TWI665302B - Genetically modified microorganisms for producing long-chain dicarboxylic acid and method of using thereof - Google Patents

Abstract

It is described as a genetically modified microorganism for producing a long-chain dicarboxylic acid and a method of using the same. The present invention provides a genetically modified microorganism comprising a first nucleic acid encoding a Umbellularia californica lauroyl-acyl carrier protein (ACP) thioesterase (BTE) Operates operably to a promoter; and a second nucleic acid encoding a Cocos nucifera lauryl-mercapto carrier protein thioesterase (FatB3) operably linked to a promoter Wherein the microorganism produces an increasing amount of long-chain dicarboxylic acids compared to the unmodified parent of the microorganism.

Description

Genetically modified microorganism for producing long-chain dicarboxylic acid and method of using same

The present invention relates to genetically modified microorganisms for producing long chain dicarboxylic acids and methods of using the same.

Long carbon chain nylon (nylon) is a high performance and high value chemical due to its unique thermal, physical, chemical and mechanical properties. Nylon 12 (nylon 12) is a special resin designed to make fuel lines and brake systems. Nylon 12 is generally priced at 10-12 Euro/kg. For high grade nylon 12, the price is usually higher than 15 Euro/kg. Due to the recent devastating explosion of the world's largest nylon 12 supplier, Evonik, at a German plant, at least the lack of short-term supply of long carbon chain nylon seems inevitable. A review of the chemical process shows that the explosion caused by the contact of high activity catalyst (Et ₂ AlCl) with water is the main risk factor. Therefore, a safe process for producing long chain dicarboxylic acids is needed.

Described below as a genetically modified microorganism comprising a first nucleic acid encoding a Umbellularia californica lauroyl-acyl carrier protein (ACP) thioesterase ( BTE) operably linked to a promoter; and a second nucleic acid encoding a Cocos nucifera lauryl-mercapto carrier protein thioesterase (FatB3) operably linked to a A promoter in which the microorganism produces an increasing number of long-chain dicarboxylic acids compared to the unmodified parent of the microorganism.

Compared to the unmodified parent of the microorganism, the microorganism exhibits a lower degree of palmitoyl-acyl carrier protein (ACP) thioesterase. For example, the microorganism can include an expression construct that exhibits an siRNA for inhibiting the expression of the palmitoyl-thiol carrier protein thioesterase.

The microorganism may further comprise one or more additional nucleic acids each encoding a acetyl-coenzyme A carboxylase (ACC), a fatty acid synthase (FSA) subunit, a cell A cytochrome P450 reductase (CPR), a long chain alcohol oxidase (eg, FAO1) or a long chain alcohol dehydrogenase (eg, FADH). Each nucleic acid is operably linked to a promoter.

In one embodiment, the microorganism has a loss-of-function mutation in an acyl-coenzyme A oxidase gene, such as pox2 or pox5 , or fadD .

The microorganism may have a modified acyl-coenzyme A synthetase gene, such as acs , which results in a reduction in the accumulation of triglyceride in the microorganism to increase the synthesis of long chain two A fatty acid pool of carboxylic acid.

In one embodiment, the microorganism has a downwardly adjusted citric acid cycle citric synthetase gene, such as gltA . This microorganism has a pool of glucose raw materials for increasing fatty acid synthesis.

In one embodiment, the microorganism has a downwardly adjusted acetic acid monophosphate adenosine to form AMP (Adenosine monophosphate-forming acetyl-coenzyme A synthetase). This microorganism has a pool of raw materials for fatty acid synthesis.

In one embodiment, the microorganism is Yarrowia lipolytica or Escherichia coli .

Further described herein is a process for producing a long chain dicarboxylic acid. The method comprises providing the genetically modified microorganism described herein, at pH 6 to 8, in the case of allowing the production of a long chain dicarboxylic acid, culturing the microorganism in a medium containing glucose or glycerol, whereby The microorganism produces the long chain dicarboxylic acid. This method may further comprise a step of collecting the long chain dicarboxylic acid.

In one embodiment, the long chain dicarboxylic acid is a C10-C18 dicarboxylic acid, for example, a C12 dicarboxylic acid.

The details of one or more embodiments are set forth in the accompanying drawings and description. Other features, objects, and advantages of the embodiments are apparent from the description and drawings.

Figure 1 is a schematic diagram showing a modified alpha, ω-dicarboxylic acid metabolic pathway.

Figure 2 is a schematic diagram showing the construction of a modified Y. lipolytica .

Figure 3 is a graph showing HPLC analysis of a dicarboxylic acid standard.

Figure 4 is a graph showing the fatty acid content of the Δ pox2 and Δ pox5 mutant strains.

Figure 5 is a schematic diagram showing the construction of various modified Yarrowia lipolytica strains.

6 a schematic view graph showing performance for a umbellularia (Umbellularia californica) lauryl acyl - acyl carrier protein thioesterase (lauroyl-acyl carrier protein (ACP ) thioesterase) (BTE) and a coconut (Cocos nucifera) lauryl acyl - acyl carrier protein thioesterase (FatB3) performance of a cassette (expression cassette).

Figure 7 is a schematic diagram showing the construction of an RNAi-expressing cassette for quenching the expression of the palmitoyl-acyl carrier protein (ACP) thioesterase gene.

Figure 8 is a set of graphs showing the dicarboxylic acid produced by two modified Yarrowia lipolytica strains.

Figure 9 is a schematic diagram showing the modification to characterize the construction of E. coli strains. A modified nucleotide of the California laurel laurel-mercapto-carrier protein thioesterase (BTE) and a modified nucleotide of the coconut laurel-mercapto-carrier protein thioesterase (FatB3) Expression cassette).

Figure 10 is a graph showing HPLC analysis of a dicarboxylic acid sample.

Figure 11 is a schematic diagram showing the modification to characterize the construction of E. coli strains. Left panel: a performance cassette in strain E2; right panel: a performance cassette in strain E3.

Figure 12 shows the amount of TCA cycle product produced by strain E2 and strain E3.

Figure 13 is a schematic diagram showing the modified performance of the expression in E. coli strain E4.

Figure 14 shows the amount of dicarboxylic acid produced by strain E2 and strain E4.

Figure 15A shows the construction method of strain E5.

Figure 15B is a schematic diagram showing the performance of the modified cassette for expression of E. coli strain E5.

Figure 15C shows a schematic diagram of the Red/ET enhanced FLP expression plasmid, 707-FLPe.

Figure 16 shows the amount of dicarboxylic acid produced by strain E5 and strain E6.

Figure 17A shows the construction method of strain E6.

Figure 17B is a schematic diagram showing the modified performance of the expression in E. coli strain E6.

In the following detailed description, numerous specific details are set forth However, it will be apparent that one or more embodiments may be implemented without these details. In other instances, well-known structures or devices are shown for the purpose of illustration.

Described below are genetically modified microorganisms for producing long chain dicarboxylic acids and methods of using the same.

In order to improve the production of dicarboxylic acids, we aim at a microbial alpha, omega-dicarboxylic acid metabolic pathway. See Figure 1. Our strategies include, for example, increasing free fatty acid content, enhancing the substrate specificity of ω-oxidation enzymes, and increasing key genes in fatty acid synthesis (acetamide coenzyme A carboxylase (acetyl) -coenzyme A carboxylase (ACC) gene, fatty acid synthase (FAS) gene expression, knockout upstream genes of β-oxidation ( pox or fadD ), reduce fatty acid degradation, eliminate citric acid The citric synthetase gene ( gltA ) increases fatty acid synthesis and eliminates the acyl-coenzyme A synthetase gene ( acs ), reduces the accumulation of triglyceride, and increases the monophosphate of acetic acid. Glycosides form AMP (Adenosine monophosphate-forming acetyl-coenzyme A synthetase, AceCS), increase fatty acid synthesis, and enhance lauroyl-acyl carrier protein (ACP) thioesterase Genes (eg, Cocos nucifera FatB3 gene and Umbellularia californica BTE gene expression, reduction / silence palm 醯 - 醯The performance of the palmitoyl-acyl carrier protein (ACP) thioesterase and the establishment of ω-oxidation metabolic pathway genes (eg, cpr, fao1 and fadH ). We constructed a stable yeast and E. coli protein. A performance system to improve the production of nylon-α,ω-dicarboxylic acid.

Thus, a genetically modified microorganism can comprise a nucleic acid encoding a California laurel laurel-mercapto carrier protein thioesterase (BTE). It may further comprise a nucleic acid encoding a coconut laurel-mercapto carrier protein thioesterase (FatB3).

The genetically modified microorganism may also have a nucleic acid encoding one Acetyl-CoA carboxylase (ACC), a fatty acid synthase (FAS) subunit, a cytochrome P450 reductase (CPR), a long-chain alcohol oxidase (eg, FAO1), or a long Alcohol dehydrogenase (eg, FADH).

Each of the above nucleic acids is operably linked to a suitable promoter for gene expression in the modified microorganism. The sequence of the nucleic acid may also be codon-optimized for expression in a genetically modified microorganism, as appropriate or desired.

The performance of the palmitoyl-mercapto carrier protein thioesterase can be reduced or silenced in the modified microorganism. Such a microorganism may have a mutation (eg, deletion) in the palmitoyl-thiol carrier protein thioesterase gene, or may have a representation construct that exhibits an RNAi molecule targeted for this gene.

Genetically modified microorganisms may also include a loss-of-function mutation in an acyl-CoA oxidase gene (eg, Yarrowia lipolytica pox2 or pox5 , Escherichia coli fadD ). For example, the microorganism may have a deletion in one of these genes.

Further, the genetically modified microorganism may also include a loss of function mutation in an acyl-CoA synthetase gene. Examples of the above-mentioned 醯Kytozyme A synthetase gene may include, but are not limited to, acs .

Furthermore, the genetically modified microorganism may also include a loss of function mutation in a citric synthetase gene. Examples of the above citrate synthase gene may include , but are not limited to, gltA .

The nucleic acid sequence of the above-mentioned enzyme and the amino acid sequence are shown below.

Yarrowia lipolytica, coenzyme A carboxylase, biotin carboxylase (ACC)

Nucleic acid sequence (sequence identification number: 1)

Amino acid sequence (sequence identification number: 2)

Escherichia coli acetaminophen coenzyme A carboxylase/carboxytransferase subunit α (Acetyl-CoA carboxylase carboxyl transferase subunit α, AccA)

Nucleic acid sequence (sequence identification number: 3)

Amino acid sequence (sequence identification number: 4)

Acetyl-CoA carboxylase biotin carboxyl carrier protein (AccB) (BCCP)

Nucleic acid sequence (sequence identification number: 5)

Amino acid sequence (sequence identification number: 6)

Acetyl-CoA biotin carboxylase (Accyl)

Nucleic acid sequence (sequence identification number: 7)

Amino acid sequence (sequence identification number: 8)

Acetyl-CoA carboxylase transferase subunit β (Accyl)

Nucleic acid sequence (sequence identification number: 9)

Amino acid sequence (sequence identification number: 10)

Fatty acid synthase subunit alpha (FASA)

Nucleic acid sequence (sequence identification number: 11)

Amino acid sequence (sequence identification number: 12)

Fatty acid synthase subunit beta (FASB)

Nucleic acid sequence (sequence identification number: 13)

Amino acid sequence (sequence identification number: 14)

Acetyl-CoA carboxylase transferase subunit β (Accyl)

Nucleic acid sequence (sequence identification number: 15)

Amino acid sequence (sequence identification number: 16)

Fatty acid synthase subunit alpha-active site 1, FASA-1

Nucleic acid sequence (sequence identification number: 17)

Amino acid sequence (sequence identification number: 18)

California Laurel Lauryl-Based Carrier Protein Thioesterase (BTE)

Nucleic acid sequence ( Yarrowia codon optimization) (SEQ ID NO: 19)

Amino acid sequence (sequence identification number: 20)

Modified California Laurel Laurel-Based Carrier Protein Thioesterase (BTE△NC)

Nucleic acid sequence ( Escherichia coli codon optimization) (SEQ ID NO: 21)

Amino acid sequence (SEQ ID NO: 22)

Coconut Laurel-Based Carrier Protein Thioesterase (FatB3)

Nucleic acid sequence ( Yarrowia codon optimization) (SEQ ID NO: 23)

Amino acid sequence (sequence identification number: 24)

Modified coconut laurel-mercapto carrier protein thioesterase (FatB3△NC)

Nucleic acid sequence ( Escherichia coli codon optimization) (SEQ ID NO: 25)

Amino acid sequence (sequence identification number: 26)

Yarrowia lipolytica palmitoyl-mercapto carrier protein thioesterase

Nucleic acid sequence (sequence identification number: 27)

Amino acid sequence (sequence identification number: 28)

Candida tropicalis cytochrome P450 reductase (CPR) (CTP 00485)

Nucleic acid sequence (sequence identification number: 29)

Amino acid sequence (sequence identification number: 30)

Candida cytochrome P450 reductase (CPR)

Nucleic acid sequence ( Escherichia coli codon optimization) (SEQ ID NO: 31)

Amino acid sequence (sequence identification number: 32)

Candida albicans oxidase (FAO1)

Nucleic acid sequence (sequence identification number: 33)

Amino acid sequence (sequence identification number: 34)

Candida albicans oxidase (FAO1)

Nucleic acid sequence (SEQ ID NO: 35) ( Escherichia coli codon optimization)

Amino acid sequence (sequence identification number: 36)

Candida albicans long-chain alcohol dehydrogenase (FADH)

Nucleic acid sequence (sequence identification number: 37)

Amino acid sequence (sequence identification number: 38)

Candida aldehyde dehydrogenase (FADH)

Nucleic acid sequence ( Escherichia coli codon optimization) (SEQ ID NO: 39)

Amino acid sequence (SEQ ID NO: 40)

Acyl-coenzyme A oxidase (POX2)

Nucleic acid sequence (SEQ ID NO: 41)

Amino acid sequence (SEQ ID NO: 42)

Acyl-coenzyme A oxidase (POX5)

Nucleic acid sequence (sequence identification number: 43)

Amino acid sequence (SEQ ID NO: 44)

Acyl-coenzyme A oxidase (FadD)

Nucleic acid sequence (sequence identification number: 45)

Amino acid sequence (sequence identification number: 46)

Escherichia coli ATP forms Adenosine monophosphate (AMP)-forming acetyl-CoA synthetase

Nucleic acid sequence (SEQ ID NO: 47)

Amino acid sequence (sequence identification number: 48)

Escherichia coli, acyl-CoA synthetase

Nucleic acid sequence (SEQ ID NO: 49)

Amino acid sequence (sequence identification number: 50)

E. coli citrate synthetase

Nucleic acid sequence (sequence identification number: 51)

Amino acid sequence (sequence identification number: 52)

As used herein, the term "promoter" means a nucleotide sequence comprising an element that initiates transcription of an operably linked nucleic acid sequence in a desired host cell. At least, a promoter comprises an RNA polymerase binding site. It may further comprise one or more, by definition, an enhancer element that enhances transcription, or one or more regulatory elements that control the state of the promoter on/off. A promoter can be an inducible or constitutive promoter, ie, GAP (glyceraldehyde-3-phosphate dehydrogenase) and FBAin (fructose-1,6) -6-bisphosphate aldolase intron) and beta-lactamase (bla, conferring ampicillin resistance) and lac operon (lactose operon) (lactose operon) The promoter is bacteriophage with two bacteriophages, namely, T7 and SP6.

Using a method known in the art and described herein, one of the expression enzymes used to express any of the above enzymes can be introduced into a suitable host cell to produce a genetically modified microorganism.

For long chain dicarboxylic acid production, the modified microorganism can then be cultured in a suitable medium. For example, the medium may contain glucose and glycerol as a carbon source. The dicarboxylic acid, particularly DCA12, can be separated from the culture medium after a sufficient period of cultivation.

Suitable host cells include, but are not limited to, Candida tropicalis , Candida albicans , Candida cloacae , Escherichia coli , and Y. Yeast ( Yarrowia lipolytica ).

The above genetically modified microorganism can be constructed by methods known in the art, for example, recombinant technology. A sequence encoding any of the above enzymes can be operably linked to a suitable promoter to produce a performance cassette which can then be introduced into a host cell.

Methods known in the art and described above can be used to eliminate a gene or reduce the performance of a gene in a genetically modified microorganism.

The following specific examples are to be construed as illustrative only and not in any way limiting the scope of the disclosure. Without further elaboration, it is believed that those of ordinary skill in the art have the <RTIgt;

Example

Materials and Methods

Construction of the Yarrowia expression system

Since the Yersinia expression system is similar to the Pichia sp . expression system, the Yarrowia genus expression system used in this study is based on P. pastoris. ( Pichia pastoris ) designed by the performance system. A construct for single/double-crossover homologous recombination is designed to insert an ω-oxidation gene into a Y. cerevisiae strain acyl coenzyme A oxidase (acyl coenzyme A) The oxidase gene ( pox1-5 ) is used to eliminate the β-oxidation activity of the strain. Geneticin was used as a screening marker. A schematic view of the structure is shown in Fig. 2.

A fusion construct using a splice overlap extension (SOE) polymerase chain reaction (PCR) to construct a fusion construct comprising pox2 or pox5 and a screening marker (Kan::G418) (see Figure 2) . The fusion construct was cloned into the pUC19 vector. This fusion construct was used to generate pox2 and pox5 -deficient strains. Our analysis shows that this strategy significantly reduces the need for strain strain replication and DNA purification steps. The polymerase chain reaction product can be used to directly transform a strain and increase efficiency.

Construction of the Escherichia coli expression system

The E. coli expression system used in this study used vector replication to achieve protein expression and was designed to knock out the acyl coenzyme A oxidase gene ( fadD ) of the Escherichia coli strain to make the strain β - Oxidative activity is lost, and spectinomycin and kanamycin are used as screening markers. A schematic view of the structure is shown in Fig. 9.

Construction of genetically modified strains of Escherichia

An electroporation method is used to introduce the construct into the cell. First, Yarrowia cells were cultured in TE/LiAc/H ₂ O for 30 minutes, and then washed with sorbitol to obtain competent Yarrowia cells. The construct is then introduced into the cells via electroporation. Anti-antibiotic transformants were screened using 50-500 [mu]g/mL geneticin.

Medium and conditions

YNB culture conditions - 0.17% YNB without amino acid, 0.5% ammonium sulfate (sammonium sulphate), 2% glucose, 0.15% yeast extract, 0.5% NH ₄ Cl, 0.01% uracil (uracil) 2% casein amino acids and 0.02% Tween-80.

1. The initial pH was at 6.0 and was incubated at 26 ° C for 48 hours (no pH control).

2. Add an additional 2% glucose to maintain the pH of the medium at 7.5 ± 0.1 (control pH, adjusted every 6 hours).

3. In this manner, dicarboxylic acid production was controlled, and the degree of glucose (maintained at about 0.5%) was monitored, cultured for 5 days, and cells and culture medium were collected for analysis.

NL culture conditions - 10% glucose, 0.85% yeast extract and 0.3% peptone.

1. The initial pH was at 6.2 (glycerol, 6.4) and incubated at 28 °C for 3 days (uncontrolled pH).

2. Collect cells for solvent extraction and dicarboxylic acid analysis.

LB culture conditions - 1% glucose, 1% yeast extract.

1. The initial pH was 6.0 and cultured for 3 days at 30 ° C (pH 7.5 was started on day 2).

2. Collect cells for solvent extraction and dicarboxylic acid analysis.

DCA Analysis - GC

1. Adjust 5 mL culture to pH 10.0 and then centrifuge it. The supernatant was collected and the pH was adjusted to pH 2.0. A pellet was collected.

2. Add 14% BF3-methanol (0.1 mL) and 0.2 mL hexane to the sample and heat at 80-90 °C for 60 minutes. Add 0.2mL of salt solution (saline Solution), followed by the addition of 0.5 mL of hexane. Perform a GC analysis.

DCA analysis-HPLC

1. 5 mL of ethyl acetate was added to 5 mL of the culture, and the cells were disrupted in a Beatbeader Ultrasonic Vibrator for about 1 minute and centrifuged at 6000 rpm. Collect the supernatant.

2. Evaporate the solvent from the supernatant. 1 mL of 99.5% ethanol was added to dissolve the extract. The samples were then analyzed by HPLC. See Figure 3.

Instrument: Shimadzu 20ALC

Column: Vercogel 120-5 C8, 5um, 4.6×250mm (Vercopak no.15835)

Eluent:

A: 0.1% TFA in H ₂ O

B: AeCN

Flow rate: 1.0ml/min

Column oven: 30 ° C

Detection: UV 220nm

Samples: citric acid (CA), sebacic acid (C10 DCA), dodecanedioic acid (C12 DCA), tetradecanedioic acid (C14 DCA) ), hexadecanedioic acid (C16 DCA), octadecanedioic acid (octanedecanedioic acid)(C18 DCA)

Injection: 10μl

result

(1) in the removed acyl coenzyme A oxidase (acyl coenzyme A oxidase) gene (pox 2 or pox 5), our data show that, compared to pox5 mutant strain, a mutant strain accumulated more POX2 fatty acids. It has a 20% increase compared to the wild type. See Figure 4.

(2) Using the targeted gene knockout method described above, we constructed four strains of Y. lipolytica (ω1, ω2, ω3, and ω4). See Figure 5.

(3) The wild type Yarrowia lipolytica was cultured in YPD medium for 1 day, and then inoculated into 250 ml of YNB medium (10% glucose or glycerol) at a starting pH of 6.18 or 6.42, and cultured in a shake. The bottle was shaken for 5 days without pH control. The dicarboxylic acid production was measured. See Table 1.

(4) The strain ω4 was cultured in YPD medium for 1 day, and then inoculated into 500 ml of NL medium at an initial pH of 5.0, and cultured in a fermentation tank. Not in the (fermenter) pH. The dicarboxylic acid production was measured. See Table 2.

(5) We constructed three Yarrowia lipolytica strains yBF (wild type added BTE, wild type added to FatB3 and wild type added BTE and FatB3, respectively), which showed single or mixed lauryl-mercapto carrier protein sulfur Lauroyl-acyl carrier protein (ACP) thioesterase (BTE, from Umbellularia californica ) and lauryl-mercapto carrier protein thioesterase (FatB3 from Cocos nucifera ). See Figure 6.

The strain yBF was cultured in YPD medium for 1 day, after which it was inoculated into 250 ml of NL or BMGY medium, and cultured in a shake flask for 7 days. BMGY medium - 2% peptone, 1% yeast extract, 100 mM potassium phosphate pH 6.0, 1.34% yeast nitrogen base (w/o AA), 0.4 μg/mL biotin (biotin) With 1% glycerol. Measurement free Fatty acid production. See Table 3.

Wild type - B, F, B / F represent wild type added BTE, wild type added to FatB3 and wild type added BTE and FatB3 respectively

¹ : NL medium; ² : BMGY medium / 3 days; ³ : BMGY medium / 7 days

(6) The strain ω5 (stored in the Bioresource Conservation and Research Center of the Republic of China Food Industry Development Institute on December 10, 1983, with the registration number BCRC 920096) (ω4 strain added to BTE and FatB3) was cultured in YNB medium. The initial pH was 6.18 and was cultured in a fermenter for 6 days without pH control. The dicarboxylic acid production was measured. See Table 4.

(7) By using RNA interference (palmitoyl ACP-thioesterase, Figure 7), we constructed ω5:: △ palmitoyl-fluorenyl The carrier protein thioesterase (strain ω6, deposited at the Bioresource Conservation and Research Center of the Republic of China Food Industry Development Institute on December 10, 1983, with accession number BCRC 920097) to reduce DCA12 degradation.

(8) The strain ω6 was cultured in YNB medium at an initial pH of 6.18, and cultured in a shake flask for 5 days without pH control. The dicarboxylic acid production was measured. See Table 5.

table 5

(9) The strains ω5 and ω6 were cultured in YPD medium for 1 day, and then inoculated into 250 ml of YNB medium (2% glucose) in a shake flask. The pH was maintained at 6.0 for 2 days. Additional 2% glucose was added every 6 hours to maintain the pH at 7.5 for 5 days. In terms of ω5, the production of DCA12 increased from 12.9% to 51.2% (1.23 g/L) compared to ω4. In terms of ω6, the production of DCA12 increased to 59.8% (2.35 g/L). See Figure 8 and Table 6.

(10) We constructed the strain ω6::AccD::FASA-1(ω7) ( deposited on December 10, 103, the National Center for Bioresource Conservation and Research of the Republic of China Food Industry Development Institute, the registration number is BCRC 920098). The strain ω7 was cultured in YNB medium for 6 days without pH control. The dicarboxylic acid production was measured. See Table 7.

(11) The strain ω7 was cultured in YNB medium under stirring at 300 rpm and 1 vvm in a fermenter, maintaining the pH at 6.0 for 2 days, and then adding an additional 2% glucose every 6 hours to maintain The pH is 6.0 for 5 days. The dicarboxylic acid production was measured. See Table 8.

(12) The strain ω7 was cultured in YNB medium under stirring at 300 rpm and 1 vvm in a fermenter, maintaining the pH at 6.0 for 2 days, and then adding an additional 2% glucose every 6 hours to maintain The pH is 7.5 for 5 days. The dicarboxylic acid production was measured. See Table 9.

Other embodiments

1. Strain BTE△NC::FatB3::CPR::FAO::FADH(E1)

We constructed the strain BTE△NC::FatB3::CPR::FAO::FADH(E1). Referring to Figure 9, pHS-B+F is inserted into BTE△NC and FatB3 in Acc6I/SalI and HindIII/BamHI in pHS vector, and pHR-CFF is in BpHHI/EcoRI and SalI/HindIII and XhoI in pHR vector respectively. Insert CPR with FAO and FADH.

In a fermenter, strain E1 was cultured in YNB and LB medium under stirring at 300 rpm and 1 vvm to maintain the pH at 6.0 for 1 day, and then add 1% glucose every 6 hours to maintain the pH. 7.5 up to 2 day. The dicarboxylic acid production was measured, and the dicarboxylic acid was produced to 0.2 g. See Figure 10.

2. Strain BTE△NC::CPR::FAO::FADH(E2) and strain BTE△NC::AceCS::CPR::FAO::FADH(E3)

We constructed the strain BTE△NC::CPR::FAO::FADH(E2) and the strain BTE△NC::AceCS::CPR::FAO::FADH(E3). Referring to Fig. 11, pHS-B is inserted into BTE△NC in Acc65I/BamHI in pHS vector, pHS-B+AceCS is inserted into BTE△NC and AceCS, pHR in Acc6I/SalI and HindIII/BamHI in pHS vector respectively. -CFF is the insertion of CPR and FAO and FADH in BamHI/EcoRI and SalI/HindIII and XhoI, respectively, in a pHR vector.

In a fermenter, strains E2 and E3 were cultured in LB medium under stirring at 300 rpm and 1 vvm to maintain the pH at 6.0 for 1 day, and then add 1% glucose every 6 hours to maintain the pH. 7.5 for 2 days. Acetic acid production was measured, while E3 acetic acid production was 0.14 g lower than E2. See Figure 12.

3. Strain BTE△NC::CPR::FAO::FADH(E2) and strain ACC::BTE△NC::FatB3::CPR::FAO::FADH(E4)

We constructed the strain BTE△NC::CPR::FAO::FADH(E2) and the strain ACC::BTE△NC::FatB3::CPR::FAO::FADH(E4). Referring to Figure 13, pHSR-ACC was inserted into AccA, AccBC, and AccD in NdI/SpeI, SpeI/EagI, and EagI/XhoI, respectively, in the pHSR vector. pHS-B+F is inserted into BTE△NC and FatB3 in Acc6I/SaI and HindIII/BamHI in pHS vector, and pHR-CFF is inserted into CPR, FAO and BamHI/EcoRI, SalI/HindIII and XhoI in pHR vector respectively. FADH.

Stirring at 300 rpm and 1 vvm aeration in a fermenter Next, strains E2 and E4 were cultured in LB medium, the pH was maintained at 6.0 for 1 day, and then an additional 1% glucose was added every 6 hours to maintain the pH at 7.5 for 2 days. The acetic acid production was measured while the dicarboxylic acid was up to 0.36 g. See Figure 14.

4. Strain Δacs::CPR::FAO::FADH(E5)

We constructed the strain Δacs::CPR::FAO::FADH(E5). See Figures 15A and 15B. Figure 15A shows the construction method of strain E5. Step (1): production of a PCR product from a functional cassette having a homology arm and a FRT position on both sides (introduction of the strain gene acs deletion: atgcgctatgccgattttccaacgctggttgatgctttggactacgccgcaattaaccctcactaaagggcg (sequence identification number: 53); Reverse primer: tcatgccagggattcctgcacatgaagactggcagcataagccttctgattaatacgactcactatagggctc (SEQ ID NO: 54)); Step (2): transfection of pRedET to E. coli host; step (3): induction of Red/ET recombinant gene and subsequent linear PCR product for E. coli host Transformation; step (4): Red/ET recombinant inserts the functional cassette into the locus; step (5): Red/ET enhanced FLP expression plasmid (Red/ET enhanced FLP expression plasmid ), 707-FLPe (see Figure 15C), transformed to complete step (4) strain; and step (5): red/ET and 707-FLPe in the strain for homologous gene exchange, and then by Red/ET The resulting kanamycin is shaved, and the target gene deletion strain without the selection marker is completed, so as to facilitate the subsequent selection of the same screening marker. The body (see Figure 15B) is transformed into the aforementioned target gene deletion strain without leaving the kanamycin in the deletion strain, so that the same kanamycin-bearing plastid can no longer be transformed into the target gene deletion strain. Steps (5) to (6) are genetic manipulation means for facilitating the subsequent gene work, and if steps (5) to (6) are not carried out, the target gene deletion is also completed. Figure 15B shows that pHR-CFF is the insertion of CPR and FAO and FADH in BamHI/EcoRI and SalI/HindIII and XhoI, respectively, in the pHR vector.

In a fermenter, strain E5 was cultured in LB medium under stirring at 300 rpm and 1 vvm to maintain the pH at 6.5 for 1 day, and then add 1% glucose every 6 hours to maintain the pH at 7.5. 2 days. The dicarboxylic acid production was measured, and the dicarboxylic acid was produced to 0.05 g. See Figure 16.

5. Strain ΔgltA::CPR::FAO::FADH(E6)

We constructed the strain ΔgltA::CPR::FAO::FADH(E6). See Figures 17A and 17B. Figure 17A shows the construction method of strain E5. Step (1): Production of a PCR product derived from a functional cassette having a homologous arm and a FRT position on both sides (the forward gene of the strain gene gltA deletion: atggctgatacaaaagcaaaactcaccctcaacggggatacagctgttgaaattaaccctcactaaagggcg (SEQ ID NO: 55); reverse primer: taacgcttgatatcgcttttaaagtcggtttttttcatatcctgtatacataatacgactcactatagggctc (SEQ ID NO: 56)); Step (2): transfection of pRedET to E. coli host; step (3): induction of Red/ET recombinant gene and subsequent transformation of linear PCR product to E. coli host; (4): Red/ET recombinant inserts the functional cassette into the target site; step (5): Red/ET enhanced FLP expression plastid, 707-FLPe (see Figure 15C), transformed to completion Step (4) strain; and step (5): Red/ET and 707-FLPe in the strain are homologous gene exchange, and then the kanamycin produced by Red/ET is shaved, and then the target gene deletion without the screening marker is completed. The strain, in order to facilitate subsequent transformation of the plastid with the same screening marker (see Figure 17B) to the aforementioned target gene deletion strain, without retaining kanamy due to the deletion strain The cin makes the same kanamycin-bearing plastid no longer transformable to the target gene deletion strain. Steps (5) to (6) are genetic manipulation means for facilitating the subsequent gene work, and if steps (5) to (6) are not carried out, the target gene deletion is also completed. Figure 17B shows that pHR-CFF is the insertion of CPR and FAO and FADH in BamHI/EcoRI and SalI/HindIII and XhoI, respectively, in the pHR vector.

In a fermenter, strain E5 was cultured in LB medium under stirring at 300 rpm and 1 vvm to maintain the pH at 6.5 for 1 day, and then add 1% glucose every 6 hours to maintain the pH at 7.5. 2 days. The dicarboxylic acid production was measured, and the dicarboxylic acid was produced to 0.02 g. See Figure 16.

All of the features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be replaced by an alternative feature that is suitable for the same, equal or similar purpose. Accordingly, unless expressly stated otherwise, the disclosed features are only one example of equivalent or similar features of the general series.

From the above, those skilled in the art can easily identify the necessary features of the embodiments, and various changes and modifications of the embodiments can be made to the present invention without departing from the spirit and scope thereof. Various uses and situations. Therefore, other embodiments are also within the scope of the patent application. It will be apparent to those skilled in the art that various modifications and changes can be made to the disclosed embodiments. It is intended that the specification and embodiments be regarded as illustrative only

【Biomaterial Storage】

Domestic registration information [please note according to the registration authority, date, number order]

Ω5 strain

Bioresource Conservation and Research Center of the Republic of China Food Industry Development Institute

December 10, 103, Republic of China

BCRC 920096

2. ω6 strain

Bioresource Conservation and Research Center of the Republic of China Food Industry Development Institute

December 10, 103, Republic of China

BCRC 920097

3. ω7 strain

Bioresource Conservation and Research Center of the Republic of China Food Industry Development Institute

December 10, 103, Republic of China

BCRC 920098

<110> Institute of Industrial Technology

<120> Genetically modified microorganism for producing long-chain dicarboxylic acid and method of using the same

<130> 0954-A24600TW

<150> US 62/032,956

<151> 2014-08-04

<160> 56

<170> PatentIn version 3.5

<210> 1

<211> 6801

<212> DNA

<213> Yarrowia lipolytica

<400> 1

<210> 2

<211> 2266

<212> PRT

<213> Yarrowia lipolytica

<400> 2

<210> 3

<211> 960

<212> DNA

<213> Escherichia coli

<400> 3

<210> 4

<211> 319

<212> PRT

<213> E. coli

<400> 4

<210> 5

<211> 471

<212> DNA

<213> E. coli

<400> 5

<210> 6

<211> 156

<212> PRT

<213> E. coli

<400> 6

<210> 7

<211> 1350

<212> DNA

<213> E. coli

<400> 7

<210> 8

<211> 449

<212> PRT

<213> E. coli

<400> 8

<210> 9

<211> 915

<212> DNA

<213> E. coli

<400> 9

<210> 10

<211> 304

<212> PRT

<213> E. coli

<400> 10

<210> 11

<211> 5553

<212> DNA

<213> Yarrowia lipolytica

<400> 11

<210> 12

<211> 1850

<212> PRT

<213> Yarrowia lipolytica

<400> 12

<210> 13

<211> 6261

<212> DNA

<213> Yarrowia lipolytica

<400> 13

<210> 14

<211> 2086

<212> PRT

<213> Yarrowia lipolytica

<400> 14

<210> 15

<211> 1635

<212> DNA

<213> Yarrowia lipolytica

<400> 15

<210> 16

<211> 544

<212> PRT

<213> Yarrowia lipolytica

<400> 16

<210> 17

<211> 792

<212> DNA

<213> Yarrowia lipolytica

<400> 17

<210> 18

<211> 263

<212> PRT

<213> Yarrowia lipolytica

<400> 18

<210> 19

<211> 903

<212> DNA

<213> California Laurel ( Umbellularia californica )

<400> 19

<210> 20

<211> 300

<212> PRT

<213> California Laurel

<400> 20

<210> 21

<211> 831

<212> DNA

<213> California Laurel

<400> 21

<210> 22

<211> 276

<212> PRT

<213> California Laurel

<400> 22

<210> 23

<211> 1245

<212> DNA

<213> Coconut ( Cocos nucifera )

<400> 23

<210> 24

<211> 414

<212> PRT

<213> Cocos nucifera

<400> 24

<210> 25

<211> 894

<212> DNA

<213> Cocos nucifera

<400> 25

<210> 26

<211> 297

<212> PRT

<213> Cocos nucifera

<400> 26

<210> 27

<211> 930

<212> DNA

<213> Yarrowia lipolytica

<400> 27

<210> 28

<211> 309

<212> PRT

<213> Yarrowia lipolytica

<400> 28

<210> 29

<211> 2043

<212> DNA

<213> Candida tropicalis

<400> 29

<210> 30

<211> 680

<212> PRT

<213> Candida

<400> 30

<210> 31

<211> 2043

<212> DNA

<213> Candida

<400> 31

<210> 32

<211> 680

<212> PRT

<213> Candida

<400> 32

<210> 33

<211> 2115

<212> DNA

<213> Candida

<400> 33

<210> 34

<211> 704

<212> PRT

<213> Candida

<400> 34

<210> 35

<211> 2115

<212> DNA

<213> Candida

<400> 35

<210> 36

<211> 704

<212> PRT

<213> Candida

<400> 36

<210> 37

<211> 768

<212> DNA

<213> Candida albicans

<400> 37

<210> 38

<211> 255

<212> PRT

<213> Candida albicans

<400> 38

<210> 39

<211> 768

<212> DNA

<213> Candida albicans

<400> 39

<210> 40

<211> 255

<212> PRT

<213> Candida albicans

<400> 40

<210> 41

<211> 2103

<212> DNA

<213> Yarrowia lipolytica

<400> 41

<210> 42

<211> 700

<212> PRT

<213> Yarrowia lipolytica

<400> 42

<210> 43

<211> 2100

<212> DNA

<213> Yarrowia lipolytica

<400> 43

<210> 44

<211> 699

<212> PRT

<213> Yarrowia lipolytica

<400> 44

<210> 45

<211> 1752

<212> DNA

<213> E. coli

<400> 45

<210> 46

<211> 583

<212> PRT

<213> E. coli

<400> 46

<210> 47

<211> 1959

<212> DNA

<213> E. coli

<400> 47

<210> 48

<211> 652

<212> PRT

<213> E. coli

<400> 48

<210> 49

<211> 1689

<212> DNA

<213> E. coli

<400> 49

<210> 50

<211> 562

<212> PRT

<213> E. coli

<400> 50

<210> 51

<211> 1284

<212> DNA

<213> E. coli

<400> 51

<210> 52

<211> 427

<212> PRT

<213> E. coli

<400> 52

<210> 53

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Forward introduction

<400> 53

<210> 54

<211> 73

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer

<400> 54

<210> 55

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Forward introduction

<400> 55

<210> 56

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer

<400> 56

Claims (24)

A genetically modified microorganism comprising: a first nucleic acid encoding a Umbellularia californica lauroyl-acyl carrier protein (ACP) thioesterase (BTE), Operabically linked to a promoter; and a second nucleic acid encoding a Cocos nucifera lauryl-mercapto-carrier protein thioesterase (FatB3) operably linked to a promoter, wherein For the unmodified parent of the microorganism, the microorganism exhibits a lower degree of palmitoyl-acyl carrier protein (ACP) thioesterase, and wherein, compared to the microorganism The unmodified parent, the microorganism produces an incremental amount of long chain dicarboxylic acids. The genetically modified microorganism of claim 1, further comprising an expression construct which exhibits an siRNA for inhibiting the expression of the palmitoyl-thiol carrier protein thioesterase. The genetically modified microorganism of claim 1, further comprising a third nucleic acid encoding an acetyl-CoA carboxylase (ACC) operably linked to a start-up child. The genetically modified microorganism of claim 1, further comprising an additional nucleic acid encoding a fatty acid synthase (FAS) subunit operably linked to a promoter. The genetically modified microorganism of claim 3, further comprising a fourth nucleic acid encoding a fatty acid synthase subunit operably linked to a promoter. The genetically modified microorganism of claim 1, further comprising an additional nucleic acid encoding adenosine monophosphate (AMP)-forming acetyl-CoA synthetase ), operatively connected to a promoter. The genetically modified microorganism of claim 5, further comprising a fifth nucleic acid encoding adenosine monophosphate to form an acetamyl CoA synthetase operably linked to a promoter. The genetically modified microorganism of claim 1, wherein the microorganism has a loss-of-function mutation in an acyl-CoA oxidase gene. The genetically modified microorganism of claim 8, wherein the 醯Krebase A oxidase gene is pox2 , pox5 or fadD . The genetically modified microorganism of claim 1, wherein the microorganism has a loss-of-function mutation in an acyl-CoA synthetase gene. The genetically modified microorganism of claim 10, wherein the 醯Krebase A synthetase gene is acs . The genetically modified microorganism of claim 1, wherein the microorganism has a loss-of-function mutation in a citric synthetase gene. The genetically modified microorganism of claim 12, wherein the citrate synthase gene is gltA . The genetically modified microorganism of claim 1, further comprising an additional nucleic acid encoding a cytochrome P450 reductase (cytochrome P450 reductase, CPR), operably linked to a promoter. The genetically modified microorganism of claim 7, further comprising a sixth nucleic acid encoding a cytochrome P450 reductase operably linked to a promoter. The genetically modified microorganism of claim 1, further comprising an additional nucleic acid encoding a long chain alcohol oxidase (FAO1). The genetically modified microorganism of claim 15, further comprising a seventh nucleic acid encoding a long-chain alcohol oxidase. The genetically modified microorganism of claim 1, further comprising an additional nucleic acid encoding a long chain alcohol dehydrogenase (FADH). The genetically modified microorganism of claim 17, further comprising an eighth nucleic acid encoding a long-chain alcohol dehydrogenase. The genetically modified microorganism of claim 1, wherein the microorganism is Yarrowia lipotica or Escherichia coli . A method for producing a long-chain dicarboxylic acid, the method comprising: providing a genetically modified microorganism according to any one of claims 1 to 20; and allowing a long chain at pH 6 to 8 In the case of the production of a carboxylic acid, the microorganism is cultured in a medium containing glucose; whereby the microorganism produces the long-chain dicarboxylic acid. Producing a long chain dicarboxylic acid as described in claim 21 The method further comprises collecting the long chain dicarboxylic acid. A process for producing a long-chain dicarboxylic acid as described in claim 21, wherein the long-chain dicarboxylic acid is a C10-C18 dicarboxylic acid. A process for producing a long-chain dicarboxylic acid as described in claim 23, wherein the long-chain dicarboxylic acid is a C12 dicarboxylic acid.