CN111118059B - Recombinant plasmid containing astaxanthin synthetase fusion gene and screening marker-free gene NPT II, recombinant bacterium and application - Google Patents

Abstract

The invention provides a recombinant plasmid containing an astaxanthin synthetase fusion gene and a screening marker-free gene NPT II, a recombinant bacterium and application, belonging to the technical field of genetic engineering breeding; the nucleotide sequence of the astaxanthin synthetase fusion gene is shown as SEQ ID NO: 1 is shown in the specification; the recombinant plasmid takes pBI121 as an original plasmid; the recombinant plasmid deletes the screening marker gene NPT II. The invention connects four astaxanthin synthesis key enzyme genes by using 2A short peptide sequences, can simplify the construction of recombinant plasmids (expression vectors) and realize the synergistic expression of each gene. In addition, the recombinant plasmid of the invention deletes the screening marker gene NPT II, and the safety of the recombinant plasmid for transgenosis is improved.

Description

Recombinant plasmid containing astaxanthin synthetase fusion gene and screening marker-free gene NPT II, recombinant bacterium and application

Technical Field

The invention relates to the technical field of genetic engineering breeding, in particular to a recombinant plasmid containing an astaxanthin synthetase fusion gene and a screening marker-free gene NPT II, a recombinant bacterium and application.

Background

Astaxanthin is a red ester soluble ketocarotenoid with a unique molecular structure, and has strong antioxidant activity, radiation resistance, aging resistance, tumor resistance and cardiovascular disease prevention. Astaxanthin biosynthesis occurs only in a small number of bacteria and green algae and the yield is low; only Adonis aestivalis (Adonis aestivis) can synthesize trace amounts of astaxanthin in the petals of plants. Due to the limited natural resources of astaxanthin, scientists have sought through genetic engineering methods to produce higher yields of natural astaxanthin and have succeeded in plants such as lettuce, potato, wheat, canola, tobacco, tomato, and rice. However, resistance marker genes such as hygromycin resistance gene (HPT), kanamycin resistance gene (NPT II) and phosphinothricin resistance gene (BAR) are often used in these transgenic plants for selection to obtain successfully transformed cells. Because of the potential harm of these resistance genes to food and ecological environment, they have become major obstacles affecting the commercial application of transgenic plants, and it is urgent to develop safe astaxanthin-producing transgenic plants without resistance marker genes.

Disclosure of Invention

The invention aims to provide a recombinant plasmid, a recombinant bacterium and application thereof, wherein the recombinant plasmid comprises an astaxanthin synthetase fusion gene and a screening-free marker gene NPT II.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a recombinant plasmid comprising an astaxanthin synthetase fusion gene and a screening marker-free gene NPT II, wherein the nucleotide sequence of the astaxanthin synthetase fusion gene is shown as SEQ ID NO: 1 is shown in the specification; the recombinant plasmid takes pBI121 as an original plasmid; the recombinant plasmid deletes the screening marker gene NPT II.

Preferably, the recombinant plasmid uses Napin promoter as promoter.

The invention provides a recombinant bacterium comprising the recombinant plasmid in the scheme.

The invention provides application of the recombinant plasmid or the recombinant bacterium in camelina sativa breeding.

The invention provides application of the recombinant plasmid or the recombinant bacterium in the scheme in improving the content of carotenoid in camelina sativa seeds.

Preferably, the carotenoid comprises astaxanthin.

Preferably, the carotenoids further comprise neoxanthin, ketolutein, astaxanthin, lutein, esterified lutein, chlorophyll, cryptoxanthin, echinenone, lycopene, alpha-carotene and/or beta-carotene.

The invention provides application of the recombinant plasmid or the recombinant bacterium in the scheme in improving the total antioxidant capacity of camelina sativa seeds.

Preferably, the application comprises the following steps:

and introducing the recombinant plasmid or the recombinant bacterium into a camelina sativa plant, culturing to obtain camelina sativa seeds, and selecting red seeds from the camelina sativa seeds to obtain the target camelina sativa seeds.

Preferably, the method of introduction comprises an agrobacterium inflorescence dip-staining method.

The invention has the beneficial effects that: the invention provides a recombinant plasmid comprising an astaxanthin synthetase fusion gene and a screening marker-free gene NPT II, wherein the nucleotide sequence of the astaxanthin synthetase fusion gene is shown as SEQ ID NO: 1 is shown in the specification; the recombinant plasmid takes pBI121 as an original plasmid; the recombinant plasmid deletes the screening marker gene NPT II. The astaxanthin synthetase fusion gene comprises three key enzyme genes in an astaxanthin synthesis pathway and an Orange (from cauliflower) gene for promoting chromosome differentiation and carotenoid storage, wherein the three key enzyme genes are respectively a beta-carotene ketolase (CrBKT) from chlamydomonas reinhardtii, a hydroxylase (HpBHY) gene from haematococcus pluvialis and a phytoene synthetase (CrtB) gene. The invention connects four key enzyme genes by 2A short peptide sequences, can simplify the construction of recombinant plasmids (expression vectors) and realize the synergistic expression of each gene. In addition, the recombinant plasmid of the invention deletes the screening marker gene NPT II, and the safety of the recombinant plasmid for transgenosis is improved. Through detection, the total carotenoid content in seeds of the camelina sativa transformed plant is 913.54 mu g/gDW which is 56 times of that of a wild type (16.08 mu g/gDW), and more importantly, the astaxanthin content is increased from 0 to 42.72 mu g/gDW. The total antioxidant capacity of the camelina sativa transformed plant seed transformed strain is obviously higher than that of a wild type. Herba CapsellaeThe camelina sativa seed oil can be obtained by directly using conventional physical oil pressing mode through transforming plant seeds, compared with the traditional method of using supercritical CO₂The critical extraction method is simple and rapid, and has low cost and high efficiency; meanwhile, when the recombinant plasmid is used for breeding camelina sativa, a camelina sativa strain with higher safety and better quality can be obtained, so that the commercialization of transgenic camelina sativa products becomes possible. Therefore, the recombinant plasmid disclosed by the invention is used for breeding camelina sativa, and the camelina sativa is used for producing high-quality edible oil which has both unsaturated fatty acid and carotenoid, so that the commercial prospect is great.

Drawings

FIG. 1 is a map of a recombinant plasmid of the present invention;

FIG. 2 is a pictorial representation of T0 transformed seedlings and wild type seedlings, wherein A is T0 transformed seedlings and B is wild type seedlings;

FIG. 3 is a pictorial representation of T1 generation seeds and wild type seeds, wherein A is T1 generation seeds and B is wild type seeds;

FIG. 4 is a pictorial view of an extract of seed pigment of generation T1 and an extract of wild type seed pigment, wherein A is an extract of seed pigment of generation T1; b is wild seed pigment extract;

FIG. 5 shows the result of PCR amplification of T1 generation strain seeds;

FIG. 6 is a UHPLC chromatogram of transformant seeds;

FIG. 7 is a UHPLC chromatogram of wild type seeds;

FIG. 8 shows the results of analysis of total antioxidant capacity of transformant seeds and wild type seeds.

Detailed Description

The invention provides a recombinant plasmid comprising an astaxanthin synthetase fusion gene and a screening marker-free gene NPT II, wherein the nucleotide sequence of the astaxanthin synthetase fusion gene is shown as SEQ ID NO: 1, specifically: cccgggacaaagagtaaagaagaacaatggcatcttctatgctgtcttctgcgactatggttgcgtctccggctcaggctactatggtggcaccgttcaacggtctgaagtcctccgcggctttcccggctactcgtaaagcgaacaacgacattaccagcattacctctaacggtggtcgtgtgaactgcatgaacaacccgtctctgctgaaccatgcggtggaaaccatggcggtgggttccaaatccttcgcgaccgcgtctaagctgttcgatgcaaagacccgtcgttctgtgctgatgctgtatgcatggtgccgccattgtgacgacgttatcgacgaccagactctgggcttccaggcacgtcagccggcgctgcagactccggaacagcgtctgatgcagctggagatgaagactcgccaggcttatgcaggctctcagatgcacgaaccggcgttcgctgctttccaggaagttgcgatggcgcatgatatcgctccggcatacgcgtttgatcatctggaaggcttcgctatggacgtgcgcgaggcgcagtactcccagctggacgataccctgcgctactgctaccacgttgctggtgttgtgggcctgatgatggcacagatcatgggtgttcgtgataacgcgaccctggatcgcgcatgtgacctgggtctggcattccagctgactaacattgcgcgtgacattgttgacgatgcgcacgcaggccgttgttatctgccggcgtcttggctggaacacgaaggcctgaacaaagaaaactacgctgcaccggaaaaccgtcaggcactgtctcgcatcgctcgccgcctggtgcaggaagcagagccgtactatctgagcgcgactgcgggcctggctggcctgccgctgcgtagcgcttgggcgattgctaccgctaagcaggtgtaccgcaaaatcggtgtgaaggttgagcaggcaggtcagcaggcgtgggatcagcgtcagtccaccactaccccggaaaaactgaccctgctgctggcagctagcggccaggcgctgacttctcgtatgcgtgcacatccgccgcgtccggcacacctgtggcagcgtccgctgtctagacagctgctgaactttgatctgctgaaactggctggtgacgtggagtctaaccctggtccgatggcgtcctctatgctgtcttctgctactatggtggcatctccggctcaggcaactatggtggcaccgtttaacggtctgaagtcttccgcagctttcccggcaactcgcaaggcaaacaacgatattactagcattacttccaacggtggccgtgttaactgcatgctgagcaagctgcagtctattagcgttaaggctcgccgtgtggagctggctcgtgacattacccgtccgaaagtttgtctgcacgcgcagcgttgtagcctggtgcgtctgcgtgtggcggctccgcagactgaagaggcactgggtaccgttcaggctgcaggtgcgggcgacgaacactccgctgatgtggctctgcagcagctggatcgtgcgattgcagaacgtcgtgcgcgtcgcaaacgcgaacagctgagctatcaggcagcggctatcgctgcttctattggtgtgtccggtattgcgatcttcgcgacctatctgcgtttcgctatgcacatgactgtgggtggtgcggttccgtggggcgaagttgcgggtactctgctgctggttgttggtggcgctctgggcatggagatgtatgcgcgttatgcgcacaaagcgatctggcacgagtccccgctgggttggctgctgcacaaaagccatcacaccccgcgtaccggtccgttcgaggctaacgatctgtttgcaatcatcaacggcctgccggcgatgctgctgtgcaccttcggcttctggctgccgaacgtgctgggcgcggcttgtttcggcgcaggtctgggtatcactctgtacggcatggcgtacatgttcgtgcatgatggtctggttcatcgtcgtttcccgactggcccgatcgcgggtctgccgtatatgaaacgcctgactgttgctcatcagctgcatcattctggcaaatatggcggtgcgccgtggggtatgttcctgggtccgcaggaactgcagcatattccgggtgcggctgaggaagtggaacgtctggtgctggaactggactggtccaaacgtcagctgctgaacttcgatctgctgaaactggcgggtgacgtggaatctaaccctggtccgatggctagctctatgctgtcctccgctaccatggttgcgtccccggcacaggcgactatggtggctccgttcaacggcctgaaatctagcgctgcatttccggcgactcgtaaggcgaacaacgacatcacttctatcaccagcaacggcggtcgcgttaactgtatgggtccgggtatccagccgaccagcgcgcgtccgtgttctcgtactaaacactctcgttttgcactgctggcggcagcactgaccgctcgtcgtgtgaaacagttcaccaagcagtttcgttctcgccgcatggcagaggacattctgaagctgtggcagcgtcagtatcatctgccgcgtgaagattctgacaagcgtaccctgcgtgagcgcgttcatctgtatcgtccgccgcgtagcgacctgggcggcatcgcggttgcggttaccgttattgctctgtgggcaaccctgtttgtttatggcctgtggttcgttaagctgccgtgggcgctgaaagttggtgagaccgctacttcttgggcgaccatcgcagcggttttcttctctctggaattcctgtacactggtctgttcatcaccactcacgatgcgatgcacggtactatcgcactgcgtaaccgtcgtctgaacgattttctgggtcagctggcaatttccctgtacgcgtggtttgactattctgtgctgcaccgtaaacattgggaacatcataaccataccggcgaaccgcgtgttgacccggacttccatcgtggcaacccgaacctggcagtgtggttcgcgcagtttatggtgagctacatgactctgtcccagtttctgaagatcgcggtttggtccaacctgctgctgctggcgggtgcgccgctggcaaaccagctgctgtttatgaccgcagcaccgatcctgtctgcgttccgcctgttctattacggcacttatgttccgcaccatccggagaagggccatactggcgcgatgccgtggcaggtttcccgcacttcttccgcatcccgcctgcagtcctttctgacttgctatcatttcgacctgcactgggagcatcatcgttggccgtatgctccgtggtgggagctgccgaaatgccgtcagatcgcacgtggcgcagctctggctcagctgctgaacttcgatctgctgaagctggcaggcgacgttgaatccaaccctgggcccatggcttcttctgcatttgcttttccttcttacataataaccaaaggaggactttcaactgattcttgtaaatcaacttctttgtcttcttctagatctttggttacagatcttccatcaccatgtctgaaacccaacaacaattcccattcaaacagaagagcaaaagtgtgtgcttcacttgcagagaagggtgaatattattcaaacagaccaccaactccattacttgacactattaactacccaatccacatgaaaaatctttctgtcaaggaactgaaacaactttctgatgagctgagatcagacgtgatctttaatgtgtcgaaaaccggtggacatttggggtcaagtcttggtgttgtggagcttactgtggctcttcattacattttcaatactccacaagacaagattctttgggatgttggtcatcagtcttatcctcataagattcttactgggagaagaggaaagatgcctacaatgaggcaaaccaatggtctctctggtttcaccaaacgaggagagagtgaacatgattgctttggtactggacacagctcaaccacaatatctgctggtttaggaatggcggtaggaagggatttgaaggggaagaacaacaatgtggttgctgtgattggtgatggtgcgatgacggcaggacaggcttatgaagccatgaacaacgccggatatctagactctgatatgattgtgattcttaatgacaacaagcaagtctcattacctacagctactttggatggaccaagtccacctgttggtgcattgagcagtgctcttagtcggttacagtctaacccggctctcagagagttgagagaagtcgcaaagggtatgacaaagcaaataggcggaccaatgcatcagttggcggctaaggtagatgtgtatgctcgaggaatgataagcggtactggatcgtcactgtttgaagaactcggtctttactatattggtccagttgatgggcacaacatagatgatttggtagccattcttaaagaagttaagagtaccagaaccacaggacctgtacttattcatgtggtgacggagaaaggtcgtggttatccttacgcggagagagctgatgacaaataccatggtgttgtgaaatttgatccagcaacgggtagacagttcaaaactactaatgagactcaatcttacacaacttactttgcggaggcattagtcgcagaagcagaggtagacaaagatgtggttgcgattcatgcagccatgggaggtggaaccgggttaaatctctttcaacgtcgcttcccaacaagatgtttcgatgtaggaatagcggaacaacacgcagttacttttgctgcgggtttagcctgtgaaggccttaaacccttctgtgcaatctattcgtctttcatgcagcgtgcttatgaccaggttgtccatgatgttgatttgcaaaaattaccggtgagatttgcaatggatagagctggactcgttggagctgatggtccgacacattgtggagctttcgatgtgacatttatggcttgtcttcctaacatgatagtgatggctccatcagatgaagcagatctctttaacatggttgcaactgctgttgcgattgatgatcgtccttcttgtttccgttaccctagaggtaacggtattggagttgcattacctcccggaaacaaaggtgttccaattgagattgggaaaggtagaattttaaaggaaggagagagagttgcgttgttgggttatggctcagcagttcagagctgtttaggagcggctgtaatgctcgaagaacgcggattaaacgtaactgtagcggatgcacggttttgcaagccattggaccgtgctctcattcgcagcttagctaagtcgcacgaggttctgatcacggttgaagaaggttccattggaggttttggctcgcacgttgttcagtttcttgctctcgatggtcttcttgatggcaaactcaagtggagaccaatggtactgcctgatcgatacattgatcacggtgcaccagctgatcaactagctgaagctggactcatgccatctcacatcgcagcaaccgcacttaacttaatcggtgcaccaagggaagctctgttttgagagctc, respectively; the recombinant plasmid takes pBI121 as an original plasmid; the recombinant plasmid deletes a screening marker gene NPT II; the recombinant plasmid preferably uses Napin promoter as promoter.

The selectable marker gene NPT II is a resistance marker gene and is used as a selectable marker to obtain successfully transformed cells. pBI121 contains a selection marker gene NPT II. The invention can eliminate the potential harm of the recombinant plasmid to food and ecological environment in the plant breeding process by deleting the screening marker gene NPT II on pBI 121.

The astaxanthin synthetase fusion gene comprises three key enzyme genes in an astaxanthin synthesis way and an Orange (from cauliflower) gene for promoting the differentiation of a chromosome and the storage of carotenoid, wherein the three key enzyme genes are respectively a beta-carotene ketolase (CrBKT) from chlamydomonas reinhardtii, a hydroxylase (HpBHY) gene from haematococcus pluvialis and a phytoene synthetase (CrtB) gene. The invention connects four key enzyme genes by 2A short peptide sequences, can simplify the construction of recombinant plasmids (expression vectors) and realize the synergistic expression of each gene.

In the invention, the astaxanthin synthetase fusion gene comprises three genes (CrtB, CrBKT, HpBHY, BBB for short) related to the synthesis of carotenoids such as astaxanthin and the like and a gene for promoting the synthesis of carotenoids (Orange). Chloroplast peptide leader (TP) sequences of Arabidopsis RBCS2 are fused before ATG at the 5' end of three genes of BBB, and the four genes are linked by 2A sequences so that the four genes are expressed in the same reading frame and form respective coded peptides when translated. The construction method of the recombinant plasmid is not particularly limited in the invention, and the conventional method in the field can be adopted. In the specific implementation process of the invention, the astaxanthin synthetase fusion gene is cloned in pBI121 after total synthesis, and preferably, a Napin promoter is used for controlling expression to form a recombinant plasmid.

The invention provides a recombinant bacterium comprising the recombinant plasmid of the scheme; the original strain of the recombinant strain preferably comprises agrobacterium.

The invention provides application of the recombinant plasmid or the recombinant bacterium in camelina sativa breeding.

The invention provides application of the recombinant plasmid or the recombinant bacterium in the scheme in improving the content of carotenoid in camelina sativa seeds; the carotenoid comprises astaxanthin; preferably, the carotenoids further comprise neoxanthin, ketolutein, astaxanthin, lutein, esterified lutein, chlorophyll, cryptoxanthin, echinenone, lycopene, alpha-carotene and/or beta-carotene.

The invention provides application of the recombinant plasmid or the recombinant bacterium in the scheme in improving the total antioxidant capacity of camelina sativa seeds.

Preferably, the application comprises the following steps: introducing the recombinant plasmid or recombinant bacterium into a camelina sativa plant, culturing to obtain camelina sativa seeds, and selecting red seeds from the camelina sativa seeds to obtain target camelina sativa seeds; the introduction method comprises an agrobacterium inflorescence dip dyeing method. The red color is preferably dark red; since the carotenoid is red, yellow and orange pigments which can change the color of plant organs after being synthesized in the plant organs, the harvested T0 generation seeds can be identified by visually observing the color to successfully transform the seeds. The successfully transformed seeds are dark red due to the accumulation of the carotenoid, the untransformed seeds are light yellow, the color difference between the two is large, whether the transformation is successful or not can be directly identified by naked eyes, and the method is simple and rapid.

The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

Materials and methods

1. Material

The germplasm material SC-N16 of Camelina sativa (L.) (see [ Astera crispa, Hutouyun Zhao, Qu, et al.2 EMS for mutagenesis of Camelina sativa to obtain 2S storage protein deletion mutant, North China agro school, 2016, 31(3): 11-17) is provided by the crop genetic breeding focus laboratory of Shanxi university of agriculture. Sowing camelina sativa seeds in seedling raising pots with the diameter of 9cm, wherein 1 seed per pot; the matrix in the basin is humus: peat soil: perlite 5: 4: 1 (volume ratio); the greenhouse temperature is 16-22 ℃, the light source is natural light, and the relative humidity is 60%. And (4) pinching when the plant grows to 10cm so as to promote the growth and development of the lateral branches. The plants enter the flowering phase for preparation for transformation when growing for about 70 days, and the plants are watered thoroughly the day before transformation. A total of 20 (pot) plants were treated and 5 (pot) were not treated as controls.

2. Method of producing a composite material

2.1 construction of plant expression vectors

Plant watchThe plasmid pBI121-Napin-BBBO was synthesized by Kunming Ongsu Biotechnology Ltd. The pBI121 is subjected to double enzyme digestion by Nhe I and ClaI and then recovered, the enzyme is filled with T4 Ploymerase, the enzyme is connected with T4 DNA ligase and then transformed into Escherichia coli DH5 alpha, a bacterial colony is picked up at 37 ℃, 220rmp bacteria are shaken, and bacterial liquid is extracted to obtain the pBI121(-NPT II) plasmid. Plasmid pBI121-Napin-BBBO and plasmid pBI121(-NPT II) are respectively recovered after double enzyme digestion by Hind III and Sac I, T4 DNA ligase enzyme is connected and transformed into escherichia coli DH5 alpha, plasmid is extracted from bacterial liquid and then double enzyme digestion is carried out for identification, after the identification is correct, the plasmid pBI121(-NPT II) -Napin-BBBO is transformed into agrobacterium strain LBA4404 by an electrotransformation method with reference to figure 1 (abbreviated as: N-BBBO (-NPT II)), and the obtained strain is stored in a refrigerator at-80 ℃ for transformation of camelina sativa. The electrotransformation apparatus used was a Bio-Rad Gene P. mu. lserX cell^TMThe electrotransfer conditions are as follows: 2.5KV, 25 muF capacitance, 400 omega resistance.

2.2 transformation of camelina sativa by Agrobacterium Floral Dip

Agrobacterium N-BBBO (-NPT II) containing the recombinant plasmid stored at-80 ℃ was streaked on LB solid culture medium containing 50mg/L streptomycin and 50mg/L kanamycin, and cultured at 28 ℃ for about 36 hours. A single colony was picked from the plate and inoculated in 3ml of LB liquid medium containing the above antibiotic, and cultured overnight at 28 ℃ with shaking at 220 rpm/min. Sucking 2ml of agrobacterium liquid, adding the agrobacterium liquid into 250ml of LB liquid culture medium containing the corresponding antibiotics, carrying out shaking culture at 220rpm/min at 28 ℃ until OD600 is 0.8-1.0, centrifuging at 5000rpm/min for 10min, collecting thalli, and suspending the thalli by using an equal-volume permeation culture medium (1/2MS, 5% of sucrose, 0.05% of Silwet L-77, pH 5.7). During transformation, a pot for planting camelina sativa plants is wrapped by a preservative film, the plants are placed in a vacuum barrel in an inverted mode, and inflorescence parts are immersed in an osmotic culture medium. Covering a vacuum barrel cover, vacuumizing at 80Kpa, starting timing, taking out the plants after 5min, flatly placing the plants on the ground paved with the preservative film, and covering the plants with black plastic bags. After 24h, the plants are placed in a greenhouse for cultivation, after one week, the plants are placed in the greenhouse for conventional cultivation after repeated dip dyeing once according to the method until the pods are mature, and the collected mature seeds are marked as T0 generations for subsequent experiments.

3. Identification of transgenic plants

3.1T 0 generation seed color identification

Since carotenoids are red, yellow, and orange pigments, they change the color of plant organs when synthesized in them. The seeds of T0 generation were harvested, and the seeds successfully transformed were identified by visually observing the color of the seeds, and the transformation rate was calculated.

3.2 transformant molecule identification

For further verification, red T0-generation seeds screened in the initial stage are germinated, planted in a greenhouse and harvested to obtain T1-generation seeds, the harvested red T1-generation seeds are germinated to obtain T2 plants, DNA of the T2-generation plants is extracted, and CRBKT primers are used for amplification and identification.

3.3 carotenoid assay method

3.3.1 extraction method: accurately weighing camelina sativa seeds (0.2-0.3 g) in a 2.0mg EP tube, setting 3 times for each sample, adding 2 steel balls with the diameter of 2mm and 200 mul of acetone solution, grinding in a rapid grinding instrument (frequency 65Hz, 99s) for 5 times, adding 500 mul of acetone solution, and placing in an ultrasonic cleaner for ultrasonic elution for 30 min. The supernatant was centrifuged at high speed (14800rmp/min, 10min), filtered through a 0.22 μm filter and then subjected to sample application.

3.2.2 UHPLC method: the instrument comprises the following steps: agilent technologies 1290 Infinity; a chromatographic column: ZORBAX Eclipse (3.0X 50mm 1.8-Micron, Agilent, USA); flow rate: 1 ml/min; sample introduction amount: 5 mu l of the solution; mobile phase procedure: 0-1.0 min: water: 20%, acetonitrile: 60%, isopropyl alcohol: 5%, methanol: 15 percent; 1.0-2.0 min: water: 0%, acetonitrile: 80%, isopropyl alcohol: 5%, methanol: 15 percent; 2.0-8.0 min: water: 0%, acetonitrile: 80%, isopropyl alcohol: 5%, methanol: 15 percent;

3.3.3 carotenoid quantitation: the carotenoid content in the sample was quantified using an external standard method.

3.4 Total antioxidant Capacity determination of seeds

The total antioxidant capacity of the seeds is measured by using a total antioxidant capacity kit of Suzhou Gerrix Biotechnology GmbH.

Second, results and analysis

1. Identification of transgenic plants

1) Identification of plant, seed and seed pigment extracting solution

A real picture of T0 transformed seedlings and wild type seedlings is shown in FIG. 2, wherein A is T0 transformed seedlings and B is wild type seedlings;

a picture of T1 generation seed and wild type seed in real life is shown in fig. 3, wherein a is T1 generation seed and B is wild type seed;

the material picture of the T1 generation seed pigment extractive solution and wild type seed pigment extractive solution is shown in FIG. 4, wherein A is T1 generation seed pigment extractive solution; b is wild seed pigment extract.

Carotenoids are accumulated in camelina sativa seeds, the colors of seeds successfully transformed in the T0 generation are obviously different from those of untransformed seeds, the successfully transformed seeds are obviously dark red, and the untransformed seeds are faint yellow. 1125 grains of seeds were co-harvested from 10 plants (pots), of which 1 grain of red seeds (successfully transformed) had a transformation rate of 1/1125.

2) Molecular identification of transformant N-BBBO (-NPTII)

For further validation, red T0 seeds screened in the early stage were germinated and planted in the greenhouse, and T2 plant leaf DNA was extracted and amplified with CRBKT primers.

The nucleotide sequence of the forward primer is shown as SEQ ID NO: 2, specifically: 5'-GAACCTGGCAGTGTGGTTC-3', respectively;

the nucleotide sequence of the reverse primer is shown as SEQ ID NO: 3, specifically: 5'-AAAGGACTGCAGGCGGGATG-3' are provided. The results of PCR amplification are shown in FIG. 5, and it can be seen from FIG. 5 that the CRBKT gene was expressed in the transformant.

3) Analysis of seed Carotenoid content

UHPLC chromatogram of transformant seed is shown in FIG. 6, wherein 1. neoxanthin, 2. ketolutein, 3. astaxanthin, 4. ketolutein, 5. lutein, 6. esterified lutein, 7. chlorophyll, 8. cryptoxanthin, 9. echinenone, 10. lycopene, 11. alpha-carotene, 12. beta-carotene; UHPLC chromatogram of wild type seeds see FIG. 7, wherein 5. lutein; see table 1 for a table of total carotenoid content. As can be seen from FIGS. 6, 7 and Table 1, the wild type seed contained only lutein at a content of 16.08. mu.g/gDW, while the transformant N-BBBO (-NPTII) seed contained 12 well-defined carotenoids including Neoxanthin (Neoxanthin), ketolutein (ketolutetin), Astaxanthin (Astaxanthin), lutein (lutein), esterified lutein (Ester-ketolutein), chlorophyll (ChlorophyII), Cryptoxanthin (beta-Cryptoxanthin), Echinenone (Echinone), lycopene (lycopene), alpha-carotene (alpha-carotene), beta-carotene (beta-carotene), and the total carotenoid content of 913.54. mu.g/gDW, which is 56 times that of the wild type, was also increased from 0 to 42.72. mu.g/gDW.

TABLE 1 comparison of the transformant N-BBBO (-NPT II) with the wild-type carotenoid content

Data are expressed as mean ± sem, n ═ 3, representing significant differences at the level of p < 0.05.

4) Analysis of Total antioxidant Capacity of seeds

Referring to fig. 8 (data are expressed as mean ± sem, N is 3) showing that the total antioxidant capacity of the N-BBBO- (nptii) transformant seed is 8.22 μmol/g, the wild type is 3.02 μmol/g, and the total antioxidant capacity of the transformant seed is significantly higher than that of the wild type, as shown in fig. 8. The accumulation of high content of total carotenoids, especially astaxanthin, significantly improves the total antioxidant capacity of the seeds.

From the above, it can be seen that the present invention expresses three key enzyme genes in the astaxanthin synthesis pathway, namely, a beta-carotene ketolase (CrBKT) from Chlamydomonas reinhardtii, a hydroxylase (HpBHY) gene from Haematococcus pluvialis, a phytoene synthase (CrtB) gene from Pantoea ananatis, and an Orange (from cauliflower) gene promoting chromosome differentiation and carotenoid storage in camelina sativa, which is an oil crop. Meanwhile, in order to simplify the construction of an expression vector and realize the synergistic expression of each gene in camelina sativa seeds, four key enzyme genes are connected by using a hand-foot-mouth disease 2A self-cutting peptide segment, and are introduced into the camelina sativa which is an oil crop through an agrobacterium inflorescence dip-dyeing method under the control of a seed specific promoter NAPIN. In the previous experiment, the seeds which are successfully transformed are dark red due to the accumulation of the carotenoid, the seeds which are not successfully transformed are light yellow, the color difference between the two is large, and the seeds can be distinguished by naked eyes, so that the screening marker gene (-NPT II) is deleted when a vector is constructed. The method is simple, quick and safe. 1125 grains of seeds were co-harvested from 10 plants (pots), of which 1 grain of red seeds (successfully transformed) had a transformation rate of 1/1125. The safe and high-quality camelina sativa strain which can synthesize astaxanthin in seeds and accumulate astaxanthin at high content and does not have a selective marker gene is obtained by using strategies of promoting synthesis, reducing product degradation and the like. The total carotenoid content was 913.54. mu.g/gDW, which is 56 times higher than the wild type (16.08. mu.g/gDW), and the astaxanthin content increased from 0 to 42.72. mu.g/gDW. The total antioxidant capacity of the seeds of the transformation strain is obviously higher than that of the wild type.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Kunming plant institute of Chinese academy of sciences

<120> recombinant plasmid containing astaxanthin synthetase fusion gene and screening marker-free gene NPT II, recombinant bacterium and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5657

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cccgggacaa agagtaaaga agaacaatgg catcttctat gctgtcttct gcgactatgg 60

ttgcgtctcc ggctcaggct actatggtgg caccgttcaa cggtctgaag tcctccgcgg 120

ctttcccggc tactcgtaaa gcgaacaacg acattaccag cattacctct aacggtggtc 180

gtgtgaactg catgaacaac ccgtctctgc tgaaccatgc ggtggaaacc atggcggtgg 240

gttccaaatc cttcgcgacc gcgtctaagc tgttcgatgc aaagacccgt cgttctgtgc 300

tgatgctgta tgcatggtgc cgccattgtg acgacgttat cgacgaccag actctgggct 360

tccaggcacg tcagccggcg ctgcagactc cggaacagcg tctgatgcag ctggagatga 420

agactcgcca ggcttatgca ggctctcaga tgcacgaacc ggcgttcgct gctttccagg 480

aagttgcgat ggcgcatgat atcgctccgg catacgcgtt tgatcatctg gaaggcttcg 540

ctatggacgt gcgcgaggcg cagtactccc agctggacga taccctgcgc tactgctacc 600

acgttgctgg tgttgtgggc ctgatgatgg cacagatcat gggtgttcgt gataacgcga 660

ccctggatcg cgcatgtgac ctgggtctgg cattccagct gactaacatt gcgcgtgaca 720

ttgttgacga tgcgcacgca ggccgttgtt atctgccggc gtcttggctg gaacacgaag 780

gcctgaacaa agaaaactac gctgcaccgg aaaaccgtca ggcactgtct cgcatcgctc 840

gccgcctggt gcaggaagca gagccgtact atctgagcgc gactgcgggc ctggctggcc 900

tgccgctgcg tagcgcttgg gcgattgcta ccgctaagca ggtgtaccgc aaaatcggtg 960

tgaaggttga gcaggcaggt cagcaggcgt gggatcagcg tcagtccacc actaccccgg 1020

aaaaactgac cctgctgctg gcagctagcg gccaggcgct gacttctcgt atgcgtgcac 1080

atccgccgcg tccggcacac ctgtggcagc gtccgctgtc tagacagctg ctgaactttg 1140

atctgctgaa actggctggt gacgtggagt ctaaccctgg tccgatggcg tcctctatgc 1200

tgtcttctgc tactatggtg gcatctccgg ctcaggcaac tatggtggca ccgtttaacg 1260

gtctgaagtc ttccgcagct ttcccggcaa ctcgcaaggc aaacaacgat attactagca 1320

ttacttccaa cggtggccgt gttaactgca tgctgagcaa gctgcagtct attagcgtta 1380

aggctcgccg tgtggagctg gctcgtgaca ttacccgtcc gaaagtttgt ctgcacgcgc 1440

agcgttgtag cctggtgcgt ctgcgtgtgg cggctccgca gactgaagag gcactgggta 1500

ccgttcaggc tgcaggtgcg ggcgacgaac actccgctga tgtggctctg cagcagctgg 1560

atcgtgcgat tgcagaacgt cgtgcgcgtc gcaaacgcga acagctgagc tatcaggcag 1620

cggctatcgc tgcttctatt ggtgtgtccg gtattgcgat cttcgcgacc tatctgcgtt 1680

tcgctatgca catgactgtg ggtggtgcgg ttccgtgggg cgaagttgcg ggtactctgc 1740

tgctggttgt tggtggcgct ctgggcatgg agatgtatgc gcgttatgcg cacaaagcga 1800

tctggcacga gtccccgctg ggttggctgc tgcacaaaag ccatcacacc ccgcgtaccg 1860

gtccgttcga ggctaacgat ctgtttgcaa tcatcaacgg cctgccggcg atgctgctgt 1920

gcaccttcgg cttctggctg ccgaacgtgc tgggcgcggc ttgtttcggc gcaggtctgg 1980

gtatcactct gtacggcatg gcgtacatgt tcgtgcatga tggtctggtt catcgtcgtt 2040

tcccgactgg cccgatcgcg ggtctgccgt atatgaaacg cctgactgtt gctcatcagc 2100

tgcatcattc tggcaaatat ggcggtgcgc cgtggggtat gttcctgggt ccgcaggaac 2160

tgcagcatat tccgggtgcg gctgaggaag tggaacgtct ggtgctggaa ctggactggt 2220

ccaaacgtca gctgctgaac ttcgatctgc tgaaactggc gggtgacgtg gaatctaacc 2280

ctggtccgat ggctagctct atgctgtcct ccgctaccat ggttgcgtcc ccggcacagg 2340

cgactatggt ggctccgttc aacggcctga aatctagcgc tgcatttccg gcgactcgta 2400

aggcgaacaa cgacatcact tctatcacca gcaacggcgg tcgcgttaac tgtatgggtc 2460

cgggtatcca gccgaccagc gcgcgtccgt gttctcgtac taaacactct cgttttgcac 2520

tgctggcggc agcactgacc gctcgtcgtg tgaaacagtt caccaagcag tttcgttctc 2580

gccgcatggc agaggacatt ctgaagctgt ggcagcgtca gtatcatctg ccgcgtgaag 2640

attctgacaa gcgtaccctg cgtgagcgcg ttcatctgta tcgtccgccg cgtagcgacc 2700

tgggcggcat cgcggttgcg gttaccgtta ttgctctgtg ggcaaccctg tttgtttatg 2760

gcctgtggtt cgttaagctg ccgtgggcgc tgaaagttgg tgagaccgct acttcttggg 2820

cgaccatcgc agcggttttc ttctctctgg aattcctgta cactggtctg ttcatcacca 2880

ctcacgatgc gatgcacggt actatcgcac tgcgtaaccg tcgtctgaac gattttctgg 2940

gtcagctggc aatttccctg tacgcgtggt ttgactattc tgtgctgcac cgtaaacatt 3000

gggaacatca taaccatacc ggcgaaccgc gtgttgaccc ggacttccat cgtggcaacc 3060

cgaacctggc agtgtggttc gcgcagttta tggtgagcta catgactctg tcccagtttc 3120

tgaagatcgc ggtttggtcc aacctgctgc tgctggcggg tgcgccgctg gcaaaccagc 3180

tgctgtttat gaccgcagca ccgatcctgt ctgcgttccg cctgttctat tacggcactt 3240

atgttccgca ccatccggag aagggccata ctggcgcgat gccgtggcag gtttcccgca 3300

cttcttccgc atcccgcctg cagtcctttc tgacttgcta tcatttcgac ctgcactggg 3360

agcatcatcg ttggccgtat gctccgtggt gggagctgcc gaaatgccgt cagatcgcac 3420

gtggcgcagc tctggctcag ctgctgaact tcgatctgct gaagctggca ggcgacgttg 3480

aatccaaccc tgggcccatg gcttcttctg catttgcttt tccttcttac ataataacca 3540

aaggaggact ttcaactgat tcttgtaaat caacttcttt gtcttcttct agatctttgg 3600

ttacagatct tccatcacca tgtctgaaac ccaacaacaa ttcccattca aacagaagag 3660

caaaagtgtg tgcttcactt gcagagaagg gtgaatatta ttcaaacaga ccaccaactc 3720

cattacttga cactattaac tacccaatcc acatgaaaaa tctttctgtc aaggaactga 3780

aacaactttc tgatgagctg agatcagacg tgatctttaa tgtgtcgaaa accggtggac 3840

atttggggtc aagtcttggt gttgtggagc ttactgtggc tcttcattac attttcaata 3900

ctccacaaga caagattctt tgggatgttg gtcatcagtc ttatcctcat aagattctta 3960

ctgggagaag aggaaagatg cctacaatga ggcaaaccaa tggtctctct ggtttcacca 4020

aacgaggaga gagtgaacat gattgctttg gtactggaca cagctcaacc acaatatctg 4080

ctggtttagg aatggcggta ggaagggatt tgaaggggaa gaacaacaat gtggttgctg 4140

tgattggtga tggtgcgatg acggcaggac aggcttatga agccatgaac aacgccggat 4200

atctagactc tgatatgatt gtgattctta atgacaacaa gcaagtctca ttacctacag 4260

ctactttgga tggaccaagt ccacctgttg gtgcattgag cagtgctctt agtcggttac 4320

agtctaaccc ggctctcaga gagttgagag aagtcgcaaa gggtatgaca aagcaaatag 4380

gcggaccaat gcatcagttg gcggctaagg tagatgtgta tgctcgagga atgataagcg 4440

gtactggatc gtcactgttt gaagaactcg gtctttacta tattggtcca gttgatgggc 4500

acaacataga tgatttggta gccattctta aagaagttaa gagtaccaga accacaggac 4560

ctgtacttat tcatgtggtg acggagaaag gtcgtggtta tccttacgcg gagagagctg 4620

atgacaaata ccatggtgtt gtgaaatttg atccagcaac gggtagacag ttcaaaacta 4680

ctaatgagac tcaatcttac acaacttact ttgcggaggc attagtcgca gaagcagagg 4740

tagacaaaga tgtggttgcg attcatgcag ccatgggagg tggaaccggg ttaaatctct 4800

ttcaacgtcg cttcccaaca agatgtttcg atgtaggaat agcggaacaa cacgcagtta 4860

cttttgctgc gggtttagcc tgtgaaggcc ttaaaccctt ctgtgcaatc tattcgtctt 4920

tcatgcagcg tgcttatgac caggttgtcc atgatgttga tttgcaaaaa ttaccggtga 4980

gatttgcaat ggatagagct ggactcgttg gagctgatgg tccgacacat tgtggagctt 5040

tcgatgtgac atttatggct tgtcttccta acatgatagt gatggctcca tcagatgaag 5100

cagatctctt taacatggtt gcaactgctg ttgcgattga tgatcgtcct tcttgtttcc 5160

gttaccctag aggtaacggt attggagttg cattacctcc cggaaacaaa ggtgttccaa 5220

ttgagattgg gaaaggtaga attttaaagg aaggagagag agttgcgttg ttgggttatg 5280

gctcagcagt tcagagctgt ttaggagcgg ctgtaatgct cgaagaacgc ggattaaacg 5340

taactgtagc ggatgcacgg ttttgcaagc cattggaccg tgctctcatt cgcagcttag 5400

ctaagtcgca cgaggttctg atcacggttg aagaaggttc cattggaggt tttggctcgc 5460

acgttgttca gtttcttgct ctcgatggtc ttcttgatgg caaactcaag tggagaccaa 5520

tggtactgcc tgatcgatac attgatcacg gtgcaccagc tgatcaacta gctgaagctg 5580

gactcatgcc atctcacatc gcagcaaccg cacttaactt aatcggtgca ccaagggaag 5640

ctctgttttg agagctc 5657

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaacctggca gtgtggttc 19

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaggactgc aggcgggatg 20

Claims (6)

1. An application of a recombinant plasmid containing an astaxanthin synthetase fusion gene and a screening marker-free gene NPT II or a recombinant bacterium containing the recombinant plasmid in improving the content of carotenoid in camelina sativa seeds;

the nucleotide sequence of the astaxanthin synthetase fusion gene is shown as SEQ ID NO: 1 is shown in the specification; the recombinant plasmid takes pBI121 as an original plasmid; the recombinant plasmid deletes the screening marker gene NPT II.

2. Use according to claim 1, characterized in that the carotenoid is astaxanthin.

3. Use according to claim 2, wherein the carotenoid is further selected from one or more of neoxanthin, ketolutein, lutein, esterified lutein, chlorophyll, cryptoxanthin, echinenone, lycopene, alpha-carotene and beta-carotene.

4. An application of a recombinant plasmid containing an astaxanthin synthetase fusion gene and a screening marker-free gene NPT II or a recombinant bacterium containing the recombinant plasmid in improving the total antioxidant capacity of camelina sativa seeds;

the nucleotide sequence of the astaxanthin synthetase fusion gene is shown as SEQ ID NO: 1 is shown in the specification; the recombinant plasmid takes pBI121 as an original plasmid; the recombinant plasmid deletes the screening marker gene NPT II.

5. The use according to any one of claims 1 to 4, characterized in that it comprises the following steps:

and introducing the recombinant plasmid or the recombinant bacterium into a camelina sativa plant, culturing to obtain camelina sativa seeds, and selecting red seeds from the camelina sativa seeds to obtain the target camelina sativa seeds.

6. The use of claim 5, wherein said introduction is by a method comprising Agrobacterium inflorescence dip-staining.

Images