and wherein said RgFAS1 is sub- The aminoacid sequence of base is as shown in SEQ ID NO:1, and the aminoacid sequence of described RgFAS2 subunit is as shown in SEQ ID NO:2.

2. derive from biologically active polypeptide fragment or the domain of oleaginous yeast fatty acid synthase described in claim 1, The aminoacid sequence of described polypeptide fragment or domain is any one in following fragment or any two or more The combination of individual fragment:

The position 190-599 of SEQ ID NO:1,

The position 611-1142 of SEQ ID NO:1,

The position 60-490 of SEQ ID NO:2,

The position 493-885 of SEQ ID NO:2,

The position 1021-1186 of SEQ ID NO:2,

The position 1212-1378 of SEQ ID NO:2,

The position 1725-1983 of SEQ ID NO:2,

The position 2066-2716 of SEQ ID NO:2, and

The position 2815-2926 of SEQ ID NO:2.

3. the biologically active polypeptide fragment of the oleaginous yeast fatty acid synthase described in claim 2 or domain, its biological activity Selected from single acyl/Acetylase (AT) activity, enoyl-ACP reductase (ER) activity, dehydratase (DH) activity, malonyl/Petiolus Trachycarpi Acyltransferase (MPT) activity, the first acyl carrier protein (ACP) activity, the second acyl carrier protein (ACP) activity, ketoacyl In reductase (KR) activity, ketone ester-acyl ACP synthase (KS) activity or Phosphopantetheinyl transferase (PPT) activity Any one or any two or more kinds of combinations.

4. the nucleotide sequence of coding oleaginous yeast fatty acid synthase described in claim 1.

Nucleotide sequence the most according to claim 4, the RgFAS1 wherein encoding described oleaginous yeast fatty acid synthase is sub- The nucleotides sequence of base is classified as SEQ ID NO:3；Encode the nucleotides sequence of the RgFAS2 subunit of described oleaginous yeast fatty acid synthase It is classified as SEQ ID NO:4.

6. the biologically active polypeptide fragment of coding oleaginous yeast fatty acid synthase described in claim 2 or the nucleotide of domain Sequence, its any one or any two in the following nucleotide sequence or the combination of more sequence:

7. contain expression cassette or the recombinant expression carrier of nucleotide sequence in any of the one of claim 4-6.

8. contain the reconstitution cell of nucleotide sequence in any of the one of claim 4-6.

9. the method building grease production reconstitution cell, described method includes the nucleotide sequence described in claim 5 Import in host cell, obtain grease production reconstitution cell.

Method the most according to claim 9, wherein said host cell is yeast cells.