CN103965305B

CN103965305B - A kind of oleaginous yeast fat drips albumen and encoding gene thereof and application

Info

Publication number: CN103965305B
Application number: CN201310039369.9A
Authority: CN
Inventors: 赵宗保; 朱志伟; 张素芳
Original assignee: Dalian Institute of Chemical Physics of CAS
Current assignee: Dalian Institute of Chemical Physics of CAS
Priority date: 2013-01-31
Filing date: 2013-01-31
Publication date: 2016-06-29
Anticipated expiration: 2033-01-31
Also published as: CN103965305A

Abstract

The present invention relates to a kind of oleaginous yeast fat and drip albumen and encoding gene thereof and application.Described oleaginous yeast fat drips the protein that albumen is following (a) or (b): the protein that (a) is made up of the amino acid sequence shown in SEQ ID NO:1；B the amino acid of SEQ ID NO:1 through one or several amino acid whose replacement and/or disappearance and/or interpolation and is had described fat and drips the protein derivative by SEQ ID NO:1 of albumen related activity by ().Green fluorescent protein positions and oil fermentation analytical proof altogether, and the oleaginous yeast fat of the present invention drips albumen and encoding gene can significantly improve cell grease accumulation and storage capacity.The present invention obtains the recombinant strain being remarkably improved oil and fat accumulation amount also by gene heterogenous expression.The oleaginous yeast fat of the present invention drips albumen and encoding gene thereof microbe grease, derivative of fatty acid can produce strain construction, and the target as the screening of adiposis patient medicine.

Description

A kind of oleaginous yeast fat drips albumen and encoding gene thereof and application

Technical field

The present invention relates to biological technical field, drip albumen and gene thereof and application particularly to a kind of oleaginous yeast fat.Tool Body ground, described oleaginous yeast fat drips albumen and encodes its nucleotide source in this rhodotorula of standing grain (R.graminis).This Bright also provide for a kind of method building grease production recombinant cell.

Background technology

Grease is the renewable resource that a kind of oxygen content is low, energy density is high, carbon chain lengths is moderate, can substitute for fossil money Source processes raw material substantially as chemical industry and regenerative resource industry, be the mankind from hydrocarbon economy to hydrocarbon oxygen transition Important link, its market potential is huge.In nature, a part of microorganism under given conditions can be born of the same parents (as nitrogen source lacks) Interior storage exceedes the grease of its dry cell weight 20%, and wherein based on triglycerides, the microorganism with this phenotype is referred to as producing Oil microorganism, including bacterium, yeast, mould, algae etc., wherein oleaginous yeast includes Rhodotorula, Candida, Some bacterial strain [Ratledge C, Wynn J in Cryptococcus, Rhizopus, Trichosporon and Yarrowia genus P.Adv Appl Microbiol2002,51,1-51].Utilize microorganism conversion of biomass resource to produce grease, base can be developed into Originally be independent of ploughing, can produce continuously, reduce the new technology of agricultural pollution, comprehensive utilization of resources, forms the petrochemical industry money of chemicals Source substitute production new way [Zhao Zongbao. Chinese biological engineering magazine 2005,25 (2), 8-11].

Since half a century, what domestic and international microbial grease was studied focuses on bacterial strain screening, domestication and zymotechnique The fields such as optimization, achieve major progress.Excellent along with the fast development of biotechnology, simple bacterial screening and culture process Change the needs that can not meet oleaginous microorganism character improvement.As the natural production bacterial strain of a certain chemicals, it is specifically given birth to Produce performance often and non-optimal.How to optimize or change metabolism network and the expression regulation network of industrial strain, to improve biology The accumulating rate of base product or the quality of oriented control target product, be focus and the difficult point of the research of current biological technical field.Oil Fat fermentation research needs reconstruct and the strengthening of fat metabolic approach, gives the property that recombinant bacterial strain produces Novel fatty acid derivative Energy.Owing to the genetic background of excellent original inhabitants' production bacterial strain is the most unclear, oil and fat accumulation metabolic regulation Cloning of Genes Related has Limit, finds more oil and fat accumulation metabolic regulation related gene, is one of the important directions of current microbial grease research.

It was discovered by researchers that the isocitric acid deriving from oleaginous microorganism (circle rhodosporidium toruloides and Si Shi saccharomyces oleaginosus) takes off The encoding gene of hydrogen enzyme (IDH) and malate dehydrogenase (ME) has differential expression, saccharomyces cerevisiae merit during original inhabitants' bacterium oil and fat accumulation Can also demonstrate that these genes can increase the fat content of recombinant bacterial strain by complementation analysis, but and could not be by a non-oil-producing bacterial strain success It is transformed into an oil-producing bacterial strain [Yang F, Zhang SF, Zhou YJ, Zhu ZW, Lin XP, Zhao ZK.Appl.Microbiol.Biotechnol.2012,94 (4), 1095-1105].Experimental result implies, microbial grease amasss Tired metabolic regulation may relate to more gene and mutually regulation therebetween and interacts.

Fat drips the main place that (Lipid droplets) is the storage of intracellular neutral fat, and diameter is from 40nm to 100 μm , it is widely present in plant, insect and zooblast.Its hydrophobic core being made up of polarity list phospholipid layer parcel neutral fats And constitute, and surface distributed has a lot of albumen, and it is week fat element that ripe fat drips the abundantest surface protein of middle content (perilipin).As Zhi Di GAP-associated protein GAP family (PAT family) member, all fat elements have typical PAT-1 domain (ammonia Cardinal extremity 1-100aa)；In the middle of it, 1/4 part is that the fat that hydrophobic amino acid forms drips anchoring domain, and c-terminus is then sweet with protection Oil three esters are not hydrolyzed, and increase fat content function and are correlated with.The function of Perilipin is relevant with its phosphorylation state, on basis Under state, the non-phosphorylation of perilipin, drip expression at fat and form a kind of physical barriers, stop lipase to touch fat and drip interior Triglycerides, thus protect fat to drip interior neutral fats from degraded；Under conditions of energy inefficiencies, poor nutritional, it is swashed by albumen Enzyme A (PKA) phosphorylation, recruits hormone-sensitive lipase (HSL) and drips surface to fat, hydrolyze neutral fats, provide energy for cell；Cause This this albumen has important function [Bickel PE, TanseyJT, Welte MA.Biochim at regulation lipid storage and degraded Biophys Acta.2009,1791 (6), 419-440] [Miura S, Gan JW, Brzostowski J, Parisi MJ, Schultz CJ, Londos C, Oliver B, Kimmel AR.J Biol Chem.2002,277 (35): 32253-32257]. This gene is widely present in some fructification fungi animal, but does not finds week fat element homologous protein in saccharomyces cerevisiae； In animal body, week, fat element was as a kind of important signals-modulating " switching device ", can regulate and control the storage of body fat and release Put.

The same with the adipocyte of animal, the triglycerides of oleaginous yeast synthesis is stored in intracellular with the form that fat drips Portion, along with the increase of oil and fat accumulation amount, fat drips constantly to become and merges greatly or mutually, and in the oil and fat accumulation later stage, fat drips and almost occupies The cell size of whole oleaginous yeast [Zhu ZW, Zhang SF, Liu HW, Shen HW, Lin XP, Yang F, Zhou YJ, Jin GJ, Ye ML, Zou HF, ZhaoZK.Nat.Commun.2012,3,1112, Supplementary Figure S6]. 2007, first identified all fat element in Metarhizium anisopliae, and prove that it has protection fat and drips the effect from degraded [Wang C, St Leger RJ.J Biol Chem.2007,282 (29), 21110-21115].Recently, protein is dripped by fat Group learns research, and we identify all fat element of a kind of novelty during this rhodotorula of standing grain (Rhodotorula graminis) oil and fat accumulation (perilipin) sample albumen high abundance is expressed, and finds that the abundance of this albumen is directly proportional to fat content, and it is named RgrLDP1 (R.graminis lipid droplet protein1, standing grain this rhodotorula fat drips albumen 1), according to experimental result, Speculate that this gene is closely related with oleaginous microorganism oil and fat accumulation, storing and metabolic regulation.Cut-off patent is submitted to day, on NCBI not Retrieve any sequence information about standing grain this rhodotorula week fat element.

Summary of the invention

It is an object of the invention to provide a kind of oleaginous yeast fat and drip albumen and encoding gene thereof and application.

The oleaginous yeast fat that the present invention provides drips albumen, entitled RgrLDP1 (R.graminis lipid droplet Protein1, standing grain this rhodotorula fat drips albumen 1), derive from standing grain this rhodotorula R.graminis ATCC MYA-4893, be by such as Lower a) or the protein of (b):

A protein that () is made up of the amino acid sequence shown in SEQ ID NO:1；

B the amino acid of SEQ ID NO:1 is passed through one or several amino acid whose replacement and/or disappearance and/or interpolation by () And there is described fat drip the protein derivative by SEQ ID NO:1 of albumen related activity.

Wherein said " fat drips albumen related activity " refers to promote that fat drips fusion, growth, increases fat and drips interior oil and fat accumulation, surely Determine fat and drip form and function, participate in the grease storing fat relevant with metabolic regulation and drip protein active.

It is easy to purify to make the oleaginous yeast fat of the present invention drip albumen, can be at the amino of above-mentioned (a) or (b) protein End or carboxyl terminal connect upper label as shown in table 1.

Table 1 is for the label purified and sequence thereof

Label	Amino acid residue number	Amino acid sequence
			Poly-Arg	5-6 (usually 5)	RRRRR
FLAG	8	DYKDDDDK
			Poly-His	2-10 (usually 6)	HHHHHH
C-mVc	10	EQKLISEEDL
			Strep-tag II	8	WSHPQFEK

PolV-Phe

11

FFFFFFFFFFF

Albumen in above-mentioned (a) or (b) can Prof. Du Yucang, it is possible to first synthesizes its encoding gene, then carries out common protein Expression obtains.The encoding gene of the albumen in above-mentioned (b) may be by lacking one in the DNA sequence dna shown in SEQ ID NO:2 Individual or the codon of several coded amino acid, and/or the missense mutation carrying out one or several base-pair obtains its encoding nucleoside Acid sequence and obtain, optionally, 5 ' ends and 3 ' ends at its coding nucleotide sequence connect the coded sequence of the label shown in table 1 And be easy to purify.

Described oleaginous yeast fat drips the encoding gene (such as, rgrldp1) of RgrLDP1 and falls within the protection model of the present invention Enclose.

Therefore, the present invention also provides for the oleaginous yeast fat of a kind of code book invention and drips the nucleotide sequence of albumen.

Preferably, described nucleotides sequence is classified as the DNA molecular shown in SEQ ID NO:2.

Recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterial strain containing described gene belong to the present invention Protection domain.

Therefore, the present invention also provides for comprising the restructuring of the nucleotide sequence that the oleaginous yeast fat of code book invention drips albumen and carries Body, preferably recombinant expression carrier；The weight having imported (such as, by converting or rotaring dyeing technology importing) described recombinant vector is provided Group cell.Described recombinant cell is preferably yeast cells, Chlamydomonas reinhardtii, cyanobacteria, Rhodococcus sp or Escherichia coli.

It should be appreciated by those skilled in the art that coding oleaginous yeast fat to drip the nucleotide sequence of albumen or comprises coding and produce The recombinant vector of the nucleotide sequence that oil cerolin drips albumen imports host cell can be carried out according to the ordinary skill in the art, For example, it is possible to carry out by converting, transfect the routine techniques such as (such as, agriculture bacillus mediated transfection) or electroporation.

The present invention also protects the primer expanding described gene.

Available existing basidiomycetes expression vector and saccharomyces cerevisiae expression build containing described encoding gene (rgrldp1) recombinant expression carrier.

Described basidiomycetes expression vector includes agrobacterium tumefaciens mediated gene recombinant vector and can be used for the micro-bullet of basidiomycetes The carrier etc. of bombardment.Described basidiomycetes expression vector also can comprise 3 ' end untranslated regions of foreign gene, i.e. comprises poly-gland Nucleotide signal and any other participate in mRNA processing or the DNA fragmentation of gene expression.Described polyadenylation signals may be guided poly-gland Thuja acid join mRNA precursor 3 ' end, as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as kermes synzyme Nos gene), The non-translational region that standing grain this rhodotorula gene (such as the G3PDH gene of R.graminis) 3 ' end is transcribed is respectively provided with similar functions.Described Saccharomyces cerevisiae expression include that saccharomyces cerevisiae sequestered expression vector (carries 2 μm replicon or autonomously replicating sequences (ARS) the existing universal support, can bought voluntarily such as pYX212, pYES2C/T etc.) and integrated expression vector (carry integration position Point gene restructuring arm).

When using rgrldp1 to build recombinant yeast expression vector, can be plus any one induction before its initiation nucleotide Type promoter or constitutive promoter, such as glyceraldehyde 3-phosphate dehydrogenase promoter pG3PDH, galactolipin evoked promoter PGal10, promoter can be used alone or be used in combination with other promoter.

For the ease of transgenic cell line or recombinant bacterial strain being identified and screening, used carrier can be modified, Enzyme (such as green fluorescent protein) or the luminophor of color change is produced as introduced the coding can expressed in yeast cells Gene (such as gus gene, luciferase gene etc.), there is the antibiotic marker genes of resistance (such as kanamycins marker gene, rich Lay mycin marker gene, hpt marker gene) or anti-chemical reagent marker gene (such as anti-herbicide gene) and nutrition sieve Select marker gene (such as LEU2, URA3) etc..

It is a further object to provide a kind of method building grease production recombinant cell, described method includes: The nucleotide sequence that the oleaginous yeast fat that code book is invented drips albumen imports host cell, obtains grease production recombinant cell. Wherein the use that is directed through of the nucleotide sequence that the oleaginous yeast fat of code book invention drips albumen comprises described nucleotide sequence Recombinant vector transformed host cell realizes.Preferably, described host cell can be selected from yeast, microalgae, Rhodococcus sp or large intestine bar Bacterium, wherein said yeast can be saccharomyces cerevisiae, and it includes, but not limited to saccharomyces cerevisiae INVSc1 or BY4741；Or it is permissible For this rhodotorula of standing grain, it includes, but not limited to R.graminis ATCC MYA-4893；Described Rhodococcus sp includes, but does not limits In, muddy Rhodococcus sp, such as, R.opacus PD630；Described microalgae is selected from chlamydomonas or Synechococcus, such as, but not limited to, Rhein Chlamydomonas (Chlamydomonas reinhardtii) CC-849 or Synechococcus (Synechococcus sp.) PCC7002.Utilize Any one can start the carrier that foreign gene is expressed in saccharomyces cerevisiae, and rgrldp1 provided by the present invention is imported wine brewing In yeast cells, obtain grease production recombinant Saccharomyces cerevisiae.Utilize any one can start foreign gene at this rhodotorula of standing grain The carrier of middle expression, increases copy number by rgrldp1 provided by the present invention, obtains this rhodotorula of standing grain of recombinating.Utilize any one The carrier that foreign gene is expressed in Chlamydomonas reinhardtii can be started, rgrldp1 provided by the present invention is imported in Chlamydomonas reinhardtii, To grease production restructuring Chlamydomonas reinhardtii.Utilize any one can start the carrier that foreign gene is expressed in Rhodococcus sp, incite somebody to action this Invent provided rgrldp1 to import in Rhodococcus sp, obtain grease production restructuring Rhodococcus sp.Utilize any one can start external source Rgrldp1 provided by the present invention, at the carrier of expression in escherichia coli, is imported in Escherichia coli, obtains grease production weight by gene Group Escherichia coli.

It is demonstrated experimentally that the oleaginous yeast fat that the present invention provides drips albumen and encoding gene is remarkably improved recombinant cell Fat content and fat drip stability.

In sum, the present invention provides following:

1. oleaginous yeast fat drips an albumen, is the protein of following (a) or (b):

A protein that () is made up of the amino acid sequence shown in SEQ ID NO:1；

2. the coding oleaginous yeast fat of the 1st drips the nucleotide sequence of albumen.

3., according to the 2nd described nucleotide sequence, described nucleotide sequence is the DNA molecular shown in SEQ ID NO:2.

4. comprise the recombinant vector of the nucleotide sequence of the 2nd or the 3rd.

5. a recombinant cell, described cell transformation imports the 4th described recombinant vector.

6. the method building grease production recombinant cell, described method includes: by the 2nd or the 3rd described gene Import in host cell, obtain grease production recombinant cell.

7., according to the 6th described method, wherein imported by the recombinant vector transformed host cell described with the 4th 2nd or the 3rd described gene.

8., according to the 6th described method, wherein said host cell is selected from yeast, microalgae, Rhodococcus sp or Escherichia coli.

9. according to the 8th described method, wherein said yeast is selected from saccharomyces cerevisiae or this rhodotorula of standing grain, and described microalgae is selected From chlamydomonas or Synechococcus, described Rhodococcus sp is muddy Rhodococcus sp.

10., according to the 9th described method, wherein said chlamydomonas is Chlamydomonas reinhardtii.

Accompanying drawing explanation

Fig. 1 is rgrldp1 gene RT-PCR amplification, and amplified band is 0.8kb.

Fig. 2 is RgrLDP1 and the domain composition analysis schematic diagram of other fat element in species week.

Fig. 3 is RgrLDP1 prokaryotic expression plasmid collection of illustrative plates.

Fig. 4 is that the SDS-PAGE of RgrLDP1 prokaryotic expression product analyzes.M: Protein Marker；P: inducing cell splits Solve liquid precipitate；S: inducing cell lysis liquid supernatant.

Fig. 5 is the nickel affinity purification of prokaryotic expression RgrLDP1 albumen.M: Protein Marker；L: cell pyrolysis liquid；E: 40mM imidazoles elution fraction.

Fig. 6 is RgrLDP1 recombinant Saccharomyces cerevisiae expression plasmid pYES2/CT-RgrLDP1.

Fig. 7 is the RgrLDP1 recombinant Saccharomyces cerevisiae expression plasmid pYES2/CT-RgrLDP1-GFP figure that c-terminus merges GFP Spectrum.

Fig. 8 is the expression and localization of the restructuring RgrLDP1 merging GFP.(A) bright field of RgrLDP1-GFP expressive host is micro- Sem observation.(B) bright-field microscope of RgrLDP1-GFP expressive host is observed.

Detailed description of the invention

Following example facilitate a better understanding of the present invention, but limit and the brightest.The scope of the present invention is wanted by right Ask and equivalents limits.

Experimental technique in following embodiment, if no special instructions, is conventional method.Reality used in following embodiment Test material, if no special instructions, be and be commercially available from routine biochemistry Reagent Company.

This rhodotorula of standing grain (R.graminis) ATCC MYA-4893: Unite States Standard biology product collecting center (ATCC), separates From comospore poplar (Populus trichocarpa) stem of Washington, DC Three Forks Park, FGSC it is committed to ATCC, is equal to R.graminis WP1 or FGSC10291.

This rhodotorula of standing grain (R.graminis) ATCC28135: purchased from Unite States Standard biology product collecting center (ATCC), separates From the barley leaf of French six row barleys (Hordeum hexastichon), H.G.Diem it is committed to Holland microorganism fungus kind and protects Center, Tibetan (Centraalbureauvoor Schimmelcultures, CBS), rear unloading is in ATCC.This bacterial strain is equal to CBS6403 or ATCC96593 or CCY29-133-1 or IFO10412 or JCM3932 or MUCL30689 or NRRL Y-17366 or VKM Y-2420。

This rhodotorula of standing grain (R.graminis) ATCC32768: purchased from Unite States Standard biology product collecting center (ATCC), separates In the careless strain of New Zealand pasture, by M.E.di Menna be committed to Holland Culture Collection (CBS), rear unloading in ATCC.This bacterial strain is equal to CBS2826 or IGC4842 or JCM3775 or MUCL30431 or NCYC502 or NRRL Y-2474.

Culture medium prescription involved in following example and purposes are as follows:

(1) YEPD culture medium: dusty yeast 10g/L, peptone 10g/L, glucose 20g/L, pH6.0, solid medium is then Add agar powder 15g/L；For strain activation and culture, seed liquor preparation and bacterial classification short term storage.

(2) limit nitrogen culture medium: glucose 70g/L, dusty yeast 0.75g/L, (NH₄)₂SO₄0.1g/L, KH₂PO₄1.0g/L, MgSO₄·7H₂O1.5g/L, pH5.6, and add trace element liquid (the 4.0g/L CaCl of 1% (V/V)₂·2H₂O, 0.55g/ L FeSO₄·7H₂O, 0.52g/L citric acid H₂O, 0.10g/L ZnSO₄·7H₂O, 0.076g/L MnSO₄·H₂O With 100 μ l18MH₂SO₄), for bacterial strain oil and fat accumulation and the cultivation of dripping thalline rich in fat.

Embodiment 1: standing grain this rhodotorula week fat element sample albumen discovery

This rhodotorula of standing grain (R.graminis) ATCC MYA-4893 is 30 DEG C of cultivation 36h in liquid YEPD culture medium.Centrifugal Collect wet thallus, wash twice with distilled water, store in-80 DEG C of refrigerators, for RNA and Protein Extraction.Train equally The sample (parallel sample) supported then is used for measuring dry cell weight and fat content.Sample named ' YEPD '.

R.graminis ATCC MYA-4893 carries out limiting the fermentation of nitrogen culture medium, it is achieved oil and fat accumulation.Biological in FUS-15L Carrying out in reactor, liquid amount 8L, inoculum concentration 10%, temperature 30 DEG C, throughput 0.8vvm, dissolved oxygen controls at 40-50% saturated (dissolved oxygen and stirring linkage).PH is controlled automatically at 5.6 by dropping 10.0M NaOH and 2M HCl.Take out respectively and cultivated 24h Each 50mL with the cell culture fluid of 96h, sample is respectively designated as ' 24h ' and ' 96h '.Centrifugal collection wet thallus, with distillation washing Wash twice, store in-80 DEG C of refrigerators.The thalline sample (parallel sample) processed equally is used for measuring dry cell weight and oil Fat content [Li YH, Zhao ZK, Bai FW.Enzyme Microb.Technol.2007,41 (3), 312-317].

The fat of R.graminis ATCC MYA-4893 drips (Lipid droplets) Proteomic analysis: ' YEPD ', The fat of ' 24h ' and ' 96h ' these 3 samples drips isolated and purified, fat and drips Protein Extraction and identify and operate same bibliography: [Athenstaedt K, Jolivet P, Boulard C, Zivy M, Negroni L, Nicaud JM, Chardot T.Proteomics.2006,6 (5), 1450-1459] [Liu H, Zhao X, Wang F, Li Y, Jiang X, Ye M, Zhao Z K, Zou H.Yeast, 2009,26,553-566] [Ding Y, Yang L, Zhang S, Wang Y, Du Y, Pu J, Peng G, Chen Y, Zhang H, Yu J, Hang H, Wu P, Yang F, Yang H, Steinbuchel A, Liu P.J.Lipid Res.2012,53,399-411]), wherein, the SDS-PAGE protein band of an about 30kDa is profit after trypsin digestion Find with μ HPLC-MS/MS methods analyst, the single peptide fragment (UniquePep) several 22 all occurred in ' 24h ' and ' 96h ' sample Individual:

R.AEQLSLAILHR.L；

K.LETNELLGQAR.K；

K.TIADFPHDK.Q；

R.TDVPLGTK.A；

K.LAPVLDYFK.T；

K.QSLQSTLDSLSNELEAYVDTAK.S；

MSAATEQAPSTTINGDTAHETALHR.V；

R.AEQLSLAILHRLEPLQK.R；

R.AEQLSLAILHR.L；

K.DTLSTAHAYVEERPYLSSLYAR.A；

R.LADGR.A；

R.LEPLQK.R；

R.KPADAAYGLAQDYNK.A；

K.AFQQRFSPLAEPVYQR.L；

R.LIPLDQVDSYANAGLDYLEK.R；

R.ATLVSLQDR.L；

R.TDVPLGTK.A；

R.ATLVSLQDRLAK.T；

K.SLPSHAQETAKPYLAAAQDVLGDVTK.E；

K.LAPVLDYFK.T；

K.DEASDKVDEVK.D；

R.ATLVSLQDR.L。

In ' 24h ' and ' 96h ' sample, these peptide fragments content total amount (PepCount) are respectively 72 and 464, ' 96h ' sample Peptide fragment abundance is about 6 times of ' 24h ' sample, and reaches the highest in ' 96h ' sample.Sample replicate analysis three times, data are divided Analyse and add up based on the albumen identified in three replicate analysis.

The MS/MS data (the single peptide fragment (UniquePep) that ' 24h ' and ' 96h ' all occurs) obtained in experiment, use TurboSEQUEST (BioWorks3.2) software carries out data retrieval, and database is standing grain this rhodotorula genome database (http://genome.jgi-psf.org/pages/blast.jsf？Db=Rhoba1_1).Search storehouse parameter to arrange with reference to literary composition Offer [Liu H, Zhao X, Wang F, Li Y, Jiang X, Ye M, Zhao Z K, Zou H.Yeast, 2009,26,553- 566].Find these peptide fragments derive from a polypeptide (numbered jgi | Rhoba1_1 | 53178 | estExt_ Genemark1.C_6_t10064, total length 1306aa) sequence of c-terminus about about 280aa.Owing to experimental data shows these Peptide fragment derives from the SDS-PAGE protein band trypsase hydrolysis products of about 30kDa, therefore speculates " jgi | Rhoba1_1 | 53178 | estExt_Genemark1.C_6_t10064 " prediction error.Download this protein sequence to find after Blastp analyzes, Correct protein sequence should identify, as shown in SEQ ID NO:1, all fat element (all fat that this protein (gene) is a kind of novelty Element encoding gene).

By the named RgrLDP1 of protein shown in SEQ ID NO:1.RgrLDP1 is made up of 279 amino acid residues；Reason Opinion isoelectric point is 5.45；Signal peptide is not had to identify through sequence analysis RgrLDP1, for endocellular enzyme；According to RgrLDP1 amino acid sequence This enzyme can be attributed to Zhou Zhisu family by row, belongs to fat and drips GAP-associated protein GAP；But the structure of RgrLDP1 and sac fungus, mammal All fat elements difference of cell derived is relatively big, and RgrLDP1, in addition to having all fat element domains, also has apolipoprotein concurrently (apolipoprotein) domain, for all fat element of a kind of novelty；With from Mixia osmundae IAM14324's Perilipin has maximum homology；RgrLDP1 shown in SEQ ID NO:1, is week fat element structure from aminoterminal 9-113 Territory, 48-274 is apolipoprotein domain, and all fat element domains and apolipoprotein domain portion region are overlapping (Fig. 2).

Embodiment 2: the clone of standing grain this rhodotorula rgrldp1 gene

According to the amino acid sequence of RgrLDP1, design degenerate primer:

Rgrldp1-sence:ATGTCNGCCGCCACYGAG (N:A/C/G/T, Y:C/T)

Rgrldp1-anti:TCACGCNGANGANGANGA (N:A/C/G/T) (/ represent "or")

Primer direction is 5 ' to 3 ' directions.

Liquid nitrogen grinding is utilized to add RNAiso method [Yang F, Tan HD, Zhou YJ, Lin XP, Zhang SF.Mol.Biotechnol.2010,47 (2), 144-151] extract R.graminis ATCC MYA-4893 total serum IgE.RNA enters Row 1.5% agarose gel electrophoresis, uses fluorescence-uv analyzer to observe and identifies, it is seen that two band clearly.By ultraviolet/can See that photothermal spectroscopic analyzer analyzes total serum IgE sample, record OD_260/280=2.0, show that total serum IgE quality is fine.Total serum IgE sample is frozen in-80 DEG C standby.

High Fidelity PrimeScript RT-PCR Kit (purchased from Takara) is utilized to synthesize cDNA the first chain.20 μ l reaction system, first, by 2 μ l total serum IgE (～1 μ g), Oligo (dT) and Random (6mer) each 100nM, at 2.0 μ l DEPC Reason water (pyrocarbonic acid diethyl ester processes water, purchased from Dalian TaKaRa company), joins in PCR pipe and mixes, be incubated 5min in 65 DEG C, Being immediately placed on cooled on ice 2min, (High Fidelity PrimeScript RT-PCR Kit carries reverse transcription to add enzyme Mix Enzyme, purchased from Takara), DEPC processes water polishing 20 μ l, 42 DEG C of 30min and carries out reverse transcription, and 70 DEG C of 15min inactivate reverse transcriptase.

With reverse transcription synthesis cDNA the first chain as template, carry out rgrldp1 gene degenerate pcr amplification, 5 × PCR delay Rush liquid (TakaRa) 10.0 μ l, dNTPs (10mM, TaKaRa) 1.0 μ l, primer rgrldp1-sence (100mM) and rgrldp1- The each 1.0 μ l of anti (100mM), PrimeStar (Dalian TakaRa) 0.5 μ l, cDNA the first chain template 1.0 μ l, ddH of synthesis₂O Polishing, to 50 μ l, is incubated 3min, then in 94 DEG C of 30s, 61 DEG C of 30s, 72 DEG C of 1min, 35 circulations in 94 DEG C, adds Taq Archaeal dna polymerase (TakaRa) 1.0 μ l carries out 3 ' ends of amplified production and adds A, 72 DEG C of 20min, and 4 DEG C are terminated reaction.Amplified production Carry out 1% (mass/volume concentration) agarose gel electrophoresis, it was observed that the band (Fig. 1) of about 0.85kb.DNA is utilized to reclaim Kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), purifies according to supplier's proposed steps (NEP013-2 specification) PCR primer.The method (D101A specification) that PCR primer provides with reference to TaKaRa company is cloned into pMD18-T carrier, obtains weight Group plasmid pMD18T-rgrldp1, is transformed into E.coli DH5 α competent cell, selects Amp resistant transformants and carries out increasing bacterium training Foster, plasmid extraction (green skies plasmid Mini Kit, article No.: D0003).Recombinant plasmid sample is delivered to TaKaRa company and is surveyed Sequence, sequencing result shows, the nucleotides sequence expanded to is classified as SEQ ID NO:2, and encoding amino acid sequence is SEQ ID NO:1 Protein.By the named RgrLDP1 of albumen shown in SEQ ID NO:1, the core shown in SEQ ID NO:2 that clone is obtained The named rgrldp1 of thuja acid.The positive named pMD18T-rgrldp1 of recombinant plasmid.Analyzing through Blastp, RgrLDP1 is attributable to Zhou Zhisu family, belongs to fat and drips GAP-associated protein GAP.But the structure of RgrLDP1 and sac fungus, all fat element in mammalian cell source Difference is relatively big, and RgrLDP1, in addition to having all fat element domains (from aminoterminal 9-113aa), also has apolipoprotein domain concurrently (from aminoterminal 48-274aa), all fat element domains and apolipoprotein domain portion are overlapping, for all fat element of a kind of novelty (Fig. 2).

Embodiment 3: the prokaryotic expression of standing grain this rhodotorula rgrldp1 gene and protein purification

According to rgrldp1 nucleotide sequence design add corresponding restriction enzyme site primer (primer rgrldp1-EcoRI-F's Underscore part is EcoRI restriction enzyme site, and the underscore part of primer rgrldp1-NotI-R is NotI restriction enzyme site), sequence As follows:

Rgrldp1-EcoRI-F:GGAATTCATGTCTGCCGCCACCGAGCAGGC

Rgrldp1-NotI-R:AAAAGGAAAAGCGGCCGCTCACGCCGACGACGAGGACGACG

Primer direction is 5 ' to 3 ' directions.

With embodiment 2 build cloning vector pMD18T-rgrldp1 as template, utilize primer rgrldp1-EcoRI-F and Rgrldp1-NotI-R expands rgrldp1 coding region sequence, and PCR fragment, through EcoRI/NotI double digestion, is connected into same double digestion PET28a carrier (recovery is digested big segment for coupled reaction), Transformed E .coli DH5a Competent cell, through order-checking The correct named pET28a-rgrldp1 of the recombinant plasmid (Fig. 3) built of checking.

By pET28a-rgrldp1 Plastid transformation E.coli Bl21 (DE3) host, obtain expressing bacterial strain BL21/pET28a- rgrldp1.Choose single colony inoculation in 10ml Kan-LB culture medium (tryptone 10g/l, dusty yeast 5g/l, NaCl10g/l, and Containing kanamycins 50 μ g/ml), cultivate 4-6h to OD for 37 DEG C_600nmFor 0.6-0.8, add final concentration of 0.1mM IPTG and lure Lead, 30 DEG C of overnight incubation.After abduction delivering terminates, taking 1ml bacterium solution, in 4 DEG C, 8000rpm is centrifuged 5min and collects thalline, and thalline sinks Form sediment with 200 μ l bacteria lysis buffer solutions (100mM Tris-HCl, 20% glycerine, 2mM EDTA, 1.5mM DTT, pH7.5) weight Outstanding, (power is 60W, pulse 2s, intermittently 2s for ice bath, ultra-fine probe, total time to utilize sonioation method to extract soluble protein 1min), to bacterium solution change clarification；16000 × g, 4 DEG C of centrifugal 10min, taking supernatant is soluble protein fraction, utilizes isopyknic The resuspended precipitation of lysis buffer；Utilize the expression (12% acrylamide gel) of SDS-PAGE analyzing proteins.Result such as Fig. 4 Shown in, under 0.1mM IPTG inductive condition, restructuring RgrLDP1 almost complete soluble-expression, molecular weight is about 37kDa (RgrLDP1 theoretical molecular is 30.7kDa, and the rear fusion protein molecular weight that tags is 36.6kDa).

Protein purification procedures is carried out according to Invitrogen Ni-NTA purification system teachings, with Nickel ion, as affine ion, relies on imidazole concentration gradient (30-100mM imidazoles) wash-out destination protein.BL21/pET28a- Rgrldp1 carry out 200ml volume abduction delivering (200mlKan-LB culture medium (tryptone 10g/l, dusty yeast 5g/l, NaCl10g/l, and the μ g/ml Han kanamycins 50), 37 DEG C are cultivated 4-6h to OD is 0.6-0.8, adds final concentration of 0.1mMIPTG induces, 30 DEG C of overnight incubation), centrifugal thalline of collecting, addition 50ml bacteria lysis buffer solution (100mM Tris-HCl, 20% glycerine, 2mM EDTA, 1.5mM DTT, pH7.5) resuspended, sonioation method extracts soluble protein (ice Bath, power is 60W, pulse 2s, intermittently 3s, total time 10min), become clarification to bacterium solution；16000 × g, 4 DEG C of centrifugal 10min, take Supernatant soluble protein, after utilizing the 0.22 low protein bound membrane filtration of μm, loading to nickel affinity chromatography post (volume 5ml), Again by 30-100mM imidazole concentration gradient (with reference to Invitrogen Ni-NTA purification system (article No.: K950- 01) specification) eluted protein.All purification process are all carried out at 4 DEG C, and ensure all of relevant buffers of precooling.Purify To albumen be stored in 20% glycerine ,-70 DEG C of preservations after packing.By SDS-PAGE, (12% acrylamide coagulates purity of protein Glue) to analyze, result is as it is shown in figure 5, RgrLDP1 purity of protein of recombinating in elution fraction E is all higher than 90%.

By recombination bacillus coli BL21/pET28a-rgrldp1 inoculation M9-N culture medium, (M9 limits nitrogen culture medium: 2% grape Sugar, 0.6%Na₂HPO₄, 0.3%KH₂PO₄, 0.05%NaCl, 1mMMgSO₄, 0.1mM CaCl₂, 0.1% (v/v) 1000 × micro- Secondary element mixed liquor；1000 × trace element mixed liquor composition: 2.7%FeCl₃·6H₂O, 0.2%ZnCl₂·4H₂O, 0.2% CaCl₂·2H₂O, 0.2%Na₂MoO₄·2H₂O, 1.9%CuSO₄·5H₂O, 0.5%H₃BO₃), 37 DEG C, 200rpm shaken cultivation 24h, every 6h sample, stay do Oil Content Analysis [Rude MA, SchirmerA.Curr.Opin.Microbiol.2009, 12,274-281].It was found that during fermentation termination, compared with control strain BL21/pET28a, BL21/pET28a-rgrldp1 Intracellular fat content is increased to 18% by 10%, it is seen then that intracellular fat content improves 80%.Prove that rgrldp1 gene can promote Enter Escherichia coli oil and fat accumulation, increase its intracellular fat content.

Embodiment 4: the Yeast expression of standing grain this rhodotorula rgrldp1 gene and fat titration position

Nucleotide sequence according to rgrldp1 designs following primer, for building the c-terminus Perilipin-with GFP (the underscore part of primer PG-PER-F is EcoRI restriction enzyme site to GFP fusion expression vector, the underscore of primer PG-GFP-R Part is NotI restriction enzyme site):

PG-PER-F:GGAATTCAACATGTCTGCCGCCACCGAGCAGGC

PG-PER-R:TGCAAGCTTGGCGTAATCATGGTCACGCCGACGACGAGGACGACG

PG-GFP-F:GAGAAGGAGGGCGAGGGGGAGAAGCAGATGACCATGATTACGCCAAG CT

PG-GFP-R:AAAAGGAAAAGCGGCCGCTCATTTGTAGAGCTCATCCATGCCATG

Primer direction is 5 ' to 3 ' directions.

The structure of step one RgrLDP1 saccharomyces cerevisiae expression

(1) pYES2/CT-RgrLDP1 vector construction: primer rgrldp1-EcoRI-F and rgrldp1-in embodiment 3 NotI-R amplified fragments is connected into pYES2/CT (purchased from the Invitrogen) carrier being digested equally after EcoRI/NotI double digestion (recovery is digested big segment for coupled reaction).Through EcoRI/NotI be digested qualification releasably go out 0.85kb Insert Fragment and The recombinant plasmid of the YES2/CT carrier segment of 5.9kbp send TaKaRa to check order, and check order the named pYES2/ of correct recombinant plasmid CT-RgrLDP1 (Fig. 6).

(2) pYES2/CT-RgrLDP1-GFP vector construction: be with the cloning vector pMD18T-rgrldp1 previously built Template, utilizes primer PER-EcoRI-F and pG-PER-R to expand RgrLDP1 fragment；With pGFPuv carrier as template, utilize primer PG-GFP-F and pG-GFP-R, expands GFP fragment；After RgrLDP1 and GFP amplified fragments utilizes DNA glue to reclaim kits, Overlap-extension round pcr is utilized to obtain RgrLDP1-GFP fusion, after purifying after EcoRI/NotI is digested It is connected into pYES2/CT (purchased from the Invitrogen) carrier being digested equally.It is digested qualification through EcoRI/NotI and releasably goes out 1.7kb The recombinant plasmid of the YES2/CT carrier segment of Insert Fragment and 5.9kbp send TaKaRa to check order, the recombinant plasmid life checking order correct Entitled pYES2/CT-RgrLDP1-GFP (Fig. 7).

Step 2 RgrLDP1 recombinant Saccharomyces cerevisiae expresses the structure of bacterial strain

By 2 recombinant plasmid pYES2/CT-RgrLDP1 and pYES2/CT-RgrLDP1-GFP, convert respectively to ferment of making wine Female (Saccharomyces cerevisiae) INVSc1 is (purchased from Invitrogen, genotype: MATa/ α, his3 Δ 1/his3 Δ 1, leu2/leu2, trp1-289/trp1-289, ura3-52/ura3-52) in.Method for transformation is as follows: single yeast colony It is inoculated in 5ml YPD culture medium (20g/L peptone, 10g/L yeast extract, 20g/L glucose, pH6.0), incubated overnight； Being inoculated in YPD culture medium fresh for 100ml with 1: 50, cultivate about 8h, now OD value is about 1.0-1.2, ice bath 15min；4 DEG C, 2000 × g is centrifuged 10min and collects thalline, is suspended in the ice-cold ddH of 50ml₂O, 2000 × g are centrifuged 10min centrifugal collection bacterium Body, is then suspended in 1M sorbierite ice-cold for 20ml, and 2000 × g is centrifuged 10min centrifugal collection thalline, to the greatest extent solution, and thalline hangs Floating on the ice-cold sorbierite of 0.5-1.0ml, now OD value is about 100-200.50 μ l electricity turn 0.5-1 μ g plasmid in competent cell DNA (DNA volume is less than 5 μ l), places 10min on ice, is transferred in the electric revolving cup of ice-cold (0 DEG C), and parameter is arranged: resistance 600, voltage 1500V, electric capacity 15 μ F, temperature 0 DEG C, the electric shock time is about 5ms, has shocked by electricity and has added the ice-cold sorbierite of 1ml, in 30 DEG C shaking table temperature bath 2h, is applied to SC-Uracil flat board (0.67%YNB W/O amino acids but with ammonium Sulfate (without amino acid yeast basic nitrogen source, liquid containing ammonium sulfate, purchased from BDDific, article No.: 291920), 2% glucose, 0.01% leucine, 0.01% tryptophan, 0.005% histidine, 1.5% agar powder), cultivate 3-4 days to growing conversion for 30 DEG C Son.Transformant is inoculated in SC-Ura fluid nutrient medium (0.67%YNB W/O amino acids but with ammonium Sulfate (without amino acid yeast basic nitrogen source, liquid containing ammonium sulfate, purchased from BD Dific, article No.: 291920), 2% glucose, 0.01% leucine, 0.01% tryptophan, 0.005% histidine) overnight, 3-4ml bacterium solution is centrifugal collects thalline, and bead crushes Cell, extracts plasmid DNA transformation E.coli DH5a, and transformant extracts plasmid, and the plasmid that EcoRI/NotI digestion verification is correct comes Source recombinant bacterium is then respectively designated as INVSc1-pYES2/CT-RgrLDP1 and INVSc1-pYES2/CT-RgrLDP1-GFP.

The expression of RgrLDP1 in step 3 RgrLDP1 expression of recombinant yeast bacterial strain

INVSc1-pYES2/CT-RgrLDP1 and INVSc1-pYES2/CT-RgrLDP1-GFP inoculates 5ml SC-respectively (0.67%YNB W/O amino acids but with ammonium sulfate is (without amino acid ferment for Ura fluid nutrient medium Female basic nitrogen source, liquid containing ammonium sulfate, purchased from BD Dific, article No.: 291920), 2% glucose, 0.01% leucine, 0.01% look Propylhomoserin, 0.005% histidine) overnight incubation, OD value reaches 4.2, centrifugal supernatant of abandoning, addition 50ml SCg-Ura inducing culture (20g/L galactolipin replaces glucose, and other composition is with SC-Ura fluid nutrient medium), 30 DEG C, 200rpm Fiber differentiation overnight, takes A small amount of cell carries out fluorescence microscope.Use pYES2/CT (purchased from Invitrogen) expression vector, the table of foreign gene Reach and controlled by inducible promoter GAL1p, when only there is galactolipin in culture medium, could abduction delivering.Utilize glass strain Broken yeast cell wall method is extracted 2 restructuring yeast strains INVSc1-pYES2/CT-RgrLDP1 and INVSc1-pYES2/ Bacterial protein after CT-RgrLDP1-GFP abduction delivering 48h, SDS-PAGE can find after analyzing, with as under condition of culture PYES2/CT (purchased from Invitrogen) empty carrier convert NVSc1 control strain compare, INVSc1-pYES2/CT-RgrLDP1 The expression of the differential protein band of 31kDa and 58kDa is had respectively with INVSc1-pYES2/CT-RgrLDP1-GFP.Meanwhile, INVSc1-pYES2/CT-RgrLDP1-GFP expression product C end merges GFP albumen, with as pYES2/CT under condition of culture (purchased from Invitrogen) empty carrier converts NVSc1 control strain and compares with NVSc1-pYES2/CT-RgrLDP1 bacterial strain, glimmering Obvious green fluorescence (Fig. 8) be can be observed under light microscope (Nikon Co.) 330-380nm excitation wavelength.The result table of Fig. 8 In bright galactolipin inducing culture, purpose melts holoprotein perilipin-GFP effective expression, and the perilipin-GFP expressed Fusion protein is orientated fat as and is dripped.

Step 4 RgrLDP1 expression of recombinant yeast bacterial strain grease production is analyzed

Recombinant Saccharomyces cerevisiae bacterial strain INVSc1-pYES2/CT-RgrLDP1 and INVSc1-pYES2/CT-RgrLDP1-GFP Inoculation 5ml SC-Ura fluid nutrient medium (0.67%yeast nitrogen base W/O aminoacids but respectively With ammonium sulfate (without amino acid yeast basic nitrogen source, liquid containing ammonium sulfate, purchased from BD Dific, article No.: 291920), 2% glucose, 0.01% leucine, 0.01% tryptophan, 0.005% histidine) 30 DEG C, 200rpm cultivates 24h. Transferring respectively in 1:30 ratio, (20% galactolipin, 0.1% yeast soaks powder, 0.4%KH to SC-Ura-NL limit nitrogen culture medium₂PO₄, 0.15%MgSO₄·7H₂O, trace element solution 500 μ L/50mL culture medium, NH₄Cl0.025%, pH6.0, C/N ratio (mol/ Mol)=300, trace element solution formula: 0.4%CaCl₂·H₂O, 0.055%FeSO₄·7H₂O, 0.052% citrate hydrate Acid, 0.01%ZnSO₄·7H₂O, 0.0076%MnSO₄·H₂O, 180mM sulfuric acid), 30 DEG C, 200rpm cultivates 4d, takes every 24h Sample, stay do Oil Content Analysis [Li YH, Zhao ZK, Bai FW.Enzyme Microb.Technol.2007,41 (3), 312-317] and fluorescence observation.

Every the bacterium solution of 24h sampling, 8000rpm room temperature is centrifuged 5min and collects thalline, with 1mLPBS buffer solution (0.15M KCl, 10mM K₃PO₄, pH7.0) and washed cell three times, with 1mLPBS buffer solution re-suspended cell, add 6 μ L0.1g/L Nile reds third Ketone solution, room temperature lucifuge dyeing 10min, with Nikon 80i fluorescence microscope (Nikon Co.) under 510-560nm excitation wavelength Observe red neutral fat to drip；It is switched under 330-380nm excitation wavelength, then observes the green fluorescent label of same position.Knot Fruit display, it is salmon pink that fat drips by Nile red dye, and along with longer fermentation times, fat drips and gradually increases and increase mutually fusion；Cut Change under 330-380nm excitation wavelength, then INVSc1-pYES2/CT-RgrLDP1-GFP Green fluorescin be can be observed fixed It is positioned at fat and drips position.

And Oil Content Analysis result shows, 2 recombinant bacterial strain INVSc1-pYES2/CT-RgrLDP1 and INVSc1- PYES2/CT-RgrLDP1-GFP all can meet oleaginous microorganism more than more than 30% in fermentation termination (4d) intracellular fat content Definition.Prove that rgrldp1 gene can dramatically increase fat content in non-Lipid-producing extracellular microbial, give recombinant bacterial strain grease raw Produce proterties.

Embodiment 5: the expression analysis of standing grain this rhodotorula rgrldp1

According to semiquantitive PCR design of primers requirement, devise standing grain this rhodotorula ACTIN and rgrldp1 Semiquatitative RT-PCR assay Primer, sequence is as follows:

ACTIN-F:GCTGTCTTCCCCTCGATTGT

ACTIN-R:GGGTCAGGATACCACGCTTC

Rgrldp1-F:GCCGACTTCCCTCACGACA

Rgrldp1-R:ACGTTCGACGCCTTGGTG

Primer direction is 5 ' to 3 ' directions.

This rhodotorula of standing grain (R.graminis) ATCC32768 is 30 DEG C of cultivation 36h in liquid YEPD culture medium.Centrifugal collection Wet thallus, washes twice with distilled water, stores in-80 DEG C of refrigerators, extracts for RNA.Parallel sample is used for measuring cell and does Weight and fat content.Sample named ' YEPD '.

This rhodotorula of standing grain (R.graminis) ATCC32768 carries out limiting the training of nitrogen culture medium in FUS-15L bioreactor Support.Liquid amount 8L, inoculum concentration 10%, temperature 30 DEG C, throughput 0.8vvm, dissolved oxygen controls at 40-50% (dissolved oxygen and stirring connection Dynamic).PH is controlled automatically at 5.6 by dropping 10.0M NaOH and 2MHCl.Take out the cell cultivation having cultivated 24h and 96h respectively The each 50mL of liquid, sample is respectively designated as ' 24h ' and ' 96h '.Centrifugal collection wet thallus, washes twice with distilled water, in-80 DEG C of ice Case stores, extracts for RNA.Parallel sample is used for measuring dry cell weight and fat content [Li YH, Zhao ZK, Bai FW. Enzyme Microb.Technol.2007,41 (3), 312-317].

UtilizePro Red Kit (purchased from Qbiogen, Inc., CA, Cat#:6550-600), in conjunction with-24 sample broke instrument (-24homogenization system, purchased from MP Biomedicals) according to product description, the total serum IgE of rapid extraction ' YEPD ', ' 24h ' and ' 96h ' sample.RNA quality analysis With embodiment 2.Total serum IgE sample is frozen standby in-80 DEG C.The total serum IgE of ' YEPD ', ' 24h ' and ' 96h ' sample is all diluted to 50ng/ μ l, utilizes High Fidelity PrimeScript RT-PCR Kit with gDNA Eraser (purchased from Takara) Synthesis cDNA the first chain, RT system is 10 μ l, and the addition of total serum IgE is 500ng, and other operation is with embodiment 2.

With ACTIN as reference gene, utilize High Fidelity PrimeScript RT-PCR Kit with gDNA Eraser (purchased from Takara), analyzes the expression of perilipin through semiquantitive RT-PCR, and PCR reaction system is 25 μ L:2 × SYBR Primix Ex taq12.5 μ l, upstream primer (10 μm) and each 0.5 μ l of downstream primer (10 μm), RT reacts product Thing 2 μ l, adds ddH₂O to 25 μ l.PCR reaction condition: 95 DEG C of 30sec, it follows that 95 DEG C of 5sec, 60 DEG C of 30sec, carries out 25 altogether Individual circulation.Reaction carries out 2.5% agarose gel electrophoresis after terminating, and utilizes SYNGENE Labworks image acquisition and analysis software (Britain Syngene company) (averag density that i.e. gel software analysis band obtains in theory, uses equivalent to analyze band gray scale CDNA carry out PCR, the amount of the sample mRNA that the gray value of band is corresponding is directly proportional), by ' YEPD ', ' 24h ' and ' 96h ' The band gray value of sample rgrldp1 gene is corrected divided by the band gray value of respective ACTIN reference gene, then distinguishes Analyze in ' YEPD ', ' 24h ' and ' 96h ' sample the expression of the rgrldp1 gene after internal reference rectification.Result shows, In R.graminis ATCC32768, the expression of rgrldp1 gene increases with its fat content and strengthens (table 2), with reality Execute the fat in example 1 to drip proteomics data and match.

Table 2rgrldp1 gene expression dose and fat content correlation analysis

	YEPD	24h	96h
				Intracellular fat content (%)	8.0	36	61
Rgrldp1 gene expression dose	0.7	46.9	139.8

The structure of embodiment 6:RgrLDP1 restructuring Chlamydomonas reinhardtii

Nucleotide sequence according to rgrldp1 designs following primer, and (the underscore part of primer rgrldp1-Kpn-F is KpnI restriction enzyme site, the underscore part of primer rgrldp1-NotI-R is NotI restriction enzyme site):

Rgrldp1-KpnI-F:5 '-CTGGAATTCAACATGTCTGCCGCCACCGAGCAGGC-3’

Rgrldp1-NotI-R:5 '-ATCGCGGCCGCTCACGCCGACGACGAGGACGACG-3’

Primer direction is 5 ' to 3 ' directions.

In embodiment 2 build cloning vector pMD18T-rgrldp1 as template, utilize primer rgrldp1-Kpn-F and Rgrldp1-NotI-R expands rgrldp1 coding region sequence, and PCR fragment, through KpnI/NotI double digestion, connects into same double digestion PChlamy_1 (purchased from Invitrogen, article No.: A14258) carrier (recovery is digested big segment for connecting), convert E.coli DH5a Competent cell, selects that Amp resistant transformants carries out Zengjing Granule, (green skies plasmid is little for plasmid extraction Amount extracts kit, article No.: D0003).The order-checking of TaKaRa company delivered to by recombinant plasmid sample, correctly builds through sequence verification The named pChlamy_1-RgrLDP1 of recombinant plasmid.Scal is utilized to be linearized by recombinant plasmid pChlamy_1-RgrLDP1, then Utilizing DNA to reclaim kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to supplier's proposed steps, (NEP013-2 says Bright book) purified pcr product ,-20 DEG C save backup.

Chlamydomonas reinhardtii (C.reinhardtii) CC-849 is (purchased from microalgae resource center (Chlamydomonas Resource Center)) utilizeTAP culture medium (purchased from Invitrogen, article No.:A1379801) cultivate to OD₇₅₀Value is 0.5, eucalyptus prepares Chlamydomonas reinhardtii CC-849 electrocompetent cell according to kit specification (article No.: A14258), takes 250 μ l impressions State cell, adds the pChlamy_1-RgrLDP1 recombinant plasmid of 2 μ g aforementioned linear, and incubation at room temperature 5min, according to following ginseng Number (voltage 600V, electric capacity 50 μ F, infinite), utilizes Bio-Rad Gene Pulser II to carry out electroporated.Convert After add immediately 5ml TAP-40mM sucrose solution (TAP be purchased from Invitrogen, article No.:A1379801, add 40mM sucrose), In 6 well culture plate 28 DEG C, 50 μ Em^-2s^-1Under the conditions of recovery 24h, then 2000rpm be centrifuged 5min collect frond, coat TAP- Agar-HVgromVcin flat board (TAP is purchased from Invitrogen, article No.:A1379801, add 2% agar powder, 100 μ g/ml tides Mycin), 28 DEG C, 50 μ E m^-2s^-1Under the conditions of cultivate 5d, the hygromycin resistant transformed son of picking, utilize rgrldp1-Kpn-F and Rgrldp1-NotI-R carries out PCR qualification, the named CC-849/pChlamy_1-RgrLDP1 of positive colony.

Restructuring Chlamydomonas reinhardtii CC-849/pChlamy_1-RgrLDP1 inoculation TAP limit nitrogen culture medium (it is abbreviated as TAP-N: Tris alkali 20mM, MgSO₄·7H₂O0.83mM, CaCl₂·2H₂O0.45mM, K₂HPO₄1.65mM, KH₂PO₄1.05mM, glacial acetic acid 0.1% (V/V), trace element solution 1ml/l culture medium, trace element solution formula: Na₂EDTA·2H₂O5g/100ml, ZnSO₄·7H₂O2.2g/100ml, H₃BO₃1.14g/100ml, MnCl₂·4H₂O0.5g/100ml, FeSO₄·7H₂O0.5g/ 100ml, CoCl₂·6H₂O0.16g/100ml, CuSO₄·5H₂O0.16g/100ml, (NH₄)₆Mo₇O₂₄·4H₂O0.11g/ 100ml) 28 DEG C, continuous light 70 μ E m^-2s^-1Under the conditions of cultivate 4d, every 24h sample, stay and do Oil Content Analysis and fluorescence Observation [Moellering Eric R., Benning1Christoph, Eukaryotic Cell2010,9,97-106].Result Find, compared with comparison algae strain Chlamydomonas reinhardtii CC-849, restructuring Chlamydomonas reinhardtii CC-849/pChlamy_1-RgrLDP1 intracellular oil Fat content is increased to 42% by 26%.Meanwhile, fluorescence microscope finds, CC-849/pChlamy_1-during fermentation termination The fat of RgrLDP1 intracellular drips and can occupy more than the 50% of cell volume, and the fat compareing algae strain Chlamydomonas reinhardtii CC-849 drips relatively Less, number is also few, only occupies the volume of intracellular about 20%.Prove the life that rgrldp1 gene can promote Chlamydomonas reinhardtii fat to drip Length and oil and fat accumulation, dramatically increase oil-producing microalgae intracellular fat content.

The structure of the muddy Rhodococcus sp of embodiment 7:RgrLDP1 restructuring

Nucleotide sequence according to rgrldp1 designs following primer, and (the underscore part of primer rgrldp1-BamHI-F is BamHI restriction enzyme site, the underscore part of primer rgrldp1-SacI-R is SacI restriction enzyme site):

Rgrldp1-BamHI-F:5 '-CTGGGATCCATGTCTGCCGCCACCGAGCAGGC-3’

Rgrldp1-SacI-R:5 '-ATCCAGCTCCGCCGACGACGAGGACGACG-3’

Primer direction is 5 ' to 3 ' directions.

Nucleotide sequence according to pGEFPuv designs following primer, and (the underscore part of primer GFPuv-SacI-F is SacI restriction enzyme site, the underscore part of primer GFPuv-XbaI-R is XbaI enzyme cutting site):

GFPuv-SacI-F:5 '-CTCCAGCTCatgagtaaaggagaagaactt-3’

GFPuv-XbaI-R:5 '-TCCTCTAGAttatttgtagagctcatccat-3’

Primer direction is 5 ' to 3 ' directions.

The cloning vector pMD18T-rgrldp1 built in embodiment 2, as template, utilizes primer rgrldp1-BamHI-F Expanding rgrldp1 coding region sequence with rgrldp1-SacI-R, PCR fragment, through BamHI/SacI double digestion, utilizes DNA to reclaim examination Agent box (purchased from Beijing Zhou Ding state, article No.: NEP013-2), purifies according to supplier's proposed steps and is digested large fragment；With pGFPuv Carrier (purchased from clontech) is template, utilizes primer GFPuv-SacI-F and GFPuv-XbaI-R, expands GFPuv fragment, PCR Fragment, through SacI/XbaI double digestion, utilizes DNA to reclaim kit (purchased from Beijing Zhou Ding state, article No.: NEP013-2), according to confession Answer business's proposed steps to purify and be digested large fragment；PJAM2 plasmid [Triccas, J.A., T.Parish, W.J.Britton, and B.Giquel.FEMS Microbiol.Lett.1998,167,151-156] utilize recovery sheet after BamHI/XbaI double digestion Section.Rgrldp1 is digested large fragment, GFPuv is digested large fragment and pJAM2 is digested the mixed in molar ratio that large fragment is by 3: 3: 1, profit Connect cyclisation, Transformed E .coli DH5a Competent cell with T4DNA ligase, select Amp resistant transformants and carry out increasing bacterium Cultivation, plasmid extraction (green skies plasmid Mini Kit, article No.: D0003).TaKaRa company delivered to by recombinant plasmid sample Order-checking, through the named pJAM-RgrLDP1-GFPuv of recombinant plasmid that sequence verification correctly builds.

Utilize electric shock transformation method, by pJAM-RgrLDP1-GFPuv Plastid transformation to muddy Rhodococcus sp (R.opacus) PD630 is (purchased from Germany Culture Collection (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH)), picking resistant transformants carries out PCR qualification, and PCR identifies the named PD630/ of positive transformant PJAM-RgrLDP1-GFPuv [Kalscheuer R, M.Arensko ¨ tter, and A Steinbu ¨ chel.Appl Microbiol Biotechnol1999,52,508-515.].

Muddy for restructuring Rhodococcus sp PD630/pJAM-RgrLDP1-GFPuv is inoculated in containing 0.01g/lNH₄Cl and 10g/l Portugal MSM culture medium [Schlegel H G, H.Kaltwasser, the and G. of grape sodium saccharate Gottschalk.Arch.Mikrobiol.1961,38,209-222.], 28 DEG C, 200rpm, cultivates 24h, samples every 6h, stay It is Oil Content Analysis and fluorescence observation [Jan, Marc, Horst Robenek, Alexander Steinb ü chelAppl.Environ.Microbiol.2006,72 (10), 6743.].It was found that with right Compare according to bacterial strain R.opacus PD630, the muddy Rhodococcus sp PD630/pJAM-RgrLDP1-GFPuv intracellular fat content of restructuring by 60% increases 77%.Meanwhile, fluorescence microscope finds, R.opacus PD630/pJAM-during fermentation termination RgrLDP1-GFPuv intracellular one big fat of formation drips and can occupy more than the 50% of cell volume, and control strain R.opacus The fat of PD630 drips relatively small, only occupies the volume of intracellular about 30%.Prove that rgrldp1 gene can promote muddy Rhodococcus sp Formation, growth and the oil and fat accumulation that fat drips, dramatically increases its intracellular fat content.

The structure of embodiment 8:RgrLDP1 constitutive expression restructuring standing grain this rhodotorula bacterial strain

Nucleotide sequence according to rgrldp1 designs following primer, and (the underscore part of primer rgrldp1-NcoI-F is NcoI restriction enzyme site, the underscore part of primer rgrldp1-EcoRV-R is EcoRV restriction enzyme site):

Rgrldp1-NcoI-F:5 '-CTGCCATGGAACATGGCCACCGTCAACGAGAAGC-3’

Rgrldp1-EcoRV-R:5 '-ATCGAATTCTCACTGCTTCTCCCCCTCGCC-3’

Primer direction is 5 ' to 3 ' directions.

The cloning vector pMD18T-rgrldp1 built in embodiment 3, as template, utilizes primer rgrldp1-NcoI-F Expanding rgrldp1 coding region sequence with rgrldp1-EcoRV-R, PCR fragment, through EcoRV/NcoI double digestion, connects into same double PRH203 [Liu Y, Koh CM, Sun L, Hlaing MM, Du M, Peng N, the Ji L. Appl Microbiol being digested Biotechnol.2013Jan；97 (2): 719-729] downstream (replacing former GFP gene) of RtG3PDH promoter in carrier, turns Change E.coli DH5a Competent cell, select streptomycin resistance transformant and carry out Zengjing Granule, plasmid extraction (the green skies Plasmid Mini Kit, article No.: D0003).The order-checking of TaKaRa company delivered to by recombinant plasmid sample, correct through sequence verification The named pRH203-RgrLDP1 of recombinant plasmid built.PRH203-RgrLDP1 is converted Agrobacterium AGL1 [Lazo GR, Stein PA, Ludwig RA.Biotechnology (N Y) .1991,9 (10), 963-967.].Picking Spectinomycin resistance turns Beggar, utilizes primer rgrldp1-NcoI-F and rgrldp1-EcoRV-R to carry out PCR qualification, the named AGL1/ of positive recombinant pRH203-RgrLDP1.Recombinational agrobacterium AGL1/pRH203-RgrLDP1 is pressed Yanbin Liu et al. method and converts importing standing grain This rhodotorula R.graminis ATCC MYA-4893, the hygromycin resistant transformed son of picking carries out PCR qualification, and positive recombinant is ordered Entitled R.graminis ATCC MYA-4893G3PDH-RgrLDP1 [LiuY, Koh CM, Sun L, Hlaing MM, Du M, Peng N, Ji L. Appl Microbiol Biotechnol.2013Jan；97 (2): 719-729].

By starting strain standing grain this rhodotorula ATCC MYA-4893 and restructuring standing grain this rhodotorula ATCC MYA-4893G3PDH- RgrLDP1 inoculates YEPD culture medium respectively, 30 DEG C, 200rpm, cultivates 3d, samples every 24h, stays and does Oil Content Analysis and glimmering Light observation [Wu SG, Zhao X, Shen HW, Wang Q, Zhao ZK.Bioresour.Technol.2011,102 (2), 1803-1807.].It was found that under the YEPD condition of culture being unfavorable for oil and fat accumulation, with control strain this rhodotorula of standing grain ATCC MYA-4893 compares, and restructuring standing grain this rhodotorula ATCC MYA-4893 G3PDH-RgrLDP1 intracellular fat content adds 3 times, increased to 48% by 12%.Meanwhile, fluorescence microscope finds, recombinate during fermentation termination standing grain this rhodotorula ATCC The fat of MYA-4893 G3PDH-RgrLDP1 intracellular drips and can occupy more than the 60% of cell volume.Prove constitutive expression Rgrldp1 gene, due to by the transcriptional control of former rgrldp1 promoter, so also can promote standing grain under the conditions of nutritious Formation, growth and the oil and fat accumulation that this rhodotorula fat drips, dramatically increases its intracellular fat content.

Although it should be understood that with reference to its exemplary embodiment, the present invention carried out particularly shown and described, It should be understood by those skilled in the art that without departing substantially from by the spirit of the present invention as defined in the claims and model Under conditions of enclosing, the change of various forms and details can be carried out wherein, any combination of various embodiment can be carried out.

Claims

1. oleaginous yeast fat drips an albumen, its protein being made up of the amino acid sequence shown in SEQ ID NO:1.

2. the oleaginous yeast fat encoding claim 1 drips the nucleotide sequence of albumen.

Nucleotide sequence the most according to claim 2, described nucleotide sequence is the DNA molecular shown in SEQ ID NO:2.

4. comprise the recombinant vector of the nucleotide sequence of Claims 2 or 3.

5. a recombinant cell, described cell imports the recombinant vector described in claim 4.

6. the method building grease production recombinant cell, described method includes: by the nucleotides described in Claims 2 or 3 Sequence imports in host cell, obtains grease production recombinant cell.

Method the most according to claim 6, wherein by with the recombinant vector transformed host cell described in claim 4 Import the nucleotide sequence described in Claims 2 or 3.

Method the most according to claim 6, wherein said host cell is selected from yeast, microalgae, Rhodococcus sp Or Escherichia coli (E.coli) (Rhodococcus).

Method the most according to claim 8, wherein said yeast is selected from saccharomyces cerevisiae (Saccharomyces Cerevisiae) or this rhodotorula of standing grain (Rhodotorula graminis), described microalgae is selected from chlamydomonas (Chlamydomonas) Or Synechococcus (Synechococcus sp.), described Rhodococcus sp is muddy Rhodococcus sp (Rhodococcus opacus).

Method the most according to claim 9, wherein said chlamydomonas is Chlamydomonas reinhardtii (Chlamydomonas reinhardtii)。