CN103866031B - The PCR of Escherichia coli O 157: H7 detects primer and detection kit - Google Patents
The PCR of Escherichia coli O 157: H7 detects primer and detection kit Download PDFInfo
- Publication number
- CN103866031B CN103866031B CN201410130211.7A CN201410130211A CN103866031B CN 103866031 B CN103866031 B CN 103866031B CN 201410130211 A CN201410130211 A CN 201410130211A CN 103866031 B CN103866031 B CN 103866031B
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- primer
- pcr
- seqidno
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 241001646719 Escherichia coli O157:H7 Species 0.000 title claims abstract description 25
- 238000001514 detection method Methods 0.000 title claims abstract description 19
- 241001333951 Escherichia coli O157 Species 0.000 claims abstract description 19
- 238000012360 testing method Methods 0.000 claims abstract description 15
- 238000006243 chemical reaction Methods 0.000 claims description 7
- 239000007788 liquid Substances 0.000 claims description 7
- 238000004519 manufacturing process Methods 0.000 claims description 6
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 5
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 5
- 230000001186 cumulative effect Effects 0.000 claims description 2
- 238000013016 damping Methods 0.000 claims description 2
- 239000012530 fluid Substances 0.000 claims description 2
- 229910021642 ultra pure water Inorganic materials 0.000 claims description 2
- 239000012498 ultrapure water Substances 0.000 claims description 2
- 238000005516 engineering process Methods 0.000 abstract description 4
- 238000009004 PCR Kit Methods 0.000 abstract description 2
- 238000011144 upstream manufacturing Methods 0.000 abstract description 2
- 239000002773 nucleotide Substances 0.000 abstract 2
- 125000003729 nucleotide group Chemical group 0.000 abstract 2
- 108091036078 conserved sequence Proteins 0.000 abstract 1
- 239000000284 extract Substances 0.000 abstract 1
- 239000000203 mixture Substances 0.000 abstract 1
- 238000012772 sequence design Methods 0.000 abstract 1
- 241000894006 Bacteria Species 0.000 description 14
- 108090000623 proteins and genes Proteins 0.000 description 13
- 239000006228 supernatant Substances 0.000 description 10
- 238000002360 preparation method Methods 0.000 description 8
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 8
- 235000015278 beef Nutrition 0.000 description 7
- 230000001580 bacterial effect Effects 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 238000001556 precipitation Methods 0.000 description 6
- 238000012408 PCR amplification Methods 0.000 description 5
- 210000004556 brain Anatomy 0.000 description 5
- 238000013461 design Methods 0.000 description 5
- 230000000968 intestinal effect Effects 0.000 description 5
- 239000010865 sewage Substances 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 230000008676 import Effects 0.000 description 4
- 244000005700 microbiome Species 0.000 description 4
- 238000012856 packing Methods 0.000 description 4
- 230000035945 sensitivity Effects 0.000 description 4
- 238000004088 simulation Methods 0.000 description 4
- 241000588724 Escherichia coli Species 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 238000000137 annealing Methods 0.000 description 3
- 244000052616 bacterial pathogen Species 0.000 description 3
- 238000009835 boiling Methods 0.000 description 3
- 230000004087 circulation Effects 0.000 description 3
- 238000004925 denaturation Methods 0.000 description 3
- 230000036425 denaturation Effects 0.000 description 3
- 239000012153 distilled water Substances 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 241000283690 Bos taurus Species 0.000 description 2
- 101100410650 Escherichia coli O157:H7 purE gene Proteins 0.000 description 2
- 241000010756 Escherichia coli O157:H7 str. EDL933 Species 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 235000003283 Pachira macrocarpa Nutrition 0.000 description 2
- 241000607142 Salmonella Species 0.000 description 2
- 229920002684 Sepharose Polymers 0.000 description 2
- 244000300264 Spinacia oleracea Species 0.000 description 2
- 235000009337 Spinacia oleracea Nutrition 0.000 description 2
- 240000001085 Trapa natans Species 0.000 description 2
- 235000014364 Trapa natans Nutrition 0.000 description 2
- 239000011324 bead Substances 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- LOKCTEFSRHRXRJ-UHFFFAOYSA-I dipotassium trisodium dihydrogen phosphate hydrogen phosphate dichloride Chemical compound P(=O)(O)(O)[O-].[K+].P(=O)(O)([O-])[O-].[Na+].[Na+].[Cl-].[K+].[Cl-].[Na+] LOKCTEFSRHRXRJ-UHFFFAOYSA-I 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 210000003608 fece Anatomy 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 235000013372 meat Nutrition 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 239000002953 phosphate buffered saline Substances 0.000 description 2
- 239000013641 positive control Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 235000009165 saligot Nutrition 0.000 description 2
- 238000005464 sample preparation method Methods 0.000 description 2
- 239000002689 soil Substances 0.000 description 2
- 238000011895 specific detection Methods 0.000 description 2
- MEIRRNXMZYDVDW-MQQKCMAXSA-N (2E,4E)-2,4-hexadien-1-ol Chemical compound C\C=C\C=C\CO MEIRRNXMZYDVDW-MQQKCMAXSA-N 0.000 description 1
- 235000005254 Allium ampeloprasum Nutrition 0.000 description 1
- 240000006108 Allium ampeloprasum Species 0.000 description 1
- 241000193830 Bacillus <bacterium> Species 0.000 description 1
- 235000000318 Bindesalat Nutrition 0.000 description 1
- 244000106835 Bindesalat Species 0.000 description 1
- 108050009160 DNA polymerase 1 Proteins 0.000 description 1
- 206010012735 Diarrhoea Diseases 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 206010014896 Enterocolitis haemorrhagic Diseases 0.000 description 1
- 101100437498 Escherichia coli (strain K12) uidA gene Proteins 0.000 description 1
- 208000032759 Hemolytic-Uremic Syndrome Diseases 0.000 description 1
- 206010034107 Pasteurella infections Diseases 0.000 description 1
- 244000046052 Phaseolus vulgaris Species 0.000 description 1
- 235000010627 Phaseolus vulgaris Nutrition 0.000 description 1
- 108010079723 Shiga Toxin Proteins 0.000 description 1
- 241000607764 Shigella dysenteriae Species 0.000 description 1
- 241000147000 Shigella flexneri 2a Species 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000000740 bleeding effect Effects 0.000 description 1
- 230000009514 concussion Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 229940023064 escherichia coli Drugs 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000556 factor analysis Methods 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 230000002008 hemorrhagic effect Effects 0.000 description 1
- 230000001524 infective effect Effects 0.000 description 1
- 239000002054 inoculum Substances 0.000 description 1
- 239000010871 livestock manure Substances 0.000 description 1
- 244000000010 microbial pathogen Species 0.000 description 1
- 238000009629 microbiological culture Methods 0.000 description 1
- 230000009871 nonspecific binding Effects 0.000 description 1
- 201000005115 pasteurellosis Diseases 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 230000005180 public health Effects 0.000 description 1
- 239000006152 selective media Substances 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 229940007046 shigella dysenteriae Drugs 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 235000013311 vegetables Nutrition 0.000 description 1
- 230000001018 virulence Effects 0.000 description 1
- 239000000304 virulence factor Substances 0.000 description 1
- 230000007923 virulence factor Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/10—Enterobacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of Escherichia coli O 157: the PCR of H7 detects primer and detection kit, belongs to biological technical field.Test kit is the rapid technology of a kind of utilization Auele Specific Primer to Escherichia coli O 157: H7 in detection sample, the steps include: one, extracts the Nucleotide in measuring samples; Two, utilize the Nucleotide in described PCR kit detection sample, whether containing Escherichia coli O 157: H7 in judgement sample.Test kit of the present invention is with strong points, easy and simple to handle.Does wherein primer pair comprise: be 5-by sequence? the upstream primer SEQ of atgaataagaatctcatc-3? ID? do are NO.1 and sequence 5-? the downstream primer SEQ of tttcttctcgcagtttcg-3? ID? the primer pair of NO.2 composition.The conserved sequence design that this cover primer sequence is exclusive according to Escherichia coli O 157 on GenBank: H7, has very high specificity and susceptibility.
Description
one, technical field
The invention provides a kind of Escherichia coli O 157: the PCR of H7 detects primer and detection kit, belongs to biological technical field.
two, background technology
Intestinal bacteria (
escherichiacoli,
e.coli) O157:H7 is important foodborne bacterial pathogens, and animal, poultry and the mankind can be caused in worldwide to break out infection.China is by Escherichia coli O 157: H7 is classified as 21 century may to one of healthy 12 kinds of pathogenic micro-organisms having great effect of compatriots, and strong to the virulence of people, infective dose is low, and infection carrier bacteria containing amount reaches l0/more than g can cause infection.After germs have invaded the human body, can causing bleeding property or non hemorrhagic diarrhoea, hemorrhagic colitis and hemolytic uremic syndrome.Escherichia coli O 157: H7 not only concerns food safety, and with medical treatment and public health problem closely related.Infecting to monitor following possible outburst timely and effectively, setting up responsive, special and reliable technology and being used for detecting Escherichia coli O 157 fast and optionally: H7 is extremely necessary.
Current, many reports are attempted developing the method be more suitable for and are detected Escherichia coli O 157: H7.Traditional culture identification technology uses selective medium or colour developing dull and stereotyped detection Escherichia coli O 157: H7, but this method is time-consuming, effort, poor accuracy.Round pcr has been widely used each detection field, plays very important effect.But the obstacle using round pcr to detect Escherichia coli O 157: H7 maximum how to select uniquely special label gene establishment method.Many scholars select shiga toxin gene
stx1 He
stx2,
uidA,
eae,
fimA,
rfbEwith
fliCidentification of escherichia coli O157:H7, although these genes provide some authentication information to a certain extent, most gene is not the exclusive gene of Escherichia coli O 157: H7, directly can not be judged to be Escherichia coli O 157: H7.Therefore, select more special and stable gene identification Escherichia coli O 157: H7, set up Fast Detection Technique, more meaningful and necessity.
In previous research work, by existing Escherichia coli O 157: H7 whole genome sequence information biology, compare of analysis, find new reading frame unique be present in Escherichia coli O 157: in H7 genome.We select Escherichia coli O 157: H7 reference strain EDL933, non-Escherichia coli O 157 bacterial strain and similar enteron aisle bacterial strain Salmonellas, Shigellae etc., set up PCR to carry out detecting and distinguish these pathogenic bacterias, result shows that this new reading frame is Escherichia coli O 157: the label gene that H7 is special and stable.These results of study impel us to develop for detecting Escherichia coli O 157 further: the novel PCR kit of H7.
three, content is found
technical problemthe object of the invention is to provide a kind of specific detection Escherichia coli O 157: H7 primer sequence and test kit.
technical schemespecific embodiment of the invention scheme is as follows:
1, design of primers: BLAST comparison Escherichia coli O 157: H7 genome sequence, finds its peculiar gene, uses DNAStar software design primer pair, is made up of sequence SEQIDNO.1 and SEQIDNO.2.Amplified production is 354bp.
2, pcr amplification, comprises the following steps:
(1) Escherichia coli O 157: H7 microbial culture and Template preparation: transfering loop dips-70 DEG C and preserves bacterial classification, streak inoculation is dull and stereotyped in sorbyl alcohol Mai Kangkai, cultivate 20h, in single colony inoculation 5mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company) for 37 DEG C; If measuring samples is liquid, then directly getting 1mL joins in 9mL heart and brain leach liquor substratum, adding 100uL concentration in substratum is again that 50mg/mL Vulkamycin. PA-93 (Ameresco import packing) cultivates 20h, next day, get inoculum 1mL, the centrifugal 10min of 12000r, the resuspended bacterium mud of 100 μ L pure water, boil 10min, the centrifugal 10min of 12000r, supernatant is template to be checked;
(2) pcr amplification: primer pZF and pZR each 0.2uL, archaeal dna polymerase 1, the DNA profiling 2uL of MgCl21.5uL, 20pmol/uL base sequence as shown in SEQIDNO.1 and SEQIDNO.2 that add dNTPs2.0uL, 25mM of 10 × PCR damping fluid 2.5uL, 2.5mM in the PCR reaction tubes of 0.2mL respectively, adds ultrapure water 15.6uL to cumulative volume 25uL.95 DEG C of denaturation 5min, 94 DEG C of 30s, 50 DEG C-60 DEG C Gradient annealing 30s, 72 DEG C of 40s, 29 circulations, 72 DEG C extend 5min again, amplification PCR primer, 1.2% agarose gel electrophoresis observations, only has the highest annealing temperature of object band, and namely optimum annealing temperature is 60 DEG C.
(3) sensitivity test: first select Escherichia coli O 157: H7 pure cultures of bacteria, then selects the Escherichia coli O 157 of simulation preparation: H7 contaminated samples analyzes the susceptibility of PCR.
(4) specific test: select the bacterium of very easily obscuring with Escherichia coli O 157: H7 to carry out specific detection.
(5) test kit assembling: PCR premixed liquid, archaeal dna polymerase, positive control, negative control and pure water.
beneficial effect
(1) the present invention is based on the discovery of early-stage Study, Escherichia coli O 157: in H7 genome, there is exclusive gene fragment, be different from other intestinal bacteria.According to this fragment gene, design primer increases, and specificity is good.
(2) because the present invention selectes Escherichia coli O 157: the peculiar gene design primer of H7, set up PCR method negative amplification be to e. coli serotype O55 and O26 very easily obscured, there is very good specificity.
(3) primer provided by the invention, without secondary structure, avoids the non-specific binding of primer self, causes false negative to increase.
(4) primer detection sensitivity provided by the invention is high, to Escherichia coli O 157: H7 bacterial cultures lowest detectable limit 10
4cFU/mL, to the positive sewage sample of simulation and meat sample, detectability 10CFU/mL (g) after increasing bacterium.
four, accompanying drawing explanation
Fig. 1: pZF and the PCR sensitivity test figure of pZR primer pair
Detect after 1-6: Escherichia coli O 157: H7 pollution beef sample increases bacterium, 10
4cFU/g, 10
3cFU/g, 10
2cFU/g, 10CFU/g, 1CFU/g and negative control.M:DL-2000 standard molecular weight; 8-15: Escherichia coli O 157: H7 pollutes beef sample direct-detection, positive control, 10
8cFU/g, 10
7cFU/g, 10
6cFU/g, 10
5cFU/g, 10
4cFU/g, 10
3cFU/g and 10
2cFU/g.
five, embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should illustrate, these embodiments are only not used in for the present invention and limit the scope of the invention.The test method of unreceipted specific experiment condition in embodiment below, usually conveniently condition, such as Sambrook equimolecular clone; Condition described in laboratory manual (NewYork:ColdSpringHarberLaboratoryPress, 1989), or according to the condition that manufacturer advises.
embodiment 1
Design of primers
Escherichia coli O 157 according to GenBank delivers: H7EDL933(accession number: AE005174) exclusive conservative property gene order design primer, pZF and pZR primer sequence is SEQIDNO.1 and SEQIDNO.2.Amplification conservative gene fragment is 354bp, and its sequence is SEQIDNO.3.SEQIDNO.1, SEQIDNO.2 and SEQIDNO.3 are as follows:
SEQIDNO.1：5-atgaataagaatctcatc-3
SEQIDNO.2：5-tttcttctcgcagtttcg-3
SEQIDNO.3：atgaataagaatctcatcctcgcatttgcattattttccttacctgtatttgcagaagaagatctggggccaggcaaata
tgtttgtgacattaggatttccagcctggataccgctactcaaattctgtcaaaatccgcaacagttctcgataatggaa
acaatttcatcgttcaaatgccaaatggagatcaattgtactctccagatctggaaaatgttgatgatggtataaaacaa
aaagcaacaataggtggagtgacatttattcgtcgtccaacttttaacgatcgcttcatcgtggaagatggaaatacagg
attcttctataagatgcgaaactgcgagaagaaa
embodiment 2
The sensitivity test of test kit, detects simulation preparation O157:H7 positive by above-mentioned primer.
All simulation preparation O157:H7 positive are all through immunomagnetic beads enrichment (Dynabeadsanti-below
e.colio157 immunomagnetic beads, purchased from Invitrogen company), color developing culture medium bacteria distribution (method reference: the separation of ox source O157:H7 and virulence factor analysis, Chinese animal doctor's journal, 2012,32 (8): 1148-1153.) turn out to be O157:H7 feminine gender and just can select.
2.1 sewage sample preparations: gather sewage from plant, 10mL/ manages, and adds Escherichia coli O 157 successively: H7 culture, final bacterial concentration is respectively 10
6cFU/mL, 10
5cFU/mL, 10
4cFU/mL, 10
3cFU/mL, 10
2cFU/mL, 10CFU/mL and 1CFU/mL.
2.2 beef sample preparations: beef mud 200g is bought in supermarket, and every 10g joins in 90mL phosphate buffered saline buffer, then adds Escherichia coli O 157: H7 culture, final bacterial concentration is respectively 10
8cFU/g, 10
7cFU/g, 10
6cFU/g, 10
5cFU/g, 10
4cFU/g, 10
3cFU/g, 10
2cFU/g, 10CFU/g and 1CFU/g.
The preparation of 2.3 templates to be checked:
By the positive beef mud sample of above-mentioned preparation, getting 1mL respectively joins in 9mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company), adding 100uL concentration in substratum is again 50mg/mL Vulkamycin. PA-93 (Ameresco import packing), 37 DEG C are continued to cultivate 18h, draw 1mL culture, the centrifugal 15min of 500r, abandon precipitation, draw supernatant to new centrifuge tube, the centrifugal 10min of 12000r, abandon supernatant, getting precipitation is resuspended in 1/10 volume distilled water, boiling water bath 10min, and 4 DEG C 12000 leaves heart 10min, draw supernatant, i.e. detection template DNA.
Get the positive sewage sample of above-mentioned preparation, getting 1mL respectively joins in 9mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company), adding 100uL concentration in substratum is again 50mg/mL Vulkamycin. PA-93 (Ameresco import packing), 37 DEG C are continued to cultivate 18h, draw 1mL culture, the centrifugal 15min of 500r, abandon precipitation, draw supernatant to new centrifuge tube, the centrifugal 10min of 12000r, abandon supernatant, getting precipitation is resuspended in 1/10 volume distilled water, boiling water bath 10min, 4 DEG C of centrifugal 10min of 12000r, draw supernatant, i.e. detection template DNA.
2.4pcr amplification condition: add 21uLPCR premixed liquid respectively in the PCR reaction tubes of 0.2mL, archaeal dna polymerase 1uL, DNA profiling 3uL.
2.5pCR pipe is increased as in PCR instrument; Reaction conditions is: 95 DEG C of denaturation 5min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 40s, and 29 circulations, 72 DEG C extend 5min again.By PCR primer in mass ratio be 1.2% sepharose on electrophoresis.
2.6result judges: if amplified production has the band of 354bp, namely indicate Escherichia coli O 157: the existence of H7; If amplified production does not have the band of 354bp, namely indicate without Escherichia coli O 157: the existence of H7.PCR direct-detection Escherichia coli O 157: H7 pure growth template, lowest detection is limited to 10
4cFU/mL.PCR detects each extent of dilution 1CFU/mL-10 simulating positive sewage sample respectively
6cFU/mL, lowest detectable limit 10
4cFU/mL, lowest detectable limit 10CFU/mL after increasing bacterium; PCR detects each extent of dilution 1CFU/g-10 simulating positive meat sample respectively
8cFU/g, lowest detectable limit 10
5cFU/g, lowest detectable limit 10CFU/g after increasing bacterium.Fig. 1.
embodiment 3
The specific test of test kit, comprises the following steps:
According to test kit PCR amplification method in embodiment 2 detect Escherichia coli O 157: H7EDL933, intestinal bacteria O26, intestinal bacteria O55 and non-intestinal bacteria cause of disease (suis, Salmonella, pasteurellosis bacillus, Shigella dysenteriae, shigella flexneri 2a) (Li Li, etc.The foundation of EHECO157H7 duplex PCR and application.North China agronomy report, 2011,26 (6): 61.) result all do not amplify any band, only has Escherichia coli O 157: H7EDL933 amplifies the band of 354bp.
embodiment 4
Above-mentioned primer sequence and test kit detect clinical sample, comprise the following steps:
4.1sample collection: gather cow manure 20 parts, Feces of Beef Cattle 20 parts, 25-30g/ part; Different stands beef is bought in country fair, each 250g, totally 6 samples; Vegetables and fruit wholesale market, buy spinach, bean sprouts, leek, water chestnut and romaine lettuce, each 250g, totally 30 parts.All collections and purchase sample storage, in sample collection bag (Nanjing assistant research fellow company), seal stored refrigerated.
4.2the preparation of template to be checked: take out ight soil or food 10 grams from sample collection bag, join in 90mL phosphate buffered saline buffer, after 37 DEG C of concussion 2h, getting 1mL joins in 9mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company), adding 100uL concentration in substratum is again 50mg/mL Vulkamycin. PA-93 (Ameresco import packing), 37 DEG C are continued to cultivate 18h, draw 1mL culture, the centrifugal 15min of 500r, abandon precipitation, draw supernatant to new centrifuge tube, the centrifugal 10min of 12000r, abandon supernatant, getting precipitation is resuspended in 1/10 volume distilled water, boiling water bath 10min, 4 DEG C of centrifugal 10min of 12000r, draw supernatant, i.e. detection template DNA.
4.3pcr amplification condition: add 22uLPCR premixed liquid respectively in the PCR reaction tubes of 0.2mL, archaeal dna polymerase 1uL, DNA profiling 2uL.
4.4pCR pipe is increased as in PCR instrument; Reaction conditions is: 95 DEG C of denaturation 5min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 40s, and 29 circulations, 72 DEG C extend 5min again.
4.5by PCR primer in mass ratio be 1.2% sepharose on electrophoresis.
4.6result judges: if amplified production has the band of 354bp, namely indicate Escherichia coli O 157: the existence of H7; If amplified production does not have the band of 354bp, namely indicate without Escherichia coli O 157: the existence of H7.
Result shows, above-mentioned all samples amounts to 76 parts, Escherichia coli O 157: positive 12 parts of H7, wherein positive 9 parts of ight soil, positive 1 part of water chestnut, positive 2 parts of spinach.
SEQUENCELISTING
<110> Jiangsu Province Agriculture Science Institute
The PCR of <120> Escherichia coli O 157: H7 detects primer and detection kit
<130>0
<160>3
<170>PatentInversion3.1
<210>1
<211>18
<212>DNA
<213> is artificial
<220>
<221> upstream primer pZF
<222>(1)..(18)
<223>
<400>1
atgaataagaatctcatc18
<210>2
<211>18
<212>DNA
<213> is artificial
<220>
<221> downstream primer pZR
<222>(1)..(18)
<223>
<400>2
tttcttctcgcagtttcg18
<210>3
<211>354
<212>DNA
<213> is artificial
<220>
<221> conservative gene fragment
<222>(1)..(354)
<223>
<400>3
atgaataagaatctcatcctcgcatttgcattattttccttacctgtatttgcagaagaa60
gatctggggccaggcaaatatgtttgtgacattaggatttccagcctggataccgctact120
caaattctgtcaaaatccgcaacagttctcgataatggaaacaatttcatcgttcaaatg180
ccaaatggagatcaattgtactctccagatctggaaaatgttgatgatggtataaaacaa240
aaagcaacaataggtggagtgacatttattcgtcgtccaacttttaacgatcgcttcatc300
gtggaagatggaaatacaggattcttctataagatgcgaaactgcgagaagaaa354
Claims (2)
1. the PCR of Escherichia coli O 157: H7 detects a primer, and it is characterized in that: be made up of sequence SEQIDNO.1 and SEQIDNO.2, amplified production is 354bp:
SEQIDNO.1：5-atgaataagaatctcatc-3
SEQIDNO.2：5-tttcttctcgcagtttcg-3。
2. the detection Escherichia coli O 157 containing primer described in claim 1: the test kit of H7, is characterized in that, test kit comprises PCR premixed liquid and archaeal dna polymerase, and described PCR premixed liquid comprises:
The reaction system of every 22uL comprises the MgCl of dNTPs2.0uL, 25mM of 10 × PCR damping fluid 2.5uL, 2.5mM
21.5uL, each 0.2uL of the primer of 20pmol/uL base sequence as shown in SEQIDNO.1 and SEQIDNO.2, ultrapure water 15.6uL;
Each detection reaction cumulative volume 25uL, containing 22uLPCR premixed liquid, archaeal dna polymerase 1uL, DNA profiling 2uL to be checked.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410130211.7A CN103866031B (en) | 2014-04-02 | 2014-04-02 | The PCR of Escherichia coli O 157: H7 detects primer and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410130211.7A CN103866031B (en) | 2014-04-02 | 2014-04-02 | The PCR of Escherichia coli O 157: H7 detects primer and detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103866031A CN103866031A (en) | 2014-06-18 |
| CN103866031B true CN103866031B (en) | 2016-02-10 |
Family
ID=50905032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410130211.7A Expired - Fee Related CN103866031B (en) | 2014-04-02 | 2014-04-02 | The PCR of Escherichia coli O 157: H7 detects primer and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103866031B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862394B (en) * | 2015-05-11 | 2019-02-12 | 昆明理工大学 | It is a kind of for detecting the primer and its methods and applications of Escherichia coli |
| CN109652574B (en) * | 2019-02-22 | 2021-08-10 | 华南理工大学 | CPA primer of Escherichia coli O157H 7, kit and detection method |
| CN109988852A (en) * | 2019-04-17 | 2019-07-09 | 江苏省农业科学院 | A kind of enterohemorrhagic escherichia coli O157:H7 detection kit and its application |
| CN110923348B (en) * | 2019-12-23 | 2022-09-16 | 河北农业大学 | Primer and method for identifying five pilus genes of escherichia coli at one time |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845513A (en) * | 2009-12-25 | 2010-09-29 | 福建出入境检验检疫局检验检疫技术中心 | One-step RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection reagent kit for Cucumber green mottle mosaic virus and detection method thereof |
| CN102191315A (en) * | 2010-03-17 | 2011-09-21 | 山东出入境检验检疫局检验检疫技术中心 | Method for detecting provenance of tunny in fish product |
-
2014
- 2014-04-02 CN CN201410130211.7A patent/CN103866031B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845513A (en) * | 2009-12-25 | 2010-09-29 | 福建出入境检验检疫局检验检疫技术中心 | One-step RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection reagent kit for Cucumber green mottle mosaic virus and detection method thereof |
| CN102191315A (en) * | 2010-03-17 | 2011-09-21 | 山东出入境检验检疫局检验检疫技术中心 | Method for detecting provenance of tunny in fish product |
Non-Patent Citations (1)
| Title |
|---|
| PCR法检测食品中大肠杆菌O157：H7;巢强国等;《食品科学》;20100415;第31卷(第8期);摘要，第213页左栏第1段、第1节、第2节、表1、图1，第214页左栏第1段、第2.3节、右栏第1段，第215页第3节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103866031A (en) | 2014-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022644A (en) | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables | |
| CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
| CN105671197B (en) | A kind of detection method of food-borne pathogens Listeria monocytogenes | |
| CN104450940B (en) | A kind of nucleotide sequence and detection method and detection kit for detecting Listeria Monocytogenes | |
| CN103866031B (en) | The PCR of Escherichia coli O 157: H7 detects primer and detection kit | |
| Sahu et al. | Rapid detection of Salmonella contamination in seafoods using multiplex PCR | |
| Aklilu et al. | MCR-1 gene encoded colistin-resistant Escherichia coli in raw chicken meat and bean sprouts in Malaysia | |
| CN109486972A (en) | A kind of CPA primer sets for detecting pseudomonas aeruginosa, CPA nucleic acid test strip kit and its application | |
| Heo et al. | Rapid detection of Listeria monocytogenes by real-time PCR in processed meat and dairy products | |
| CN104232784A (en) | Multiplex PCR (polymerase chain reaction) method for testing three main pathogens in beef | |
| CN104662146A (en) | Culture medium for food poisoning bacteria, and method for detecting food poisoning bacteria | |
| CN102337344B (en) | Quantitative detection method of escherichia coli in soil and assay kit thereof | |
| CN101363061A (en) | Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food | |
| CN104152546A (en) | Kit and method for simultaneously detecting salmonella, listeria monocytogenes and staphylococcus aureus | |
| CN104561295B (en) | A kind of purpose nucleotide sequence and detection kit and detection method for detecting the rugged Cronobacter sakazakii of slope | |
| CN104726550A (en) | Kit for detecting staphylococcus aureus viable cells in food | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN108018364A (en) | A kind of kit and detection method of absolute quantitation detection vibrio parahemolyticus | |
| CN110846423A (en) | Fluorescent quantitative PCR (polymerase chain reaction) rapid detection method for pseudomonas fluorescens, kit and application | |
| CN102936625B (en) | Molecular motor biosensor kit used in vibrio parahaemolyticus molecular typing | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN103866030B (en) | The LAMP detection primer of Escherichia coli O 157: H7 and detection kit | |
| Rotundo et al. | Evaluation of PCR-based methods for the identification of enteroaggregative hemorrhagic Escherichia coli in sprouts | |
| CN103981270A (en) | Photobacterium damsela rapid detection primer, kit and application | |
| CN106755411A (en) | The real-time fluorescence quantitative PCR quick detection primer and its kit of marine product vibrio parahemolyticus toxR genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160210 |