CN103993019B - The application of rose RrDFR1 gene in regulating plant anthocyanidin is synthetic - Google Patents
The application of rose RrDFR1 gene in regulating plant anthocyanidin is synthetic Download PDFInfo
- Publication number
- CN103993019B CN103993019B CN201410180475.3A CN201410180475A CN103993019B CN 103993019 B CN103993019 B CN 103993019B CN 201410180475 A CN201410180475 A CN 201410180475A CN 103993019 B CN103993019 B CN 103993019B
- Authority
- CN
- China
- Prior art keywords
- gene
- rrdfr1
- rose
- plant
- anthocyanidin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to plant gene engineering technology field. Be specifically related to a kind of separation, clone, functional verification and application of rose DNA fragmentation. Described DNA fragmentation comprises rose pattern functional gene RrDFR1, is its nucleotide sequence as sequence table SEQ? ID? is the sequence of its corresponding protein as SEQ shown in NO:1? ID? shown in NO:2. This genetic fragment can change the pattern of plant, improves the content of Anthocyanin. By direct this genetic fragment conversion of plant, the pattern of render transgenic plant changes, and anthocyanidin content increases.
Description
Technical field
The present invention relates to plant gene engineering technology field. Be specifically related to a kind of separation clone, merit of rose genetic fragmentCan checking and application. Described gene is relevant with Anthocyanin metabolism. By the complete translation district of this gene and cauliflower floral leafViral promotors directly proceeds to general plant in conjunction with rear, and the pattern of transfer-gen plant changes, and anthocyanidin content increases.
Background technology
The pigment of plant mainly contains three major types: betaines, carotenoids and anthocyan. Wherein anthocyanidin is wideThe general a kind of water colo(u)r being present in plant, it is made up of a basic structure parent nucleus and different substituting groups, because ofThereby the difference of substituting group type and position has formed the anthocyanidin material with different colours comprises red, powder, purple and blue etc.,Wherein about 88% angiospermous colored color is determined by anthocyanidin, and anthocyanidin structurally mainly divides three classes: IndiaCertain herbaceous plants with big flowers element (pelargonidin), Cyanidin (cyanidin) and delphinidin (delphinidin). Anthocyanidin is mainly with glucosidesForm be present in the liquid bag of epidermal cell and have different physiological roles, for example help plant pollination, improve disease resistance of plant,And protective plant is avoided low temperature and uv damage etc.; Anthocyanidin be also in the plant found up to now the most potent fromBy base scavenger, its powerful oxidation resistance can angiocardiopathy preventing, antitumor, anti-sudden change, anti arteriosclerosis function,Regulate the functions such as immunocompetence. In addition anthocyanidin or a kind of safe, nontoxic natural food colour. Therefore, anthocyanidin is in gardenThe aspects such as skill, medicine, cosmetic, food have certain application potential and researching value.
Rose (RosarugosaThunb.) is rose family Rosa fallen leaves bush, and flower type is beautiful, and sweet perfumes are diffused all around,Lucuriant in design, in the traditional famous flower of China, evaluate highly, have the title of " spending middle queen ". Rose has important economic worth,Its petal contains abundant anthocyan material, can deeply be applied to food, medical treatment, health care etc.
Summary of the invention
The rose functional gene RrDFR1 that object of the present invention provides a kind of separation is in regulating plant anthocyanidin is syntheticApplication, this gene is relevant to the formation of pattern.
The present invention is achieved through the following technical solutions:
The invention provides gene coded sequence and the function thereof of in rose, expressing RrDFR1, specifically comprise: RrDFR1 baseThe clone of the nucleotide coding sequence of cause, expression vector establishment, by this genetic transformation host tobacco, obtains transgene tobacco and plantsStrain, carries out Molecular Identification and Phenotypic Observation.
First the present invention clones RrDFR1 functional gene from rose, and this genetic fragment is the DNA with particular sequenceMolecule, its ORFs is 1050bp, its nucleotide sequence is as shown in sequence table SEQ IDN0:1.
The present invention also provides this rose RrDFR1 albumen coded sequence, and it has 349 amino acid residues, its correspondenceAmino acid sequence is as shown in SEQIDNO:2.
The present invention also provides a pair of nucleotide primer that obtains rose sample gene RrDFR1 for transferring. This primerAccording to gene RrDFR1 design, use this primer pair roseleaf sample cDNA to be carried out pcr amplification and can be obtained the base of 1050bpBecause of fragment. The DNA sequence dna of this primer pair is as follows:
P1 forward primer: 5 ' ATGGGATCGGAATCCGAG3 ' (seeing sequence table SEQ IDNO:3)
P2 reverse primer: 5 ' TTAGCCTGTGACTTTGACACG3 ' (seeing sequence table SEQ IDNO:4)
The primer pair that the present invention also provides a pair of detection rose RrDFR1 gene to express in transgene tobacco. This primerTo according to gene RrDFR1 design, use this tobacco sample cDNA that primer is transformed to this gene to carry out RT-PCR amplification, detecting shouldWhether gene expresses in transgene tobacco, the fragment that acquisition length is 207bp.
The DNA sequence dna of above-mentioned primer pair is as follows:
P3 forward primer: 5 ' CAAGGGCATTGAGGAGAACTTGC3 ' (seeing sequence table SEQ IDNO:5)
P4 reverse primer: 5 ' CCTGTGACTTTGACACGGACGA3 ' (seeing sequence table SEQ IDNO:6)
Can utilize any carrier that can guide foreign gene to express in plant, by directly delivered DNA, electricityThe conventional biological technique method such as lead, agriculture bacillus mediated the encoding gene of RrDFR1 provided by the invention is imported to plant cell or groupKnit, and the plant tissue of conversion is cultivated into plant. While using genetic fragment of the present invention to be building up in plant expression vector,Before its transcription initiation nucleotides, can add that any one strengthens promoter or inducible promoter. For the ease of transgenosis is plantedThing cell or plant are identified and screen, and can process used carrier, have the antibiotic of resistance as addedLabel (such as kanamycins or hygromycin etc.). The host who is converted is the various plants including tobacco, cultivates differentThe floristics of pattern.
The present invention also provides a kind of transgene tobacco anthocyanidin to extract and assay method. Extract nitrogen bucket is taked ripe flowerPetal, petal is ground to form to fine powder with liquid nitrogen, put into rapidly liquid nitrogen after point installing in centrifuge tube frozen, ultralow in-80 DEG CIn temperature refrigerator, save backup. Accurately take 0.1g petal, add 0.5mL extract (Jia Chun ︰ Yan Suan ︰ water volume ratio=70 ︰ 0.1 ︰29.9) in the lower 4 DEG C of lixiviate 24h of dark condition, during this time every the gyrate shaker 1min that vibrates for 6h. 12000rpm is centrifugal10min, gets supernatant to new centrifuge tube, then after filtering with the nylon millipore filter of aperture 0.22 μ m, 40 DEG C of refrigerators of Bao Cun Yu –In, for the analysis of anthocyanin. With spectrophotometer (UV-2401PC, SHIMADZU) respectively at wavelength 530nm and 657nm placeMeasure the light absorption value of sample. The content of anthocyanidin calculates with following formula: QAnthocyanins=(A530-0.25 × A657)×M-1。
More detailed technical scheme is shown in " detailed description of the invention ".
Brief description of the drawings
Sequence table SEQ IDNO:1 is DNA fragmentation (its that includes RrDFR1 gene coding region that the present invention separates cloneMiddle 1-1008bp is CDS). Sequence total length is 1050bp, 349 amino acid of encoding.
Sequence table SEQ IDNO:2 is the sequence of protein corresponding to above-mentioned RrDFR1 genetic fragment.
Sequence table SEQ IDNO:3, SEQIDNO:4 is the DNA of the primer pair of the above-mentioned roseleaf sample cDNA of amplificationSequence.
Sequence table SEQ IDNO:5, SEQIDNO:6 detects expressing gene fragment primer pair in transgene tobaccoDNA sequence dna.
Fig. 1: be excess plant expression vector pCAMBIA2300s structural representation.
Fig. 2: be recombinant plasmid pCAMBIA2300s-RrDFR1 structural representation.
Fig. 3: contrast early Henbane with transform RrDFR1 gene morning Henbane pattern comparison diagram. Mark in figure: Fig. 3 AIt is early Henbane pattern of contrast; Fig. 3 B is that the present invention turns the early pattern of Henbane of RrDFR1 gene.
Fig. 4: the electrophoresis of the expression of RrDFR1 gene in transgene tobacco runs glue figure. Fig. 4 A turns RrDFR1 geneRun glue figure, Fig. 4 B is the race glue figure that turns house-keeping gene eIF, and mark in figure: M is molecular size range, and 1-3 is 3 transgenic lines,P is recombinant plasmid pCAMBIA2300s-RrDFR1, and CK is Henbane morning (as the early contrast of Henbane of transgenosis).
Fig. 5: contrast is Henbane and Henbane petal anthocyanidin content figure morning that transforms RrDFR1 gene early. Mark in figure:1-is Henbane morning; 2,3-is respectively RrDFR1-6, RrDFR1-12, is 2 genetically modified tobacco strains.
Detailed description of the invention
Embodiment 1: separate clone RrFLS1 gene
(again claim " No. one, Pingyin ", http://tc.cctv.com/20100412/ to rich colored rose early stage of the present invention103621.shtml, the seed selection document of rich colored rose is published, and sees: Lv Chuanrun (Pingyin rose research institute), rose is newKind-Feng flower rose and cultivation technique, Shandong forestry science and technology, 2007,5:77; Gardening forestry institute of Hua Zhong Agriculture University gardening is plantedThing biology flowers Practical Teaching Base is introduced a fine variety from Pingying County Pingyin, Shandong Province rose research institute) flower of different times carried outTranscribe group order-checking (transcribing group order-checking is completed by Shenzhen Huada Genetic Technology Co., Ltd), obtained transcribing in group sequencing resultThe full length sequence of RrDFR1 gene. According to the known array total length of transcribing order-checking RrDFR1 gene, design special primer P1 (is shown in orderList SEQIDNO:3) forward primer 5 ' ATGGGATCGGAATCCGAG3 ' and P2 (seeing sequence table SEQ IDNO:4) oppositely drawThing 5 ' TTAGCCTGTGACTTTGACACG3 ', by the 1-1050bp of sequencing sequence from rose variety ' rich flower ' (being rich colored rose)In the cDNA that petal RNA reverse transcription obtains, out, the fragment that amplification obtains is as follows in amplification:
ATGGGATCGGAATCCGAGTCCGTTTGCGTGACAGGCGCCTCCGGTTTCGTAGGTTCATGGCTCGTCATGAGACTCCTAGAGCGCGGCTACACTGTCCGAGCCACCGTGCGAGACCCTGCTAATTCGAAGAAGGTGAAGCATCTGCTGGACTTACCAAAGGCGGCGACTCACTTGACGCTGTGGAAGGCAGACTTGGCGGAGGAGGGAAGCTTCGACGAAGCCATCAAGGGATGCACCGGAGTGTTCCATGTCGCCACTCCTATGGATTTTGAGTCCAAGGACCCTGAGAACGAAGTGATCAAACCTACTATAAATGGGGTGCTAGACATCATGAAAGCATGTCTAAAAGCAAAGACTGTAAGAAGGCTAGTGTTTACAGCTTCGGCTGGATCTGTCAATGTTGAAGAGACCCAAAAGCCGGTCTACAACGAAAGCAACTGGAGTGATGTCGAATTTTGCCGGAGAGTGAAGATGACTGGTTGGATGTATTTTGTATCCAAAACTCTAGCTGAGCAAGAGGCATGGAAGTTTGCCAAAGAAAATAACATTGATTTCATCACCATTATCCCAACTCTCGTAATCGGTCCATTTCTCATGCCTGCCATGCCGCCGAGCCTCATTACTGGACTTTCGCCACTCACTGGAAATGAAAGTCATTATTCGATCATAAAGCAAGGCCAATTCATTCATCTAGACGACCTCTGCCAATCTCATATATACTTGTATGAGCATCCGAAAGCAGAGGGCCGCTACATTTGTTCATCGCACGATGCTACGATTCATGAAATTGCGAAATTGCTGAGGGAAAAGTACCCCGAGTACAATGTTCCTACAACGTTCAAGGGCATTGAGGAGAACTTGCCAAAGGTCCATTTTTCTTCAAAGAAATTATTGGAAACAGGGTTCGAGTTCAAATACAGCTTGGAGGACATGTTTGTAGGAGCTGTTGATGCTTGTAAAGCAAAGGGTTTGCTTCCTCCTCCTACTGAAAGAGTTGAAAAGCAGGAGGTTGATGAGAGCAGTGTCGTCCGTGTCAAAGTCACAGGCTAA
1-1050bp in amplified production is exactly sequence of the present invention. Concrete steps are:
1, adopt conventional CTAB method (reference: " plant genetic engineering ", Wang Guanlin, Fang Hongjun chief editor) from rose varietyIn ' rich flower ', extract the total RNA of petal, concrete steps are as follows:
1) to add in centrifuge tube CTAB (softex kw) Extraction buffer (2% (W/V) CTAB,NaCl1.4mol/L, EDTA (ethylenediamine tetra-acetic acid) 20mmol/L, TrisCl100mmol/L, 2% (W/V) pvp) and 10%Beta-mercaptoethanol, preheating in water-bath.
2) roseleaf is ground by cooled with liquid nitrogen, add in extract, mix, 65 DEG C of water-baths 10 minutes
3) add isopyknic chloroform: isoamyl alcohol (volume ratio 24:1) mixed liquor, put upside down and mix, leave standstill 10min, at 4 DEG CThe centrifugal 10min of 12000g
4) get supernatant, repeating step 3)
5) get supernatant, adding final concentration is the LiCl of 2mol/L, ice bath 10-12 hour, 12000g, 4 DEG C centrifugal 15 minutes,Abandon supernatant, by 75% ethanol washing and precipitating twice, be dissolved in appropriate DEPC (pyrocarbonic acid diethyl ester) and process in water stand-by.
6) to extract the total RNA of petal as template from rose variety ' rich flower ', utilize reverse transcriptase (purchased from precious bioengineeringDalian Co., Ltd) by synthetic its reverse transcription cDNA Article 1 chain, reaction condition is: 65 DEG C of 5min, 42 DEG C of 50min, 70 DEG C10min。
7) according to the special primer P1 (seeing sequence table SEQ IDN:3) 5 ' that transcribes the sequences Design in order-checkingATGGGATCGGAATCCGAG3 ' and P2 (seeing sequence table SEQ IDNO:4) 5 ' TTAGCCTGTGACTTTGACACG3 ', willThe cDNA that RrDFR1 obtains from rose variety ' rich flower ' petal RNA reverse transcription, amplification out.
Reaction condition: 94 DEG C of denaturation 4min; 94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 1min, 37 circulations; 72 DEG C are prolongedStretch 10min. The PCR product that amplification is obtained is connected intoCarrier (purchased from precious bioengineering Dalian Co., Ltd), screeningPositive colony order-checking, obtain required full-length gene. This clone is named asPlasmid.
The structure of embodiment 2:RrDFR1 gene overexpression carrier, transforms
In order to illustrate better the function of this gene, applicant is by its overexpression in tobacco, from transfer-gen plantPhenotype verify. Concrete steps are: first by the positive colony obtaining in embodiment 1Plasmid BamHI and Sal I double digestion, reclaim object fragment; Meanwhile, the enzyme that uses the same method is cut and is carried two tobacco mosaic disease virus promoter 35SGenetic transformation carrier pCAMBIA2300s (this genetic transformation carrier is from Wuhan City, Hubei Province Hua Zhong Agriculture University crop geneticImprovement National Key Laboratory builds and gives). Enzyme cuts complete, cuts with the endonuclease bamhi that comprises RrDFR1 gene and enzymePCAMBIA2300s (Fig. 1) carrier does coupled reaction, and (coli strain is large purchased from precious bioengineering to transform bacillus coli DH 5 alphaConnect Co., Ltd). Cut screening positive clone by enzyme, obtain recombinant vector (or claiming to transform plasmid), applicant is by its called afterRecombinant plasmid pCAMBIA2300s-RrDFR1.
Imported in Henbane morning by agriculture bacillus mediated tobacco genetic transforming method, cultivate through infecting, being total to,Screening has the transformation seedlings of kalamycin resistance and hygromycin resistance simultaneously, then by taking root, practice the conventional steps such as transplantation of seedlings (ginsengExamine document: J. Pehanorm Brooker, EF is Ritchie not, T Manny A Disi work; Huang Peitang, Wang Jiaxi etc. translate; Molecular cloning experiment guide(third edition); Beijing, Science Press; 2002 editions), obtain transfer-gen plant.
The key step of genetic transformation of the present invention and application reagent are as described below:
(1) reagent and solution abbreviation
In the present invention, the abbreviation of culture medium plant hormone used is expressed as follows: 6-BA (6-BenzylaminoPurine, 6-benzyl aminopurine); NAA (Naphthaleneaceticacid, methyl α-naphthyl acetate); Kan(Kanamycin, kanamycins); Cef (Cefotaxime, cephalosporin); Hyg (Hygromycin, hygromycin)
(2) for the culture medium prescription of Henbane genetic transformation morning
Table 1 has been listed composition and the consumption thereof of various culture mediums of the present invention.
The design of table 1 early blossoming Transformation of tobacco culture medium
Note: 1/2MS, the preparation of MS culture medium is referring to MurashigeT.andF.Skoog.Physiol.Plant,The method of 1962,15:473-497 report.
Kan (Kanamycin, kanamycins), Cef (Cefotaxime, cephalosporin) in table 1, Hyg(Hygromycin, hygromycin), adopts 0.45 μ m membrane filtration method sterilizing, above-mentioned except Kan, Hyg, Cef compositionCulture medium, after conventional 121 DEG C of high pressure steam sterilization 20min, in the time that culture medium is cooled to 50-60 DEG C, adds on superclean benchEnter.
(1) agriculture bacillus mediated genetic transformation step
1) cultivation of Agrobacterium
First, at the solid LB culture medium (10g/L peptone, 5g/L yeast extract, the 10g/ that select with corresponding resistanceL sodium chloride, Kan100mg/L+, agar 1.5g/L) upper preculture Agrobacterium EHA10548 hour, 28 DEG C of cultivation temperature; Picking is pre-Cultivate the single bacterium colony of Agrobacterium, be inoculated in the liquid LB culture medium that corresponding resistance selects (10g/L peptone, 5g/L yeast extract,10g/L sodium chloride, Kan100mg/L) in, in 28 DEG C of 200rpm shaking table overnight incubation, to bacterial concentration OD600Value is approximately 0.6.
2) leaf disc transformation method
A. the clip young leaflet tablet that early launch completely on Henbane aseptic seedling top, is cut into 0.8cm × 0.8cm size by bladeFritter, puts into aseptic beaker;
B. pour ready bacterium liquid into beaker, jiggle beaker. Blade soaks 10min in bacterium liquid;
C. blade in step b is taken out, be transferred on the filter paper of the bacterium of having gone out and blot; Then be placed on as above commonDark cultivation three days in culture medium, cultivation temperature is 28 DEG C;
D. after three days, blade is proceeded to as described in Table 1 sprouting and select on culture medium, illumination and dark cultivation replace (illuminationIntensity 1000-1500lx, light application time: 16h/d, interlunation: 8h/d) lower cultivation, carry out the screening of Kan and Hyg resistant budsDifferentiation, cultivation temperature is 28 DEG C;
E. after resistant buds forms, cut, proceed to and select on culture medium strong sprout as above, illumination and dark cultivationAlternately (intensity of illumination 1000-1500lx, light application time: 16h/d, interlunation: 8h/d) lower cultivation, carries out Kan and Hyg resistanceThe screening of seedling, cultivation temperature is 28 DEG C;
F. resistance seedling screening being obtained proceeds to as above taking root and selects on culture medium, it to be taken root, in illumination and darkCultivate alternately (intensity of illumination 1000-1500lx, light application time: 16h/d, interlunation: 8h/d) lower cultivation, cultivation temperature is 28℃。
2) transplant
Wash the residual culture medium on transgenosis early blossoming tobacco plant root off, the seedling with good root system proceeded to greenhouse,In initial one week, keep moisture moistening simultaneously.
The present embodiment obtain altogether the PCR testing result of 20 strains positive proceed to recombinant plasmid (or claiming to transform plasmid)The T of pCAMBIA2300s-RrDFR10For transgene tobacco.
Embodiment 3:RrDFR1 gene transgenic T0In generation, is detected with RT-PCR in the phenotype observation in field
After transplanting under transgenosis early blossoming tobacco plant, until florescence, by transgenosis early Henbane colored type and do not turnChange the early colored type of Henbane and compare, find that the pattern of the tobacco that turns RrDFR1 gene changes: there is no the early blossoming of conversionTobacco pattern is pink (Fig. 3 A); Henbane pattern morning that turns RrFLS1 gene becomes rose (Fig. 3 B).
Whether relevant with the RrDFR1 gene proceeding in order to verify the change of transgenosis Henbane pattern morning, the present invention adoptsConventional RT-PCR method RrDFR1 gene expression in part transgenosis early blossoming tobacco plant has been carried out detecting (the results are shown in Figure4). Concrete steps are as follows: adopt TRIZOL reagent (purchased from precious bioengineering Dalian Co., Ltd) from transgene tobacco 1-8 strainIn system, extract total RNA (extracting method operates according to above-mentioned TRIZOL reagent description) of flower, utilize reverse transcriptase (raw purchased from treasuredThing engineering Dalian Co., Ltd) by synthetic its reverse transcription cDNA Article 1 chain, reaction condition is 65 DEG C of 5min, 42 DEG C of 50min, 70DEG C 10min. First detect and concentration adjustment root with the cDNA that the house-keeping gene eIF (X79009) of report obtains reverse transcriptionSequences Design pair of primers P5 forward primer (5-GCAGCCGTGATCACACAGTATCT) and P6 according to house-keeping gene EIF are reversePrimer (5-ACACCCTTCCTTCCAAAACGT), carries out PCR detection, and reaction condition is: 94 DEG C of denaturation 4min; 94 DEG C30sec, 60 DEG C of 30sec, 72 DEG C of 30sec, 28 circulations; 72 DEG C are extended 10min. Result of the test as shown in Figure 4, house-keeping geneEIF morning Henbane and transgenosis early in Henbane, all can expand, and brightness is consistent. Then, according to the order of RrDFR1 geneRow, are designing pair of primers P3 (seeing sequence table SEQ IDNO:3) forward primer (5-near 3 ' endAnd P4 (seeing sequence table SEQ IDNO:4) reverse primer (5-CAAGGGCATTGAGGAGAACTTGC)CCTGTGACTTTGACACGGACGA), carry out RT-PCR detection, reaction condition is: 94 DEG C of denaturation 4min; 94 DEG C of 30sec, 60DEG C 30sec, 72 DEG C of 1min, 35 circulations; 72 DEG C are extended 10min. Result of the test shows, all inspections in 3 transgenic line tobaccosMeasure the expression of RrDFR1 gene, result as shown in Figure 4. Fig. 4: the electricity of the expression of RrDFR1 gene in transgene tobaccoGlue figure is run in swimming. Fig. 4 A is the race glue figure that turns RrDFR1 gene, and Fig. 4 B is the race glue figure that turns house-keeping gene eIF, and mark in figure: M isMolecular size range, 1-3 is 3 transgenic lines, and P is recombinant plasmid pCAMBIA2300s-RrDFR1, and CK is that early Henbane (is doneFor the early contrast of Henbane of transgenosis).
Embodiment 4: turn the early extraction and determination of Henbane secondary metabolites of RrDFR1
Accurately take early Henbane petal of the 0.1g RrDFR1 of turning of the present invention, add 0.5mL extract (first alcohol ︰ salt acid ︰ waterVolume ratio=70 ︰ 0.1 ︰ 29.9) in the lower 4 DEG C of lixiviate 24h of dark condition, during this time every the gyrate shaker 1min that vibrates for 6h.The centrifugal 10min of 12000rpm, gets supernatant to new centrifuge tube, then after filtering with the nylon millipore filter of aperture 0.22 μ m, protectsIn 40 DEG C of refrigerators of Cun Yu –. Measure at wavelength 530nm and 657nm place respectively with spectrophotometer (UV-2401PC, SHIMADZU)The light absorption value of sample. The content of anthocyanidin calculates with following formula: QAnthocyanins=(A530-0.25 × A657) × M-1. The testing result of the anthocyanidin of the present embodiment as shown in Figure 5.
Claims (1)
1. the rose RrDFR1 gene of nucleotide sequence as shown in sequence table SEQ IDNO:1 is in regulation and control tobacco anthocyanidin is syntheticApplication.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410180475.3A CN103993019B (en) | 2014-04-30 | 2014-04-30 | The application of rose RrDFR1 gene in regulating plant anthocyanidin is synthetic |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410180475.3A CN103993019B (en) | 2014-04-30 | 2014-04-30 | The application of rose RrDFR1 gene in regulating plant anthocyanidin is synthetic |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103993019A CN103993019A (en) | 2014-08-20 |
CN103993019B true CN103993019B (en) | 2016-05-04 |
Family
ID=51307351
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410180475.3A Expired - Fee Related CN103993019B (en) | 2014-04-30 | 2014-04-30 | The application of rose RrDFR1 gene in regulating plant anthocyanidin is synthetic |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103993019B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104531724B (en) * | 2015-02-06 | 2017-09-26 | 中国科学院武汉植物园 | Regulate and control gene PpRd and its application of fruit pulp anthocyanin synthesis |
CN106117327B (en) * | 2016-07-01 | 2019-08-06 | 华中农业大学 | It synthesizes the relevant artificial synthesized transcription factor of flavonoids and its promotes the application in flavonoids synthesis and regulation Anthocyanin |
CN111471786B (en) * | 2020-04-03 | 2022-09-16 | 天津科润农业科技股份有限公司 | Molecular marker related to cauliflower anthocyanin and application |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103421835A (en) * | 2012-12-08 | 2013-12-04 | 华中农业大学 | Application of transcription factor gene RrMYB11 in regulating and controlling rose types |
-
2014
- 2014-04-30 CN CN201410180475.3A patent/CN103993019B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103421835A (en) * | 2012-12-08 | 2013-12-04 | 华中农业大学 | Application of transcription factor gene RrMYB11 in regulating and controlling rose types |
Non-Patent Citations (3)
Title |
---|
"GenBank Accession No:AB490072.1";登陆号;《GenBank》;20090306;第1-2页 * |
"植物二氢黄酮醇4-还原酶基因的研究进展";李春雷 等;《生物技术通讯》;20090531;第20卷(第3期);第442-445页 * |
"玫瑰新品种-丰花玫瑰及栽培技术";吕传润;《山东林业科技》;20071031(第5期);第77页第1段 * |
Also Published As
Publication number | Publication date |
---|---|
CN103993019A (en) | 2014-08-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108864267B (en) | Sweet potato carotenoid synthesis and salt-tolerant drought-resistant related protein IbARF5 as well as encoding gene and application thereof | |
CN105873940A (en) | Plants with enhanced photosynthesis and methods of manufacture thereof | |
CN102791729A (en) | Molecular engineering of a floral inducer for crop improvement | |
CN109384837B (en) | Poplar drought-resistant gene and application thereof | |
CN106480063A (en) | A kind of tea tree myb transcription factor CsAN1 and its application in regulation and control anthocyanidin metabolism | |
CN107698673A (en) | Red palm AaMYB3 transcription factors and its encoding gene and application | |
CN106117327B (en) | It synthesizes the relevant artificial synthesized transcription factor of flavonoids and its promotes the application in flavonoids synthesis and regulation Anthocyanin | |
CN103993019B (en) | The application of rose RrDFR1 gene in regulating plant anthocyanidin is synthetic | |
CN103421835B (en) | Application of transcription factor gene RrMYB11 in regulating and controlling rose types | |
CN105837671B (en) | Obtained from the flavonols modulin MsMYB22 and its encoding gene of functional form apple and application | |
CN108948169B (en) | Protein and gene for promoting synthesis of cotton fiber green pigment, and coding sequence and application thereof | |
CN104694491A (en) | Rose anthocyanin reductase RrANR gene and encoding protein and application thereof | |
CN103789328A (en) | Application of rose functional gene RrFLS1 to regulation and control of plant flavonoid metabolism | |
CN109055392A (en) | State's orchid allelotaxis controlling gene and its coding albumen and application | |
CN111118059B (en) | Recombinant plasmid containing astaxanthin synthetase fusion gene and screening marker-free gene NPT II, recombinant bacterium and application | |
CN107858372A (en) | A kind of agriculture bacillus mediated cotton transient transformation methods | |
CN104844702B (en) | Plant stress tolerance correlative protein GmSTOP1 and its encoding gene application | |
CN101955938B (en) | DNA fragment for inhibiting expression of omega secaline gene in wheat 1B/1R translocation line and application thereof | |
CN105585620B (en) | Soybean protein GmAIRP1 and its encoding gene are cultivating the application in resistance plant | |
CN105950644B (en) | The albumen and application of asparagus enzyme, namely chalcone isomerase gene and its coding | |
CN105585621B (en) | Soybean protein GmAIRP1 and its encoding gene and application | |
CN102146377A (en) | Method for preparing protein by embryogenic cell tissue | |
CN114480414A (en) | Method for enhancing cold resistance of plants or cultivating plants with high cold resistance | |
CN107630021A (en) | The albumen and application of asparagus resistant gene of salt AoSOS2 and its coding | |
CN102719452A (en) | Application of csRRM2 gene of rape to improvement on yield trait of rape |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160504 Termination date: 20170430 |
|
CF01 | Termination of patent right due to non-payment of annual fee |